Applied Microbiology and Biotechnology

, Volume 101, Issue 14, pp 5749–5763 | Cite as

Heavy metal accumulation by Saccharomyces cerevisiae cells armed with metal binding hexapeptides targeted to the inner face of the plasma membrane

  • Lavinia Liliana Ruta
  • Ralph Kissen
  • Ioana Nicolau
  • Aurora Daniela Neagoe
  • Andrei José Petrescu
  • Atle M. Bones
  • Ileana Cornelia Farcasanu
Applied genetics and molecular biotechnology

Abstract

Accumulation of heavy metals without developing toxicity symptoms is a phenotype restricted to a small group of plants called hyperaccumulators, whose metal-related characteristics suggested the high potential in biotechnologies such as bioremediation and bioextraction. In an attempt to extrapolate the heavy metal hyperaccumulating phenotype to yeast, we obtained Saccharomyces cerevisiae cells armed with non-natural metal-binding hexapeptides targeted to the inner face of the plasma membrane, expected to sequester the metal ions once they penetrated the cell. We describe the construction of S. cerevisiae strains overexpressing metal-binding hexapeptides (MeBHxP) fused to the carboxy-terminus of a myristoylated green fluorescent protein (myrGFP). Three non-toxic myrGFP-MeBHxP (myrGFP-H6, myrGFP-C6, and myrGFP-(DE)3) were investigated against an array of heavy metals in terms of their effect on S. cerevisiae growth, heavy metal (hyper) accumulation, and capacity to remove heavy metal from contaminated environments.

Keywords

Heavy metal Metal-binding hexapeptide Accumulation Saccharomyces cerevisiae 

Introduction

Maintaining a clean environment is the ultimate requirement to any activity producing hazardous sub-products, wastes, or accidental releases. Among the most widespread and long-known environmental hazards are heavy metals, a class of non-biodegradable pollutants resulting from various anthropogenic activities: mining, smelting, industrial production, agriculture, technological applications, all having a tremendous impact upon living organisms (Bradl 2002; He et al. 2005). Being natural components of the environment, the heavy metals are not easily removed by standard physicochemical methods, which sometimes are a secondary source of pollution themselves; this is why eco-friendly biotechnological approaches are preferred. Heavy metal bioremediation makes use of natural or engineered organisms to clean up the contaminated sites (Mosa et al. 2016). Ideally, a bioremediator combines two apparently contradictory traits: it takes up important amounts of the pollutant from the surroundings, while it does not develop the pollutant-related toxicity symptoms. In nature, this phenotype is encountered in a small group of plant species called heavy metal hyperaccumulators (for reviews, Krämer 2010; Farcasanu et al. 2012; Dalcorso et al. 2013; Leitenmaier and Küpper 2013; Pollard et al. 2014; Sharma et al. 2016); their metal-related characteristics prompted the basic principles of biotechnologies such as phytoremediation, phytomining, and phytoextraction (Rascio and Navari-Izzo 2011). Nevertheless, the natural hyperaccumulating plants are hardly suitable for bioremediation purposes as most produce little biomass (Krämer 2005). This is why attempts have been made to engineer various species, and the progress made in the understanding of the molecular mechanisms involved in heavy metal hyperaccumulation has paved the way to designing plants and microbes for improved bioremediation abilities (for review, Mosa et al. 2016). In fact, microorganisms are more often used in bioremediation to eliminate heavy metals (Mosa et al. 2016).

