European Journal of Nutrition

, Volume 56, Issue 2, pp 715–726 | Cite as

Methylation patterns of Vegfb promoter are associated with gene and protein expression levels: the effects of dietary fatty acids

  • Roberto Monastero
  • Sara García-Serrano
  • Ana Lago-Sampedro
  • Francisca Rodríguez-Pacheco
  • Natalia Colomo
  • Sonsoles Morcillo
  • Gracia M. Martín-Nuñez
  • Juan M. Gomez-Zumaquero
  • Eduardo García-Fuentes
  • Federico Soriguer
  • Gemma Rojo-Martínez
  • Eva García-Escobar
Original Contribution

Abstract

Purpose

We have investigated the epigenetic regulation by dietary fatty acids of Vegfb levels in rats’ white adipose tissue and 3T3-L1 cells.

Methods

A group of rats were assigned to three diets, each one with a different composition of saturated, monounsaturated and polyunsaturated fatty acids. Samples of white adipose tissues were taken for the methylation and expression studies. Additionally, 3T3-L1 cells were treated with palmitic, oleic, and linoleic fatty acids. After treatment, cells were harvested and genetic material was extracted for the analysis of Vegfb levels.

Results

We report evidence of changes in the methylation levels of the CpG island at the Vegfb promoter and in the Vegfb expression levels in vivo and in vitro by dietary fatty acid, with the main contribution of the linoleic fatty acid. Vegfb promoter methylation levels were closely related to the Vegfb gene expression.

Conclusion

According to our results, the regulation of Vegfb gene expression by dietary fatty acids may be mediated, at least in part, by epigenetic modifications on Vegfb promoter methylation. Considering the deep association between angiogenesis and tissue growth, we suggest the nutriepigenetic regulation of Vegfb as a key target in the control of the adipose tissue expansion.

Keywords

Adipose tissue Dietary fatty acids Gene expression Nutriepigenetic regulation Vegfb 

Notes

Acknowledgments

We gratefully acknowledge the help of Ron Askew-Reeves for the English corrections of this manuscript. The research group belong to the “Centros de Investigación Biomédica en Red” (CIBERDEM CB07/08/0019) of the Instituto de Salud Carlos III. We acknowledge the very useful assistance provided by the Plataforma de Genomica ECAI of the IBIMA Institute. This study was undertaken with finance from the Fondo de Investigación Sanitaria of the Instituto de Salud Carlos III and the Fondo Europeo de Desarrollo Regional FEDER (PI11/00880 and PI12/01293), Metabolism and Nutrition Network (RCMYN C03-08) and Junta de Andalucía (02/03, 125/02, 115/02).

Author contributions

EG-E, GR-M and FS designed research; EG-E, RM, AL, SG-S, GMM-N, FR-P and JMG-Z performed the experiments; EG-E, NC, SM, FS, EG-F contributed to discussion; EG-E and GR-M analyzed data and wrote the paper. All authors have read and reviewed the manuscript.

Compliance with ethical standards

Conflict of interest

Authors have nothing to disclose.

Supplementary material

394_2015_1115_MOESM1_ESM.tif (991 kb)
Supplementary Figure 1 3T3-L1 differentiated adipocytes at day 10 after differentiation induction. 10X images of 3T3-L1 cells at day 10 after differentiation induction. (A) More than 90% of cells showed the typical morphology of differentiated adipocytes. (B) The cells were fixed and then incubated with oil red O; lipid droplets appears stained in red (TIFF 990 kb)
394_2015_1115_MOESM2_ESM.tif (560 kb)
Supplementary Figure 2 Expression levels of apoptosis pathway and cell stability markers in 3T3-L1 cells treated with fatty acids. (A) BCL2, (B) caspase 3 and (C) P53, relative to β-actin gene expression levels of 3T3-L1 cells treated with 100 μM of palmitate, oleate and linoleate (white bars) referred to the Control group C_DMEM (gray bar). Gene expression levels in the presence of NaOH were also measured (striped bars). The primers used in the experiments were Forward β-actin: GCATGGATTTACGCACAATG, Reverse β-actin: AGTTGGTTCTAGCCCCAGTG; Forward BCL2: GGTGGTGGAGGAACTCTTCA, Reverse BCL2: ATGCCGGTTCAGGTACTCAG; Forward Casp3: GTCTGACTGGAAAGCCGAAA, Reverse Casp3: CCACTGTCTGTCTCAATACCG and Forward P53: TGGAAGACTCCAGTGGGAAC, Reverse P53: TCTTCTGTACGGCGGTCTCT. Bars are means ± SD. (TIFF 560 kb)

