Correction to: Expanding tryptophan-containing cyclodipeptide synthase spectrum by identification of nine members from Streptomyces strains

Correction
Correction to: Applied Microbiology and Biotechnology
Fig. 1

Phylogenetic analysis of CDPSs from actinobacteria. The main CDPS products are given in parenthesis. Enzymes investigated in this study are highlighted in red

Table 1

Information on CDPSs identified in this study

CDPS

Accession number

Protein length (aa)

Primer sequences (5’-3’)

Cloning constructs in pGEM-T easy

Cloning sites in pET28a

Expression constructs

CWWS1D46488

WP_014141671

278

AACATATGCACGACAACGGTCATCGGCCC

TTGGATCCTTACGTCACCGGCT

pHY02

NdeI

BamHI

pHY34

CWWS2D46488

WP_014140974

234

GCCATATGCTGCATCGAACGTCCTT

TAGGATCCTCACGGCTCGGCGGGCAGTT

pHY01

NdeI

BamHI

pHY11

CWWS1NB2774

WP_078950527

265

CATATGACGATCACAGCTGACGCATCATTC

GGATCCTCAAGCTGCTCGACGCTCAT

pHY72

NdeI

BamHI

pHY82

CWWS1NB5737

WP_019889609

239

GCCATATGACTCTCATCGAAGACAC

GGATCCTCAAGCGGCTCGACGGTCAT

pHY08

NdeI

BamHI

pHY09

CWWS1NB5414

WP_063768158

273

CATATGAGGGCGATCACACAGGTGAC

GGATCCTCAAGCTGCTCGACGCTCAT

pHY77

NdeI

BamHI

pHY83

CWPS1NS1868

WP_078873129

241

CATATGAACACTTCCCTCGCTGC

GAATTCTCAGCGTTCGGCCGCCCGGTC

pHY103

NdeI

EcoRI

pHY107

CWLS1NF5053

WP_051847149

243

CATATGTGCGAGGGCGCCGATGTGC

GGATCCTCAGGATTCGTCCACCGG

pJL03

NdeI

BamHI

pJL26a

CWPS1NF5123

WP_052397358

263

CATATGACCAGCAGGACCGAAAC

GAATTCTCACGGAAGCAGCCGGGGG

pHY100

NdeI

EcoRI

pHY105

CWXS1NS1868

WP_078872750

267

CATATGGCCACACACGCCTCCGC

GAATTCTCACTGCTGCGTCACGTGGTC

pHY101

NdeI

EcoRI

pHY106

CWXS1NB3589

KOG90878

255

CATATGGGGGCCCCGCAGCCC

GGATCCTCACGTCAAGTCCCTTTCTCC

pJL02

NdeI

BamHI

pJL25

CWXS1NB24309

WP_078624487

282

GCGCATATGAGTGCATCGCAGGCTGCTG

GGATCCTCACGTCACGTCCCCTGC

pJL01

NdeI

BamHI

pJL24b

CFLS1NF5639

WP_031028810

278

CATATGAACCGCCGCTGTTCCTTCG

GGATCCTCATGCTCCTGGGGCACTG

pJL04

NdeI

BamHI

pJL29

CFLS1D41684

BAU83478

224

CGCATATGAACCAGTTCGACGTGCTGCC

GGATCCCCGGACCACGAGGAAGCC

pJL05

NdeI

BamHI

pJL30c

Restriction sites for cloning are underlined in primer sequences

a The 12 base pairs at the 5´-end of the sequence coding for WP_051847149 were not included in the expression construct pJL26

b The 96 base pairs at the 5´-end of the sequence coding for WP_078624487 were not included in the expression construct pJL24

c According to the annotation in database, BAU83478 comprises 484 amino acids and consists of CDPS sequence at its N-terminus and that for a putative methyltransferase at its C-terminus. The sequence coding for amino acids 1 - 224 of BAU83478 was cloned into pET28a generating pJL30

  https://doi.org/10.1007/s00253-018-8908-6

The original version of this article contained mistake. After careful re-examination of the LC-MS data, the products of CDPSs “WP_031028810” and “BAU83478” should be cFL instead of cPY. We apologize for any inconvenience that this may have caused.

Correct presentations given below:

The sixth sentence of the first paragraph in the Discussion Section:

“As shown in Fig. S10, WP_031028810 from Streptomyces sp. NRRL F-5639 and BAU83478 from Streptomyces laurentii DSM 41684 were proven to be responsible for the formation of cyclo-l-Pro-l-Tyr (cPY).”

should be changed to

“As shown in Fig. S10, WP_031028810 from Streptomyces sp. NRRL F-5639 and BAU83478 from Streptomyces laurentii DSM 41684 were proven to be responsible for the formation of cyclo-l-Phe-l-Leu (cFL).”

Copyright information

© Springer-Verlag GmbH Germany, part of Springer Nature 2018

Authors and Affiliations

  1. 1.Institut für Pharmazeutische Biologie und BiotechnologiePhilipps-Universität MarburgMarburgGermany

Personalised recommendations