In this study, we investigated the possibility to engineer yeast cells for enhanced heavy metal accumulation, ultimately for bioremediation purposes. Numerous studies focused on the possibility to use yeast in heavy metal bioremediation (for review, Soares 2011; Soares and Soares 2012, 2013; Liu et al. 2016). The budding yeast Saccharomyces cerevisiae is a non-accumulator, but many molecular mechanisms involved in the heavy metal transport (Van Ho et al. 2002) and homeostasis (Ratherford and Bird 2004; Massé and Arguin 2005; Eide 2009; Reddi et al. 2009; Rosenfeld et al. 2010) have been elucidated in this organism, making it a suitable model for experiments aimed at manipulating the level of heavy metal accumulation. Additionally, this generally-regarded-as-safe (GRAS) microorganism has a high biosorptive capacity for heavy metals (Machado et al. 2008, 2009). This trait is conferred by the nature of the cell wall, which has an outer layer consisting of highly glycosylated proteins rich in negatively charged groups (phosphate and carboxylate), electrostatically binding metal ions to the cell surface (Brady et al. 1994; Francois 2016). To enhance the innate biosorbent capacity, the cell surface of yeast was engineered by the molecular display (arming) technology (Georgiou et al. 1997; Murai et al. 1997; Shibasaki et al. 2009). Using this technique, cells with improved heavy metal biosorption abilities were obtained (Kambe-Honjoh et al. 2000; Kuroda et al. 2001, 2002; Nakajima et al. 2001; Kuroda and Ueda 2003, 2006, 2010; Kotrba and Rumi 2010), with significant results in the removal and recovery of metals (Kuroda and Ueda 2010, Kuroda et al. 2014; Ito et al. 2016). In this study, we initiated a different approach, starting from the hypothesis that the accumulative capacity of yeast cells would be enhanced if the metal ions were bound/complexed in a non-toxic form immediately after crossing the cell membrane. The transport of heavy metals in yeast cells is carried out by an intricate system consisting of both high and low affinity components (Feldmann 2012). Once inside the cell, the metal toxicity is controlled by cation buffering (e.g., by phosphate and polyphosphate, yeast metallothionein, etc.) or sequestration in cell compartments, such as the vacuole (Blaby-Haas and Merchant 2014). In S. cerevisiae, the heavy metal accumulation is kept low through the excretion via the secretory pathway: the excess cations that penetrate the cells are rapidly pumped through the action of the ER and Golgi-localized Pmr1p to be furthered expelled from the cell via the secretory vesicles (Dürr et al. 1998; Lauer Júnior et al. 2008). Yeast cells defective in the Pmr1p pump were shown to accumulate heavy metals (Lapinskas et al. 1995) and were used as kamikaze cells to bioremediate synthetic effluents in a lab-scale experiment (Ruta et al. 2010) or to hyperaccumulate heavy metals by overexpressing the gene encoding the inorganic phosphate transporter Pho84p (Ofiteru et al. 2012). In the present study, we aimed at obtaining yeast cells armed with artificial metal-binding oligopeptides targeted not on the cell surface (Shibasaki et al. 2001, 2006) but to the inner face of the plasma membrane. This can be done by adding a myristoylation sequence (MGCTVSTQTI) at the amino terminus of a polypeptide; this sequence was shown to be sufficient for membrane association in yeast (Gillen et al. 1998). Hexapeptides containing amino acids with affinity for metal ions, namely, histidine (hexa-His/H6), cysteine (hexa-Cys/C6), and aspartate/glutamate (hexa-Asp/D6, hexa-Glu/E6, or DEDEDE/(DE)3), were attached by DNA manipulation to the carboxy-terminus of myristoylated GFP (myrGFP) and expressed in yeast cells to determine to which extent the attachments of metal-binding oligopeptides to cell membranes enhance the metal accumulation by metabolically active cells.

Materials and methods

Strains and culture conditions

The S. cerevisiae strains used in this study were isogenic with the “wild-type” (WT) parental strain BY4741 (MATa, his3Δ1, leu2Δ0, met15Δ0, ura3Δ0) (Brachmann et al. 1998). The knock-out mutant strains used were Y01367 (BY4741, zap1::kanMX4), Y04622 (BY4741, zrt1::kanMX4), and Y04087 (BY4741, zrt2::kanMX4). All strains were obtained from EUROSCARF (European S. cerevisiae Archive for Functional Analysis, www.euroscarf.de). Cell storage, growth, and manipulation were done as described (Sherman 2002). Strains were maintained and grown in standard YPD (yeast extract-polypeptone-dextrose); transformed strains were selected on SD (synthetic media with dextrose) or SG (synthetic media with galactose), supplemented with the necessary amino acids. Minimal defined media (MMe) were virtually metal free and were supplemented with the essential elements and with controlled metal concentrations prior to use. All media had pH adjusted to 6. For solid media, 2% agar was used. For growth improvement, all the synthetic media were supplemented with 40 mg/L leucine (Cohen and Engelberg 2007).