References

  1. 1.
    Boden G, Chen X, Iqbal N (1998) Acute lowering of plasma fatty acids lowers basal insulin secretion in diabetic and nondiabetic subjects. Diabetes 47(10):1609–1612CrossRefGoogle Scholar
  2. 2.
    Clore JN, Allred J, White D, Li J, Stillman J (2002) The role of plasma fatty acid composition in endogenous glucose production in patients with type 2 diabetes mellitus. Metabolism 51(11):1471–1477CrossRefGoogle Scholar
  3. 3.
    Eckardt K, Taube A, Eckel J (2011) Obesity-associated insulin resistance in skeletal muscle: role of lipid accumulation and physical inactivity. Rev Endocr Metab Disord 12(3):163–172CrossRefGoogle Scholar
  4. 4.
    Hagberg CE, Falkevall A, Wang X, Larsson E, Huusko J, Nilsson I et al (2010) Vascular endothelial growth factor B controls endothelial fatty acid uptake. Nature 464(7290):917–921CrossRefGoogle Scholar
  5. 5.
    Li X, Tjwa M, Van Hove I, Enholm B, Neven E, Paavonen K et al (2008) Reevaluation of the role of VEGF-B suggests a restricted role in the revascularization of the ischemic myocardium. Arterioscler Thromb Vasc Biol 28(9):1614–1620CrossRefGoogle Scholar
  6. 6.
    Hagberg CE, Mehlem A, Falkevall A, Muhl L, Fam BC, Ortsater H et al (2012) Targeting VEGF-B as a novel treatment for insulin resistance and type 2 diabetes. Nature 490(7420):426–430CrossRefGoogle Scholar
  7. 7.
    Gealekman O, Burkart A, Chouinard M, Nicoloro SM, Straubhaar J, Corvera S (2008) Enhanced angiogenesis in obesity and in response to PPARgamma activators through adipocyte VEGF and ANGPTL4 production. Am J Physiol Endocrinol Metab 295(5):E1056–E1064CrossRefGoogle Scholar
  8. 8.
    Bry M, Kivela R, Holopainen T, Anisimov A, Tammela T, Soronen J et al (2010) Vascular endothelial growth factor-B acts as a coronary growth factor in transgenic rats without inducing angiogenesis, vascular leak, or inflammation. Circulation 122(17):1725–1733CrossRefGoogle Scholar
  9. 9.
    Karpanen T, Bry M, Ollila HM, Seppanen-Laakso T, Liimatta E, Leskinen H et al (2008) Overexpression of vascular endothelial growth factor-B in mouse heart alters cardiac lipid metabolism and induces myocardial hypertrophy. Circ Res 103(9):1018–1026CrossRefGoogle Scholar
  10. 10.
    Feil R, Fraga MF (2011) Epigenetics and the environment: emerging patterns and implications. Nat Rev Genet 13(2):97–109Google Scholar
  11. 11.
    Shen W, Wang C, Xia L, Fan C, Dong H, Deckelbaum RJ et al (2014) Epigenetic modification of the leptin promoter in diet-induced obese mice and the effects of N-3 polyunsaturated fatty acids. Sci Rep 4:5282Google Scholar
  12. 12.
    Burdge GC, Lillycrop KA (2010) Bridging the gap between epigenetics research and nutritional public health interventions. Genome Med 2(11):80CrossRefGoogle Scholar
  13. 13.
    Gabory A, Attig L, Junien C (2011) Developmental programming and epigenetics. Am J Clin Nutr 94(6 Suppl):1943S–1952SCrossRefGoogle Scholar
  14. 14.
    Simmons R (2011) Epigenetics and maternal nutrition: nature v. nurture. Proc Nutr Soc 70(1):73–81CrossRefGoogle Scholar
  15. 15.
    Matouk CC, Marsden PA (2008) Epigenetic regulation of vascular endothelial gene expression. Circ Res 102(8):873–887CrossRefGoogle Scholar
  16. 16.
    Hellebrekers DM, Melotte V, Vire E, Langenkamp E, Molema G, Fuks F et al (2007) Identification of epigenetically silenced genes in tumor endothelial cells. Cancer Res 67(9):4138–4148CrossRefGoogle Scholar
  17. 17.
    Vallim T, Salter AM (2010) Regulation of hepatic gene expression by saturated fatty acids. Prostaglandins Leukot Essent Fatty Acids 82(4–6):211–218CrossRefGoogle Scholar
  18. 18.
    Salter AM, Tarling EJ (2007) Regulation of gene transcription by fatty acids. Animal 1(9):1314–1320CrossRefGoogle Scholar
  19. 19.
    Liang H, Zhong Y, Zhou S, Li QQ (2011) Palmitic acid-induced apoptosis in pancreatic beta-cells is increased by liver X receptor agonist and attenuated by eicosapentaenoate. In Vivo 25(5):711–718Google Scholar
  20. 20.
    Margareto J, Marti A, Martinez JA (2001) Modification of RXRalpha expression according to the duration of a cafeteria diet. J Physiol Biochem 57(4):347–348CrossRefGoogle Scholar
  21. 21.
    Sabin MA, Crowne EC, Stewart CE, Hunt LP, Turner SJ, Welsh GI et al (2007) Depot-specific effects of fatty acids on lipid accumulation in children’s adipocytes. Biochem Biophys Res Commun 361(2):356–361CrossRefGoogle Scholar
