Introduction

Several research reports have demonstrated that plasmid DNA immunization is able to induce a diversity of immune responses against a variety of infectious and non-infectious diseases (reviewed by Stenvenson et al. 2004; Donnelly et al. 2005; Anderson and Schneider 2007). The administration of plasmid DNA encoding a target gene via different routes (e.g., intramuscular, intradermal, subcutaneous) and vehicles is capable of generating cytotoxic T lymphocyte, T helper (Th) cells, and antibody responses in a variety of animal models (Doolan et al. 1996; Donnelly et al. 1997; Garg and Tarleton 2002; Otten et al. 2004; Speiser et al. 2005). However, a Th1 immune response profile is preferentially produced by this genetic immunization methodology probably due to the effect of the plasmid DNA adjuvant, which is also responsible for the selective activation of CD4+ T cells with a Th1 phenotype generation (Raz et al. 1996; Leclerc et al. 1997).

The balance between Th1 and Th2 immune response activation may be an important question to be addressed during the rational vaccine development process. In this context, African trypanosomiasis (AT) may be a good example of polarized Th1 immune response activation. The causative agent of AT is an extra-cellular protozoan called Trypanosoma brucei that is transmitted by the bite of the infected tsetse fly (Glossina sp.). There are three subspecies of these parasites, denominated T. brucei brucei, T. brucei gambiense, and T. brucei rhodesiense. T. brucei brucei causes animal trypanosomiasis; T. brucei gambiense and T. brucei rhodesiense are the causative agents of human AT and denominated sleeping sickness. The World Health Organization estimates that several hundred thousand people are currently infected with T. brucei and live in endemic areas (Simarro et al. 2008).

In the natural course of the AT infection, the interactions between the T. brucei and the host, preferentially induce an early Th1 polarized immune response profile, characterized by the release of inflammatory mediators and the secretion of gamma-interferon (IFN-γ), tumor necrosis factor (TNF), and interleukin (IL)-2 cytokines in response to some of the parasite’s antigens (Hertz et al. 1998; Namangala et al. 2001; Drennan et al. 2005). Thus, the Th1 immune response may be important in the immunopathological consequences of AT and which relative resistance to AT is associated with a strong Th1 immunity with IFN-gamma cytokines production, which is a contribute linker to host resistance.

To find appropriate parasites targets for vaccine and drugs, development is a constant challenge in biomedical research, albeit the difficulty in the identification and characterization of these targets. The trans-sialidase enzyme may represent a promising target for the development of therapeutics to treat infections caused by Trypanosoma parasites (Neres et al. 2008). In this context, T. brucei and several microorganisms make use of nTSA, a membrane-associated enzyme that transfers sialic acid from sialylated glycoconjugates present in the host’s cell surface to acceptor molecules on the parasites’ surface (Schenkman et al. 1991).

The sialic acid confers a negative charge that may dramatically change the biological properties of a given surface molecule. In Trypanosoma cruzi parasites, the etiological agent of Chagas disease, these sugar residues have been implicated in some biological processes, including cell–cell interactions and T-cell activation, a key for their survival in the blood (Tribulatti et al. 2005). However, the biological function and molecular characterization of the trans-sialidase from T. brucei is poorly investigated. Thus, trans-sialidase from T. brucei (TbTSA) may be a potential antigen target for vaccine development due to its fundamental role in the production of sialylated glycoconjugates on the parasites surface, constantly interacting with host’s immune system.

In order to investigate this hypothesis, we studied in this work the ability of a plasmid DNA vaccine encoding a TbTSA sequence to induce humoral and protective immune responses against T. brucei brucei parasites in the murine model.

Materials and methods

Reagents and buffers

Reagents: LB Broth (Sigma—USA), LB Agar (Sigma—USA), o-phenylenediamine (OPD; Sigma—USA), prestained SDS-PAGE standards (Bio-Rad—USA), protein stain (Coomassie brilliant blue R 0.25% w/v, 40% v/v methanol, and 7% v/v acetic acid—Sigma—USA), Tween® 20 (Sigma—USA), T4 DNA ligase (Promega—USA). Buffers: citrate buffer pH 5.0 (0.1 M citric acid and sodium phosphate), phosphate buffer saline (PBS) pH 7.4 (0.13 M NaCl, 0.002 M KCl, 0.01 M Na2HPO4, and 0.001 M KH2PO4), Tris-acetate-EDTA (40 mM Tris, 20 mM acetic acid, 1 mM EDTA, pH 8.0), blotting buffer (25 mm Tris, 192 mM glycine, pH 8.3), SDS-sample buffer (62.5 mM Tris-HCl, pH 6.8, 2/SDS, 25% glycerol, 0.01% bromophenol blue).