Plasmids

The DNA encoding myrGFP fused at the carboxy-terminus with metal binding hexapeptide sequences (MeBHxP-s) were amplified by PCR using plasmid pGREG596 (Jansen et al. 2005) as template. Plasmid pGREG596 harboring myrGFP under GAL1 promoter and URA3 as selectable marker was purchased from EUROSCARF, Germany. The primers used to introduce MeBHxP-s and the plasmids resulted are presented in Table S1. The forward primer was universally used for all constructs and consisted of bases 519–540 of pGREG596, 31 bases upstream of the ATG start codon of the myrGFP cDNA. Just upstream of the start codon, there is a SpeI site that was used to replace the original myrGFP with myrGFP::MeBHxP. The reverse primers were designed to introduce the specific MeBHxP, a stop codon, and a site for SalI restriction enzyme. The myrGFP::MeBHxP-s were amplified by PCR using AmpliTaq™ DNA polymerase (Invitrogen, Waltham, USA). The amplicons were purified by Wizard SV gel and PCR Clean-up System (Promega, Madison, USA) and introduced into pCR2.1 vector using a TA Cloning® Kit, with pCR™2.1 Vector and One Shot® TOP10 Chemically Competent Escherichia coli (Invitrogen, Waltham, USA), yielding the plasmid series pCR2.1-myrGFP::MeBHxP. At this step, all constructs were checked by sequencing (CeMIA SA, Larissa, Greece). For subsequent subcloning, the DNA fragments corresponding to the myrGFP::MeBHxP-s were cut from the pCR2.1-series with SpeI and SalI and introduced into pGREG596, also cut with SpeI and SalI; this treatment removed both the original myrGFP and the 1.2 kb SalI-SalI fragment harboring the HIS3 gene. The subset of plasmids thus resulted were named pGRD-myrGFP::MeBHxP (GR from the original GREG name, and D from disrupted SalI-SalI fragment) and allowed the galactose-inducible expression of myrGFP-MeBHxP. For constitutive expression, the myrGFP::MeBHxP-s were cut from the pCR2.1-myrGFP::MeBHxP-series with EcoRI and SalI and introduced into the EcoRI-SalI sites of pYX212 (Novagen, discontinued) to yield the pYX212-myrGFP::MeBHxP series (Supplementary Table S1). The 3D model of myrGFP-MeBHxP was made using InsightII software tools (Accelrys, Dassault Systèmes BIOVIA, Discovery Studio Modeling Environment, Cambridge, UK), and the figures were edited using PyMOL Molecular Graphics System, version 1.3 Schrödinger, LLC (https://www.pymol.org/).

Yeast transformation

Fresh cultures (1 day on YPD-agar plates) were used for yeast transformation using the “quick and dirty” approach (Amberg et al. 2005). As both pGRD-myrGFP::MeBHxP and pYX212-myrGFP::MeBHxP series are URA3-based plasmids, the transformants were selected on SD plates lacking uracil (SD-Ura). Correct transformation was checked by colony PCR.

Yeast cell growth assay

Assessment of growth in liquid cultures

Cells in early-log phase were diluted (time 0) to 5 × 105 cells/mL (optical density OD600 = 0.05) in various media tested (galactose-containing media for transgene induction, metal-supplemented media for metal tolerance assay). Cell growth was monitored at time intervals by determining the OD600 in a plate reader equipped with thermostat and shaker (Varioskan, Thermo Fischer Scientific, Vantaa, Finland). Relative cell growth was calculated for each transformant as the ratio between OD600 determined at the specified time and the OD600 at time 0.

Assessment of cell growth using the spot assay

Cells in early-log phase (OD600 ∼ 0.5) were tenfold serially diluted in a 48-well microtiter plate and stamped on the agar plates using a pin replicator (approximately 4 μL/spot). Plates were photographed after 3 days’ incubation at 30 °C.

Assessment of cell viability

Cell suspensions, grown under various conditions, were diluted with sterile water to density 103 cells/mL and 100 μL was plated on YPD/agar. After 2–3 days of incubation at 30 °C, the colonies were counted and viability was expressed as percent of colony forming units (CFU). The cell viability, expressed as percentage of live cells within a whole population, was also done by staining with methylene blue. Viability was examined for at least 300 cells from one biological replicate (Kwolek-Mirek and Zadrag-Tecza 2014). Viable cells were colorless, and dead cells were blue.

Metal accumulation by living cells

Overnight pre-cultures were diluted in fresh selective medium (SD-Ura, pH 6) to 106 cells/mL. The cells were incubated with shaking for 2 h at 30 °C before metal ions (in the chloride forms, except for silver, which was used in the form of the water-soluble nitrate) were added from sterile stocks. Cells grown in an orbital shaker (30 °C at 200 rpm) in media containing MnCl2, CoCl2, NiCl2, CuCl2, CdCl2, or AgNO3 were harvested at the specified times and were washed three times with 10 mM 2-(N-morpholino)ethanesulfonic acid (MES)–Tris buffer, pH 6.0, at 0–2 °C. All centrifugation (1 min, 5000 rpm) was done at 4 °C. Cells were finally suspended in deionized water (108 cells/mL) and used for metal and cell protein assay. Metal analysis was done using an instrument with a single collector, quadrupole inductively coupled plasma with mass spectrometry (ICP-MS, Perkin-Elmer ELAN DRC-e, Concord, Vaughan, Canada) with axial field technology for trace elements, rare earth elements, and isotopic analyses. The analyses were performed after digestion of cells with 65% ultrapure HNO3 (Merck, Darmstadt, Germany). Standard solutions were prepared by diluting a 10 μg/mL multielement solution (Multielement ICP Calibration Standard 3, matrix 5%HNO3, Perkin Elmer Pure Plus, Shelton, USA). The metal cellular content was normalized to total cellular proteins, which were assayed spectrophotometrically as described by Bradford (1976).