  22. 22.
    Hommelberg PP, Plat J, Langen RC, Schols AM, Mensink RP (2009) Fatty acid-induced NF-kappaB activation and insulin resistance in skeletal muscle are chain length dependent. Am J Physiol Endocrinol Metab 296(1):E114–E120CrossRefGoogle Scholar
  23. 23.
    Dimopoulos N, Watson M, Sakamoto K, Hundal HS (2006) Differential effects of palmitate and palmitoleate on insulin action and glucose utilization in rat L6 skeletal muscle cells. Biochem J 399(3):473–481CrossRefGoogle Scholar
  24. 24.
    Burdge GC, Lillycrop KA (2014) Fatty acids and epigenetics. Curr Opin Clin Nutr Metab Care 17(2):156–161CrossRefGoogle Scholar
  25. 25.
    Reeves PG, Nielsen FH, Fahey GC Jr (1993) AIN-93 purified diets for laboratory rodents: final report of the American Institute of Nutrition ad hoc writing committee on the reformulation of the AIN-76A rodent diet. J Nutr 123(11):1939–1951Google Scholar
  26. 26.
    Soriguer F, Rojo-Martinez G, Dobarganes MC, Garcia Almeida JM, Esteva I, Beltran M et al (2003) Hypertension is related to the degradation of dietary frying oils. Am J Clin Nutr 78(6):1092–1097Google Scholar
  27. 27.
    Mikeska T, Felsberg J, Hewitt CA, Dobrovic A (2011) Analysing DNA methylation using bisulphite pyrosequencing. Methods Mol Biol 791:33–53CrossRefGoogle Scholar
  28. 28.
    Colyer HA, Armstrong RN, Sharpe DJ, Mills KI (2012) Detection and analysis of DNA methylation by pyrosequencing. Methods Mol Biol 863:281–292CrossRefGoogle Scholar
  29. 29.
    Soriguer F, Garcia-Serrano S, Garrido-Sanchez L, Gutierrez-Repiso C, Rojo-Martinez G, Garcia-Escobar E et al (2010) Jejunal wall triglyceride concentration of morbidly obese persons is lower in those with type 2 diabetes mellitus. J Lipid Res 51(12):3516–3523CrossRefGoogle Scholar
  30. 30.
    Altman DG (1990) Practical statistics for medical research, vol 91. Chapman & Hall, London, pp 218–223Google Scholar
  31. 31.
    Oster B, Linnet L, Christensen LL, Thorsen K, Ongen H, Dermitzakis ET et al (2013) Non-CpG island promoter hypomethylation and miR-149 regulate the expression of SRPX2 in colorectal cancer. Int J Cancer 132(10):2303–2315CrossRefGoogle Scholar
  32. 32.
    Xu H, Dong X, Ai Q, Mai K, Xu W, Zhang Y et al (2014) Regulation of tissue LC-PUFA contents, Delta6 fatty acyl desaturase (FADS2) gene expression and the methylation of the putative FADS2 gene promoter by different dietary fatty acid profiles in Japanese seabass (Lateolabrax japonicus). PLoS ONE 9(1):e87726CrossRefGoogle Scholar
  33. 33.
    Kiec-Wilk B, Razny U, Mathers JC, Dembinska-Kiec A (2009) DNA methylation, induced by beta-carotene and arachidonic acid, plays a regulatory role in the pro-angiogenic VEGF-receptor (KDR) gene expression in endothelial cells. J Physiol Pharmacol 60(4):49–53Google Scholar
  34. 34.
    Lomba A, Martinez JA, Garcia-Diaz DF, Paternain L, Marti A, Campion J et al (2010) Weight gain induced by an isocaloric pair-fed high fat diet: a nutriepigenetic study on FASN and NDUFB6 gene promoters. Mol Genet Metab 101(2–3):273–278CrossRefGoogle Scholar
  35. 35.
    Voisin S, Almen MS, Moschonis G, Chrousos GP, Manios Y, Schioth HB (2014) Dietary fat quality impacts genome-wide DNA methylation patterns in a cross-sectional study of Greek preadolescents. Eur J Hum Genet 23(5):654–662CrossRefGoogle Scholar
  36. 36.
    Lillycrop KA, Burdge GC (2011) Epigenetic changes in early life and future risk of obesity. Int J Obes (Lond) 35(1):72–83CrossRefGoogle Scholar
  37. 37.
    Zhang J, Zhang F, Didelot X, Bruce KD, Cagampang FR, Vatish M, Hanson M, Lehnert H et al (2009) Maternal high fat diet during pregnancy and lactation alters hepatic expression of insulin like growth factor-2 and key microRNAs in the adult offspring. BMC Genom 10:478CrossRefGoogle Scholar
  38. 38.
    Klein ME, Lioy DT, Ma L, Impey S, Mandel G, Goodman RH (2007) Homeostatic regulation of MeCP2 expression by a CREB-induced microRNA. Nat Neurosci 10:1513–1514CrossRefGoogle Scholar
  39. 39.
    Varambally S, Cao Q, Mani RS, Shankar S, Wang X, Ateeq B, Laxman B, Cao X et al (2008) Genomic loss of microRNA-101 leads to overexpression of histone methyltransferase EZH2 in cancer. Science 322:1695–1699CrossRefGoogle Scholar
  40. 40.