Animals and parasites

BALB-c mice used in this work were obtained from Instituto de Higiene e Medicina Tropical, Lisbon—Portugal. These mice were used in the experimental infection with T. brucei brucei and the DNA immunization protocols. Mice were inoculated intraperitoneally with approximately 5.0 × 102 trypanosomes prepared by dilution of the frozen stabilate with PBS-glucose 20 mM pH 7.4. The cloned stabilate was T. brucei brucei GVR 35/1.5 which had been derived from trypanosomes originally isolated from a wildebeest in the Serengeti in 1966. This stabilate produces a chronic infection in mice, allowing them to survive for at least 30 days (Jennings 1993). In addition, this trypanosome mouse model has been extensively used to assess the efficacy of trypanocidal drug regimens to eliminate CNS trypanosomes (Jennings 1993; Atouguia et al. 1995; Fernandes et al. 1997).

Trans-sialidase gene amplification and cloning

Genomic DNA from T. brucei brucei was used as DNA template for TSA gene amplification by polymerase chain reaction (PCR) assay. The reaction was performed with 100 ng of genomic DNA, 100 pmol of each primer, 0.5 mM of each dNTPs (Bioline—Germany), 3 mM de MgCl2, 5 U Taq DNA polymerase—Biotaq™ DNA polymerase (Bioline—Germany), and NH4 buffer (Bioline—Germany). Specific primers (sense: 5′ATTATAGCTAGCATGGAGGAACTCCACCAAC′3 and antisense: 5′TAATCCCTTAAGTCAGTGCAGACAATAA′3) were designed to amplify the first 1,416 bp from the TSA gene (Gene Bank®—National Library of Medicine—National Center for Biotechnology Information, Bethesda—USA) with gene identification 11141754 (Montagna et al. 2002), denominated nTSA gene. The nTSA fragment was digested with NheI and AflII endonucleases (Fermentas—USA) and cloned in the commercial plasmid DNA vaccine backbone pVAX1 (Invitrogen, USA) and subsequently subcloned in a pET28a plasmid (Novagen—USA). Restriction analysis assays and automatic nucleotide sequence (outsourced to StabVida, Oeiras—Portugal) were used to assess the cloning of the nTSA into pVAX1 and pET28a plasmids.

Plasmid purification and DNA vaccination protocol

Plasmid DNA used for DNA immunization in BALB-c mice was prepared from 250 mL of Escherichia coli DH5α in 20 g/L LB Broth medium with 30 μg/mL (w/v) kanamycin (Bioline—UK). Plasmid purification was performed by standard alkaline lysis followed by hydrophobic interaction chromatography (Diogo et al. 2000). A group of five mice was immunized by injecting 100 μg (200 μl) of plasmid DNA encoding nTSA gene by intramuscular route. As a control groups, five mice were injected with 100 μg of plasmid pVAX1LacZ (Invitrogen—USA) and with 200 μl of PBS by the same route. After 12, 35, and 50 days, post-immunization blood samples were collected from terminal tail of the mice. The sera were pooled and stored at −20°C until further use.

Total protein extract from T. brucei brucei

Blood collected from mice infected with T. brucei brucei was used to purify the bloodstream forms of the parasites using a gravity-operated DEAE-cellulose chromatography column (Lanham and Godfrey 1970) equilibrated with PBS-glucose 20 mM pH 7.4. The parasite-containing fractions were centrifuged, and the pellets were washed three times. A crude parasite lysate was obtained by three freeze-thaw cycles. The total protein content was measured using the BCAProtein Assay (Pierce, Rockford—USA).