Metal removal by yeast cells

Cells from overnight pre-cultures were harvested, resuspended into fresh SD-Ura at cell density 5 × 106/mL and incubated at 28 °C until reaching stationary phase (6–8 h). Cells were centrifuged and washed twice with 10 mM ethylenediaminetetraacetic acid (EDTA to remove the ions bound to the cell surface), once with deionized water and once with 10 mM MES–Tris buffer, pH 6.0. Cell suspensions were concentrated and added (108 cells/mL) to 10 mM MES–Tris buffer, pH 6.0, supplemented with 2% glucose and individual metal ions (0.1 mM CuCl2, CoCl2, MnCl2 or NiCl2, or 0.02 mM CdCl2) and shaken in flasks at 200 rpm in an orbital shaker, at 25 °C. After the specified times, the cells were harvested by centrifugation. The removal of metal ions by yeast cells was assessed by the decrease of the metal ion concentration in the supernatant, determined by ICP-MS.

myrGFP-MeBHxP intracellular localization

For the detection of myrGFP-MeBHxP fluorescence, the transformed cells were grown overnight in SD-Ura, diluted to 106 cells/mL and grown for 2–6 h in SD-Ura (pYX212-myrGFP series) or SG-Ura (pGRD-myrGFP series) before being visualized by fluorescence microscopy. Live cells were examined with an Olympus fluorescent microscope system (Olympus BX53, Tokyo, Japan) equipped with a HBO-100 mercury lamp and an Olympus DP73 camera. To detect the GFP signals, a GFP filter set (excitation filter 460–480, dichromatic mirror 585, emission filter 495–540) was used. The microscopic photographs were processed using the CellSens Dimension V1 imaging software (Olympus, Tokyo, Japan).

Gene expression analysis by qRT-PCR

Wild-type BY4741 yeast cells transformed with the GAL1 promoter-driven constructs (pGRD-myrGFP series) were grown in SD-Ura (OD600 = 0.5) before being washed and shifted to SG-Ura for transgene induction. Six hours after the galactose shift, cells were treated or not with 0.5 mM MeCl2, then incubated for 1 additional hour before being harvested for RNA isolation. For each treatment, RNA was isolated from three distinct transformants using the RiboPure™ RNA Purification Kit for yeast (Ambion™, Thermo Fischer Scientific, Vilnius, Lithuania) following the manufacturer’s instructions. Approximately 500 ng RNA was transcribed into cDNA using GoScript™ Reverse Transcription System (Promega, Madison, USA). Finally, a total of 10 ng cDNA was used for each qRT-PCR done wih the GoTaq® qPCR Master Mix (Promega, Madison, USA). Each reaction was performed in triplicate using MyiQ Single-Color Real-Time PCR Detection System (BioRad, Hercules, USA). Expression of ZAP1, ZRT1, and ZRT2 mRNA was normalized to the relative expression of ACT1 in each sample. The qRT-PCR cycling conditions were 95 °C for 1 min and 40 cycles of 95 °C for 10 s, 59 °C for 10 s, 72 °C for 12 s. The primers used for amplification of cDNA were ZAP1-F: 5′-GGATGCGTTGACTCCCAGGG, ZAP1-R: 5′- CTGGGAGTCAACGCATCCAT; ZRT1-F: 5′-GAGCAACGTTACTACGCCGT, ZRT1-R: ACATGGTGAAAAAAGTACTC; ZRT2-F: 5′-GGTTGATCTTATAGCGAGGG, ZRT2-R: AACCGAAGAACTTCGCTATG; ACT1-F: 5′-GGTTGCTGCTTTGGTTATTG, ACT1-R: 5′-CAATTGGGTAACGTAAAGTC.