    Garcia-Serrano S, Moreno-Santos I, Garrido-Sanchez L, Gutierrez-Repiso C, Garcia-Almeida JM, Garcia-Arnes J, Rivas-Marin J, Gallego-Perales JL et al (2011) Stearoyl-CoA desaturase-1 is associated with insulin resistance in morbidly obese subjects. Mol Med 17:273–280CrossRefGoogle Scholar
  41. 41.
    Rasouli N, Yao-Borengasser A, Miles LM, Elbein SC, Kern PA (2006) Increased plasma adiponectin in response to pioglitazone does not result from increased gene expression. Am J Physiol Endocrinol Metab 290:E42–E46CrossRefGoogle Scholar
  42. 42.
    Hojbjerre L, Rosenzweig M, Dela F, Bruun JM, Stallknecht B (2007) Acute exercise increases adipose tissue interstitial adiponectin concentration in healthy overweight and lean subjects. Eur J Endocrinol 157:613–623CrossRefGoogle Scholar
  43. 43.
    Kiunga GA, Raju J, Sabljic N, Bajaj G, Good CK, Bird RP (2004) Elevated insulin receptor protein expression in experimentally induced colonic tumors. Cancer Lett 211:145–153CrossRefGoogle Scholar
  44. 44.
    Sotiropoulos KB, Clermont A, Yasuda Y, Rask-Madsen C, Mastumoto M, Takahashi J et al (2006) Adipose-specific effect of rosiglitazone on vascular permeability and protein kinase C activation: novel mechanism for PPARgamma agonist’s effects on edema and weight gain. FASEB J 20(8):1203–1205CrossRefGoogle Scholar
  45. 45.
    Bouloumie A, Lolmede K, Sengenes C, Galitzky J, Lafontan M (2002) Angiogenesis in adipose tissue. Ann Endocrinol (Paris) 63(2 Pt 1):91–95Google Scholar
  46. 46.
    Neels JG, Thinnes T, Loskutoff DJ (2004) Angiogenesis in an in vivo model of adipose tissue development. FASEB J 18(9):983–985Google Scholar
  47. 47.
    Iggman D, Rosqvist F, Larsson A, Arnlov J, Beckman L, Rudling M et al (2014) Role of dietary fats in modulating cardiometabolic risk during moderate weight gain: a randomized double-blind overfeeding trial (LIPOGAIN study). J Am Heart Assoc 3(5):e001095CrossRefGoogle Scholar
  48. 48.
    Bjermo H, Iggman D, Kullberg J, Dahlman I, Johansson L, Persson L et al (2012) Effects of n-6 PUFAs compared with SFAs on liver fat, lipoproteins, and inflammation in abdominal obesity: a randomized controlled trial. Am J Clin Nutr 95(5):1003–1012CrossRefGoogle Scholar
  49. 49.
    Martin-Nunez GM, Rubio-Martin E, Cabrera-Mulero R, Rojo-Martinez G, Olveira G, Valdes S, Soriguer F, Castano L et al (2014) Type 2 diabetes mellitus in relation to global LINE-1 DNA methylation in peripheral blood: a cohort study. Epigenetics 9:1322–1328CrossRefGoogle Scholar
  50. 50.
    Martin-Nunez GM, Cabrera-Mulero R, Rubio-Martin E, Rojo-Martinez G, Olveira G, Valdes S, Soriguer F, Castano L et al (2014) Methylation levels of the SCD1 gene promoter and LINE-1 repeat region are associated with weight change: an intervention study. Mol Nutr Food Res 58:1528–1536CrossRefGoogle Scholar
  51. 51.
    Nicoletti CF, Nonino CB, de Oliveira BA, Pinhel MA, Mansego ML, Milagro FI, Zulet MA, Martinez JA (2015) DNA methylation and hydroxymethylation levels in relation to two weight loss strategies: energy-restricted diet or bariatric surgery. Obes Surg. doi: 10.1007/s11695-015-1802-8 Google Scholar
  52. 52.
    Sanchez I, Reynoso-Camacho R, Salgado LM (2015) The diet-induced metabolic syndrome is accompanied by whole-genome epigenetic changes. Genes Nutr 10:471CrossRefGoogle Scholar
  53. 53.
    Pan H, Lin X, Wu Y, Chen L, Teh AL, Soh SE, Lee YS, Tint MT, MacIsaac JL, Morin AM, Tan KH, Yap F, Saw SM, Kobor MS, Meaney MJ, Godfrey KM, Chong YS, Gluckman PD, Karnani N, Holbrook JD, GUSTO Study Group (2015) HIF3A association with adiposity: the story begins before birth. Epigenomics 7(6):937–950CrossRefGoogle Scholar
  54. 54.
    Tajuddin SM, Amaral AF, Fernandez AF, Rodriguez-Rodero S, Rodriguez RM, Moore LE, Tardon A, Carrato A et al (2013) Genetic and non-genetic predictors of LINE-1 methylation in leukocyte DNA. Environ Health Perspect 121:650–656Google Scholar
  55. 55.
    Hsieh CL (1994) Dependence of transcriptional repression on CpG methylation density. Mol Cell Biol 14:5487–5494CrossRefGoogle Scholar
  56. 56.
    Boyes J, Bird A (1992) Repression of genes by DNA methylation depends on CpG density and promoter strength: evidence for involvement of a methyl-CpG binding protein. EMBO J 11:327–333Google Scholar
  57. 57.
    Mill J, Heijmans BT (2013) From promises to practical strategies in epigenetic epidemiology. Nat Rev Genet 14:585–594CrossRefGoogle Scholar