Enzyme-linked immunosorbent assay (ELISA)

Total IgG antibody was measured by ELISA using sera samples from mice in the immunized and control groups. Previously, 96-well microplates (Nunc—Denmark) were coated with 100 ng/well of total protein extract from T. brucei brucei in carbonate buffer pH 8.5 overnight at 4°C. The microplates were washed three times with PBS = 0.05% Tween (Promega—USA) and blocked for 1 h at room temperature with 5% (w/v) powder milk suspension in PBS. After three washes, serial dilution of each pool of the immunized mice sera were added in duplicate and incubated for 2 h at room temperature with horseradish peroxidase (HRP)-conjugated anti-mouse IgG (Sigma Chemical Co.—USA) diluted 1:4,000 (v/v). The HRP-conjugated antibodies containing microplates were left to develop for 30 min with a substrate solution made up of 10 mL of citrate buffer pH 5.0 with 10 mg of OPD and 10 μL of hydrogen peroxide 30% (v/v; both from Sigma—USA). Finally, the reaction was stopped by the addition of 4 N sulfuric acid and the absorbance was measured at 492 nm.

Electrophoresis and Western blotting

The recombinant nTSA protein expression in E. coli cells was analyzed by SDS-PAGE under reducing conditions (samples were denatured for 5 min in boiling water) and immunobloting assays. E. coli BL21 (DE3) cells were transformed with pET28a encoding the nTSA gene, and protein expression was induced with 0.5 mM IPTG. After 3 h of induction, cells were centrifuged and the pellet was suspended in PBS. Subsequently, cells were suspended in SDS sample buffer and subjected to SDS-PAGE and then stained with Coomassie Brilliant Blue. Gels were blotted onto PVDF membranes (Bio-Rad, USA) which were blocked three times with PBS 1% BSA. The membranes were incubated with sera from immunized and unimmunized mice diluted in PBS (1:1,000) for 1 h at room temperature on shaking. Membranes were washed three times with PBS 0.05% Tween-20 for 10 min. Finally, the antigen-antibody reaction was developed by addition of goat anti-mouse IgG alkaline phosphate-conjugate antibody (Novagen—USA) using NBT/BCIP substrates, according to the manufacturer’s instructions.

Protective assay in vaccinated mice

After 175 days of immunization, mice in vaccinated and control groups were submitted to the challenge assay, performed by intraperitoneal injection of 500 parasites (T. b. brucei GVR 35 1.5) per animal. The period of survival, defined as the number of days after infection that the infected animals remain alive, was evaluated. The presence or absence of T. brucei in the blood was monitored daily by optical microscopy and survival assessed.

Results

Gene cloning and plasmid construction

Blood obtained from BALB-c mice infected with T. brucei brucei parasites was used to isolate genomic DNA from T. brucei brucei. This material was then used as a template to amplify by PCR (result not shown) the 5-terminal segment from the nTSA gene, constituted by 1,416 bp. This segment (denominated here nTSA) which codes for a 50 kDa N-terminal fragment of the trans-sialidase protein was then cloned into the plasmid DNA vaccine backbone, pVAX1, and into the prokaryotic expression plasmid, pET28a. The first plasmid, nTSApVAX1, was used as a DNA vaccine prototype, whereas the second one, nTSApET28a, was used to express recombinant nTSA protein in E. coli bacteria. Following characterization by restriction analysis and nucleotide sequencing (results not shown), the nTSApVAX1 plasmid was synthesized in vivo in E. coli cells and subsequently purified by column chromatography.

Anti-trypanosoma IgG antibodies measured in vaccinated mice

In order to analyze the humoral immune response induced by DNA vaccination with nTSApVAX1 plasmid, sera samples were obtained after 12, 35, and 50 days post-immunization from three groups of five BALB-c mice immunized intramuscularly with a single dose of 100 μg of nTSApVAX1, 100 μg of pVAX1LacZ, or 100 μL PBS. ELISA assay was conducted using a total protein extract from T. brucei brucei as an antigen source. The humoral immune response was measured and results are represented from pool of sera from each group. The anti-trypanosoma IgG antibody titers are shown in Fig. 1 as a plot of the relation between optical density (OD) and the course of immunization. These data demonstrate that OD increase in function of the time in sera samples obtained from mice vaccinated with nTSApVAX1, when compared with control groups (PBS and pVAX1LacZ). These results suggest that the titer of IgG antibody anti-trypanosoma increases as a function of the days post immunization, whereas maximum OD was obtained after 50 days post-immunization with nTSApVAX1 (Fig. 1c). Additionally, both control groups constituted of the PBS and pVAX1LacZ show minimal OD during the whole time of immunization.