Reproducibility of the results and statistics

All experiments were repeated, independently, on three different transformants. For each individual experiment, values were expressed as the mean ± standard of three independent experiments. For visual data, the observed trends were fully consistent among the independent experiments and a representative example is shown. One sample t test was used for the statistical analysis of each strain compared with strain myrGFP under the specific conditions. For multiple datasets, the analysis of myrGFP-MeBHxP compared with the control myrGFP was performed using a one-way or two-way analysis of variance (ANOVA) followed by Bonferroni’s test for multiple comparisons. A p < 0.05 was deemed indicative of a statistically significant difference for these tests (*p < 0.05, **p < 0.01, and ***p < 0.001).

Results

Effect of expressing myrGFP C-tagged with metal-binding hexapeptides (myrGFP-MeBHxP) on S. cerevisiae growth

The primary goal of our study was to manipulate yeast cells towards increased accumulation of metal ions without developing the metal-related toxicity symptoms. To achieve this, we speculated that the metal ions would lose their innate toxicity if they encountered a buffering chemical environment that was readily available once the ions penetrated the cell. Ideally, this environment would be located adjacent to the inner face of the plasma membrane; allowing rapid binding; and consequently, preventing the metal ions to bind non-specifically to other biomolecules or to be directed to compartments involved in metal excretion. We made use of a vector (pGREG596, Jansen et al. 2005) that contains the DNA cassette for myrGFP under the control of the galactose-inducible GAL1 promoter. When expressed in yeast cells, a protein bearing the myristoylation sequence (MGCTVSTQTI) would be targeted preponderantly to the plasma membrane (Gillen et al. 1998); in our case, expressed myrGFP would be anchored by myristoylation to the inner face of the lipid bilayer leaving the GFP domain free to face the cytosol. We C-tagged myrGFP with six codons for the amino acids known to have affinity for metal ions: histidine (H, known to have high affinity for Ni2+ and Co2+ thanks to the imidazolyl moiety), cysteine (C, with high affinity for thiol-binding metals, such as Cu2+ or Cd2+), or the less specific carboxylate bearing amino acids aspartate (D) and glutamate (E), expected to bind non-specifically any ion bearing a positive charge. Five C-tagged myrGFPs constructs were obtained in this study by PCR, encoding for myrGFP-H6 (hexahistidyl tag), myrGFP-C6 (hexacysteinyl tag), myrGFP-D6 (hexa-aspartyl tag), myrGFP-E6 (hexaglutamyl tag), and myrGFP-(DE)3 (tri-aspartyl-glutamyl tag). None of the five tags is found in nature; computer modeling revealed the hexapeptide tags as appendices to the myrGFP floating freely in the cytoplasm, very close to the plasma membrane (Fig. 1a). To determine the eventual toxicity of the MeBHxP expression, the constructs were placed under the control of the GAL1 yeast promoter, which allows selective expression of the construct downstream: it switches on the gene when the transformed cells are grown in galactose media, but not in glucose media (Guthrie and Fink 1991). The wild-type laboratory strain BY4741 was transformed with the pGRD-myrGFP::MeBHxP plasmid series (Supplementary Table S1), and the transformed colonies were picked up on selective medium SD-Ura and checked by colony PCR for correct transformation. Early log phase pre-cultures in liquid SD-Ura were washed and shifted to galactose-containing selective medium (SG-Ura) for the induction of myrGFP::MeBHxP expression. Cell growth was monitored over a period of 20 h by measuring OD600 every 2 h. The expression of the chimeric genes was checked by reverse-transcriptase PCR and by fluorescence microscopy on cell samples taken every 2 h from the galactose shift (data not shown). It was noted that cells expressing myrGFP-H6, myrGFP-C6, and myrGFP-(DE)3 grew very well, at a rate that was slightly higher but not significantly different (p > 0.05) from the growth of cells expressing the control myrGFP. In contrast, cells expressing myrGFP-D6 and myrGFP-E6 had poor growth, at a rate significantly lower (p < 0.001) than the cells expressing the control myrGFP (Fig. 1b). The cells expressing myrGFP-D6 and myrGFP-E6 also exhibited abnormal morphology compared to the other transgenic strains tested (Supplementary Fig. S1a) along with high endosome proliferation, at least in the case of myrGFP-D6 (Supplementary Fig. S1b), and they were not investigated further.
Fig. 1

Expression of myrGFP-MeBHxP. a Model representing the binding of the myrGFP-MeBHxP to the inner face of the plasma membrane, shown here for myrGFP-(DE)3. The 3D model was made using InsightII software tools (Accelrys), and the figures were edited using PyMOL Molecular Graphics System, version 1.3 Schrödinger, LLC. GFP (green). Myristoyl N-tail (orange). (DE)3 C-tag (purple). Carboxylate oxygens (red). The models for the other myrGFP-MeBHxP-s were similar, but the hexapeptides formed random coils. b Growth of yeast cells expressing myrGFP-MeBHxP. The wild-type BY4741 cells transformed with the pGRD-myrGFP::MeBHxP series were shifted to SG-Ura for transgene induction. The growth was determined spectrophotometrically (OD600). Values are means ± standard deviation of three independent data. Cells expressing myrGFP-D6 or myrGFP-E6 grew significantly slower than did the other transgenic strains (one-way ANOVA followed by Bonferroni’s test, p < 0.001)