Copyright information

© Springer-Verlag Berlin Heidelberg 2015

Authors and Affiliations

  • Roberto Monastero
    • 1
    • 2
  • Sara García-Serrano
    • 1
    • 2
  • Ana Lago-Sampedro
    • 1
    • 2
  • Francisca Rodríguez-Pacheco
    • 1
    • 2
  • Natalia Colomo
    • 1
    • 2
  • Sonsoles Morcillo
    • 4
    • 5
  • Gracia M. Martín-Nuñez
    • 1
    • 2
  • Juan M. Gomez-Zumaquero
    • 3
  • Eduardo García-Fuentes
    • 1
    • 4
  • Federico Soriguer
    • 1
    • 2
  • Gemma Rojo-Martínez
    • 1
    • 2
  • Eva García-Escobar
    • 1
    • 2
  1. 1.UGC Endocrinología y Nutrición, Instituto de Investigación Biomédica de Málaga (IBIMA)Hospital Universitario Regional de MálagaMálagaSpain
  2. 2.CIBER de Diabetes y Enfermedades Metabólicas asociadas (CIBERDEM CB07/08/0019)Instituto de Salud Carlos IIIMálagaSpain
  3. 3.ECAI de Genomica del Instituto de Investigación Biomédica de Málaga (IBIMA)MálagaSpain
  4. 4.CIBER de Obesidad y Nutrición (CIBEROBN CB06/03/0018)Instituto de Salud Carlos IIIMálagaSpain
  5. 5.UGC Endocrinología y Nutrición, Instituto de Investigación Biomédica de Málaga (IBIMA)Hospital Universitario Virgen de la VictoriaMálagaSpain

Personalised recommendations