Fig. 1
figure 1

IgG humoral immune response elicited by DNA vaccination. Three groups of mice were immunized with 100 μg of nTSApVAX1 plasmid, 100 μg of pVAX1LacZ plasmid, and 100 μl of phosphate buffer saline alone by intramuscular way. Humoral immune response was measured 12 (a), 35 (b), and 50 days after immunization (c). These results are represented from pool of sera from five animals per group

nTSA recombinant protein production and immunoidentification

The immunoreactivy of anti-Trypanosoma IgG antibody from immunized mice with nTSApVAX1, previously measured by ELISA (Fig. 1), was determined by Western Blotting with nTSA recombinant protein express in E. coli and visualized by SDS-PAGE after stimulated with IPTG (Fig. 2b). The Fig. 2c shows that the pool of sera obtained from nTSApVAX1 immunized group after 50 days post immunization reacts with a band about 50 kDa, equivalent to nTSA recombinant protein. This reaction was not detectable in control groups, constituted by PBS and pVAX1LacZ (results not shown). These results show that the protein of about 50 kDa is the recombinant nTSA expressed in E. coli under IPTG induction. Additionally, these results suggest that the reactivity of the anti-trypanosoma IgG antibodies detected by ELISA against T. brucei total protein is mainly that of anti-nTSA antibodies, since they react with the nTSA recombinant protein.

Fig. 2
figure 2

Immunodetection of antibodies in the sera of Balb-c mice immunized intramuscularly with a single 100 μg dose of nTSApVAX1 plasmid DNA vaccine. An SDS-PAGE was run with a protein extract of E. coli cells transformed with plasmid nTSApET28a and grown without (a) or with (b) IPTG induction. Samples run on the adjacent SDS-PAGE gel were blotted on PVDF membranes and made to react with sera of immunized mice collected 50 days post-immunization (c)

Protective effect of DNA vaccination against T. brucei infection

In order to analyze the protective response vaccinated with nTSApVAX1 plasmid and control groups (PBS and pVAX1LacZ), challenge assay was performed after 175 days post-immunization. The infection was monitored by evaluating survival and the presence or absence of parasites in the blood during infection with T. brucei, determined by optical microscopy. After 45 days post-infection (PI), 100% of control groups (PBS and pVAX1LacZ) were dead, whereas immunized group with nTSApVAX1 remained alive, with a protection rate of 60% (Table 1). For all groups, deaths were observed after 25 days PI, whereas 100% of mortality was observed after 35 and 45 days PI for control groups injected with pVAX1LacZ and PBS, respectively (Fig. 3). In the case of immunized group with nTSApVAX1, 40% of mortality was observed after 30 days PI (Fig. 3). These results demonstrated the influence of nTSApVAX1 DNA vaccination during the mortality and survival of infection caused by T. brucei brucei parasites.

Table 1 The mortality and protection race of different groups challenged by T. brucei brucei
Fig. 3
figure 3

Survival after testing challenge of the animals immunized Balb-c in the days post infection with T. brucei brucei

Discussion

The experimental murine model of human African sleeping sickness has been extensively applied to the study of immunopathological reactions, similar to those shown in larger mammalian hosts using T. brucei brucei infections (Eckersall et al. 2001; Kennedy 2000). In this work, this model was used to study humoral immune response after DNA vaccination and allowed us to analyze the progress of African trypanosomiasis infection in vaccinated mice. We have selected the TbTSA as an antigenic candidate on the basis of the promising results obtained by others with the TSA from T. cruzi (TcTSA) when developing a DNA vaccine against Chagas’ disease (Costa et al. 1998 and 1999; Pereira-Chioccola et al. 1999; Araújo et al. 2005; Hoft et al. 2007). Because TbTSA has a significantly high degree of structural and biochemical similarity with TcTSA, we expected that this approach could yield similar results.