Expression of myrGFP-MeBHxP from a constitutive promoter

Since the expression of myrGFP-H6, myrGFP-C6, and myrGFP-(DE)3 did not impair the growth and the morphology of the transformed cells, these constructs were chosen for further investigation. Firstly, the chimeric myrGFP::MeBHxP-s were shifted from the control of the inducible GAL1 promoter to a constitutive one. The promoter of the strongly expressed glycolytic gene TPI1 (coding for triose phosphate isomerase) of S. cerevisiae was decided upon, a promoter often used for the production of recombinant proteins (Egel-Mitani et al. 2000). Expression of the constructs from this promoter did not impair cell growth and had the advantage that the laborious galactose-shift was no longer required. Also, the absence of other galactose-related inconveniences (e.g., higher cost of galactose) could be regarded as a bonus. All constructs, myrGFP-H6, myrGFP-C6, and myrGFP-(DE)3, as well as control myrGFP, expressed well and could be localized by fluorescence microscopy predominantly at the plasma membrane level (Fig. 2a). As expected, the expression was often accompanied by increased tolerance to heavy metals (Fig. 2b). Thus, expression of myrGFP-H6 led to increased tolerance to Ni2+ compared to the other transgenic strains. This did not come as a surprise, since the imidazolyl group of the histidyl residues are known for their affinity to Ni2+. On the other hand, expression of myrGFP-C6 increased the tolerance to thiol-loving metals Cu2+, Cd2+, and Ag+ (Fig. 2b). As for myrGFP-(DE)3, clear gained tolerance was noticed for oxygen-loving metals such as Cu2+ and Mn2+, while a weaker tolerance to other divalent cations, such as Ni2+, Co2+, or Cd2+, was also recorded (Fig. 2b).
Fig. 2

Effect of myrGFP-MeBHxP expression on metal tolerance. a Cellular localization of myrGFP-MeBHxP. BY4741 cells expressing myrGFP-MeBHxP from a constitutive promoter (pYX212-myrGFP::MeBHxP series) were prepared for visualization as described in the “ Materials and methods ” section. Live cell fluorescence revealed the localization at the plasma membrane of the transgenic myrGFP-s studied. The experiments were done on at least three independent transformants, with similar results. For each strain, one representative example is shown. Controls: Cells transformed with pYX212 (up, left) or with pYX212 harboring non-myristoylated GFP (up, middle), which determined cytosolic localization. b Growth of strains expressing myrGFP-MeBHxP on plates supplemented with metal ions. Cells in early-log phase (OD600 ∼0.5) were tenfold serially diluted in a 48-well microtiter plate and stamped on the SD-Ura agar plates using a pin replicator (approximately 4 μL/spot). Metal concentrations were CuCl2, NiCl2, and CoCl2 1 mM; MnCl2 5 mM; and CdCl2 and AgNO3 0.2 mM. Plates were photographed after 3 days’ incubation at 30 °C. The experiments were repeated three times and the results were similar. One representative set is shown

Accumulation of metals by cells expressing myrGFP-MeBHxP

Considering their life environment, there are two types of heavy metal hyperaccumulators (for review, Farcasanu et al. 2012). The organisms belonging to the first type grow under normal conditions but take up and accumulate high amounts of a metal, often against a concentration gradient, for various purposes (e.g., defense against insects). This phenotype is extremely interesting for biotechnologies such as biomining, bioextraction, and bioconcentration. The second type of natural hyperaccumulators (usually plants) have adapted to metalliferous soils and can grow in metal-rich environments by hyperaccumulating metals in a non-toxic form (compartmentalized, buffered, complexed, etc.). Under such circumstances, the first approach to characterize our transgenic yeast strains was to determine whether the expression of any of the constructs determined an accumulating phenotype under low metal conditions. We prepared MMe, a synthetic variant of minimal medium for yeast (Sherman 2002) that contained “traces” of essential metals (2 μM Mn2+ and Zn2+, 1 μM Cu2+, Co2+and Ni2+, final concentration each) but also the non-essential Cd2+ and Ag+ (0.05 μM final concentration each). Mn2+ and Zn2+ were present at approximately the same concentration as in standard synthetic media, while Cu2+ was approximately five times the standard concentration. Co2+ and Ni2+, although essential, are not included in the trace element stocks of synthetic media recipes (Sherman 2002) as they are considered to exist in sufficient amount as contaminating the other ingredients: we included them at 1 μM concentration. Cd2+ and Ag+ were added because they were sometimes detected in cells when grown in standard synthetic media (SD). Overall, the presence of metal ions in the amounts indicated above did not affect the viability of the yeast strains used. Thus, all strains grown in MMe medium had cells which formed individual colonies (more than 98%), did not turn blue when stained with methylene blue (more than 98%), and changed the medium pH to 4 before reaching the stationary phase, due to metabolic activity. The metal content of cells expressing myrGFP (control), myrGFP-H6, myrGFP-C6, and myrGFP-(DE)3 was determined by ICP-MS on samples collected 8 h after shifting the cells to MMe-Ura, and the results are presented in Table 1. It was noted that under low concentration conditions, the accumulative potential of the transgenic strains was not spectacular, and also predictable. Compared to cells expressing the control myrGFP, the myrGFP-H6 cells accumulated approximately 8 times more Ni2+ (but not Co2+), while myrGFP-C6 expression augmented Cu2+, Zn2+, Cd2+, and Ag+ accumulation approximately four times in each case. myrGFP-(DE)3 expression augmented Mn2+ and Zn2+ accumulation approximately three times. The results obtained were far from the extrapolated definition of a hyperaccumulator, which is supposed to have an accumulating capacity at least 10–500 times higher than the control (Krzciuk and Gałuszka 2015), in our case, the cells expressing myrGFP-s.
Table 1

Metal content of cells expressing myrGFP-MeHxP in MMe-Ura, a minimal medium supplemented with trace concentrations of metals

STRAIN

Cell metal content (nmol/mg cell total protein)

Co

Cu

Mn

Ni

Zn

Cda

Aga

myrGFP

1.54 ± 0.12

4.2 ± 0.4

2.4 ± 0,6

0.2 ± 0.04

12.2 ± 1.8

1.8 ± 0.3

1.2 ± 0.5

myrGFP-H6

1.89 ± 0.38

6.21 ± 0.62*

2.8 ± 0.25

1.65 ± 0.45*

23.1 ± 2.21

2.36 ± 0.1

1.1 ± 0.3

myrGFP-C6

1.68 ± 0.34

25.8 ± 4.9**

2.1 ± 0.34

0.34 ± 0.12

48.8 ± 6.46*

8.2 ± 0.5**

4.5 ± 0.8*

myrGFP-(DE)3

1.82 ± 0.21

12.8 ± 1.2**

6.8 ± 0.82*

0.8 ± 0.32

33.9 ± 4.38*

3.11 ± 0.4

2.8 ± 0. 7

Overnight pre-cultures in SD-Ura of BY4741 wild-type cells transformed with the specified pYX212-MeHxP constructs (Supplementary Table S1) were washed and shifted to MMe-Ura (OD600 = 0.5) then grown for 8 h before being harvested for multi-elemental analysis (ICP-MS). MMe-Ura contained 2 μM Mn2+ and Zn2+; 1 μM Co2+, Cu2+, and Ni2+; and 0.05 μM Cd2+ and Ag+. Each determination was done in triplicate on approximately 108 cells from three different transformants. Results are given as mean ± standard deviation. Values significantly higher than the amount of the metal accumulated by myrGFP, according to one sample t test, are shown in bold letters

*p < 0.05; **p < 0.01

aNon-essential

The accumulating phenotype was more prominent under high concentration conditions (Fig. 3). The cells were tested for their accumulative properties in media supplemented with 0.5 mM of Cu2+, Co2+, Mn2+, or Ni2+ or 50 μM of Cd2+ or Ag+. These concentrations are much higher than normal (for instance, approximately 25 times higher than normal for Mn2+) but were low enough to ensure robust growth and more than 90% cell viability for all strains tested, including the control. Also, at these concentrations, the metals specified above did not affect cell membrane integrity, as shown by the absence of leakage of UV260-absorbing cellular components (Van der Heggen et al. 2010). Upon exposure, the cells took up the metals rather rapidly, to a saturation plateau that was reached within 45–60 min for most strains. In the data presented in Fig. 3, the metal accumulations after 1–2 h of exposure to metals are presented. No significant further accumulation was recorded for any strain after 2 h (Supplementary Fig. S2).
Fig. 3