In T. cruzi, TcTSA is highly immunogenic, is expressed as a surface protein, and represents an important antigen recognized by sera from patients with Chagas’ disease (Pereira-Chiocola et al. 2003). In addition, several works show that TcTSA is able to stimulate cellular immune response, as TcTSA can stimulate murine macrophages and human monocyte to produce pro-inflammatory cytokines (Golgher and Gazzinelli 2004; Gao and Pereira 2001). Different from T. cruzi, some studies show that TbTSA is expressed only on the surface of the procyclic forms of T. brucei (Montagna et al. 2002, 2006). However, the immunogenic properties and the function of TbTSA are not completely reveled.

Our work provides evidence that DNA immunization of BABL-c mice with 100 μg of a plasmid (nTSApVAX1) which encodes the catalytic and amino-terminal domain of TbTSA induces a humoral immune response. This response is characterized by the production of IgG antibodies that bind specifically to a total protein extract purified from bloodstream forms of T. brucei brucei parasites and to a recombinant TbTSA produced in E. coli. Additionally, the immunization conferred a 60% protection to vaccinated BALB-c mice challenged with infective form of T. brucei brucei, when compared with control groups.

Although the precise mechanism which governs the antibody production and protective response were not addressed, our results show that antibodies that recognize TbTSA are involved in this protective immune response against T. brucei infection. In addition, a probable Th1 immune response activation may be involved in the immunoprotection phenomenon presented by nTSApVAX1 intramuscular vaccination. This speculation is based on the evidence that bacterial DNA containing CpG motifs are potent activators of the immune system and that this phenomenon may play a critical role in the efficacy of the DNA vaccine to induce preferentially a Th1 phenotype (Halpern et al. 1996; Krieg et al. 1995). Thus, the critical protective effect of nTSApVAX1 vaccination could be due to immunostimulatory CpG sequence, antigen encoding nTSA sequence, or both. However, we can conclude here that the protective activity presented by nTSApVAX1 immunization must be the nTSA gene expression, once that the control plasmid (pVAX1LacZ) that has the same CpG content, does present the similar protective activity as nTSApVAX1.

In experimental African trypanosomiasis, several studies have emphasized the importance of Th1/Th2 cytokines balance in the modulation the immune response and controlling the intensity of the disease. The relative resistance to African trypanosomiasis is associated with a strong Th1 immune response to parasite antigens and that gamma-interferon (IFN-γ) but not interleukin (IL)-4 is linked to host resistance (Liu et al. 1999; Uzonna et al. 1998; Hertz et al. 1998; Schopf et al. 1998). Another study shows that resistance to T. brucei brucei has been correlated with the ability of infected animals to produce Th1 cytokines, such as (IFN-γ) and TNF, in an early phase of infection, followed by IL-4 and IL-10 in late and chronic stages of the disease (Namangala et al. 2001). In addition, the participation of Th2 cytokines (e.g., IL-4, IL-5, and IL-10) in the immune response of infected mice is attributed to the control of exacerbated Th1 cytokines production in order to prevent the excessive production of Th1 cytokines.

Thus, the cytokine production may maintain the balance between pathogenic and protective immune responses during the infection. The current idea in which Th1 immune response is associated with the resistance to the African trypanosomiasis in murine model supports our hypothesis that vaccination with plasmid DNA, while inducing a Th1 immune response, may be responsible for the protective event observed in mice vaccinated with nTSApVAX1 and challenged with T. brucei brucei parasites. Another interesting finding of our study is the fact of immunized sera (nTSApVAX1) binding to total proteins of the bloodstream forms of T. brucei. This fact suggests (1) that TbTSA is also expressed in the bloodstream forms of T. brucei (similarly that it happens with T. cruzi) or (2) the presence of a TbTSA-like protein in the bloodstream forms of the T. brucei, with cross-reactivity property to anti-nTSA antibodies. However, this phenomena needs to be investigated.

In conclusion, this work shows that intramuscular immunization with a plasmid DNA encoding N-terminal TbTSA is able to induce an IgG antibody able to bind to total protein extract from T. brucei brucei parasites and recombinant nTSA protein. An important observation in our study was the fact that 60% of mice immunized with nTSApVAX1 were protected from infection. Thus, this work opens up the possibility of new investigation for AT vaccine development using TSA as a promising antigen target for immune intervention strategies in AT.