Metal accumulation by cells expressing myrGFP-MeBHxP. Exponentially growing cells transformed with pYX212-myrGFP::MeBHxP series were shifted to media supplemented with metal ions and incubated with shaking at 30 °C. Metal ions were added to the final concentration 0.5 mM (CuCl2, MnCl2, CoCl2, NiCl2) or 0.05 mM (CdCl2, AgNO3). Cells were harvested after 1 and 2 h, washed and mineralized for metal assay. Accumulated metal determined by ICP-MS was normalized to cell total protein. Values are mean ± standard deviation of three independent data. The graphs show the accumulation of a Cu2+, b Mn2+, c Co2+, d Ni2+, e Cd2+, and f Ag+. Asterisks indicate that the mean obtained for the myrGFP-MeBHxP strain was significantly different from the mean of myrGFP control, according to one-way ANOVA test followed by Bonferroni’s test. *p < 0.05; **p < 0.01; ***p < 0.001

Cu2+ accumulated in all strains tested; the highest accumulative capacity was recorded for myrGFP-(DE)3, followed by myrGFP-C6 (Fig. 3a). This was not surprising, as Cu2+ has high affinity for carboxylates, but also for thiol groups. Mn2+, an oxygen-loving ion, was accumulated mainly by the myrGFP-(DE)3 strain (Fig. 3b). The strain myrGFP-H6 accumulated Co2+ and to a lesser extent Ni2+ (Fig. 3c, d); this was unexpected, since Ni2+ has a higher affinity to imidazolyl groups than Co2+. Unlike Ni2+, Co2+ also accumulated in strain myrGFP-C6 (Fig. 3c). In summary, strain myrGFP-H6 accumulated ions in the order Co2+ > Ni2+ ≥ Cu2+ > Mn2+; strain myrGFP-C6 accumulated ions in the order Co2+ > Cu2+ > Ni2+ > Mn2+, while strain myrGFP-(DE)3 accumulated ions in the order Cu2+ > Mn2+ ≈ Ni2+ > Co2+.

As for the heavier, non-essential metals Cd2+ and Ag+, both were accumulated by myrGFP-C6 strain, in the order Cd2+ > Ag+, while Cd2+ was also accumulated by myrGFP-(DE)3 and, to a lesser extent, by myrGFP-H6 (Fig. 3e, f).

Removal of metals by cells expressing myrGFP-MeBHxP

Considering that all strains expressing the modified myrGFPs showed specificity for certain metal ions, we investigated which of these strains could be used to efficiently remove excess metal ions from the environment. To test this, selective media were supplemented with various metal ions and the capacity of the tested strains to remove the contaminating ions was determined by measuring the decrease of the metal concentration in the growth media. Various non-toxic concentrations were tested; it was noted that a good working concentration was 0.1 mM for Co2+, Cu2+, Mn2+, and Ni2+ and 0.02 mM for Cd2+ or Ag+. At these concentrations, the cell viability was not affected, and neither was the growth rate, which remained similar to that of the non-exposed cells (data not shown). As the components of culture media can coordinate metal ions, limiting their availability for accumulation, a suitable, non-complexing medium is preferable. MES is one such suitable pH buffer because it does not form complexes with metal ions (Van der Heggen et al. 2010). The removal assays were done in 10 mM MES/Tris buffer (pH 6.0) supplemented with 2% glucose and individual metal ions in the concentrations specified above. Cells expressing myrGFP-MeBHxP were left in contact with the metal-containing buffer for 1–2 h, time that ensured metal cell saturation (Supplementary Fig. S2). The accumulation of Cu2+ by myrGFP-(DE)3, followed by myrGFP-C6 (Fig. 3a), correlated well with the Cu2+ removal by these strains (Fig. 4a). More than 70% of the external Cu2+ was removed by myrGFP-(DE)3 in the first hour (and more than 80% after 2 h), while the myrGFP-C6 cells efficiently removed more than 50% Cu2+. Mn2+ binds easily to oxygen ligands, but the capacity of myrGFP-(DE)3 was not spectacular (around 50%, Fig. 4b), a result which correlated with the weaker Mn2+ accumulative power of myrGFP-(DE)3 (Fig. 3b). No significant differences between myrGFP-H6 or myrGFP-C6 and myrGFP removal capacity could be noticed (Fig. 4b).
Fig. 4

Metal removal from metal-supplemented media by cells expressing myrGFP-MeBHxP. Suspensions of BY4741 cells transformed with pYX212-myrGFP::MeBHxP were prepared as described in the “ Materials and methods ” section before being concentrated and inoculated (108 cells/mL) in 10 mM MES/Tris, pH 6.0, with 2% glucose (to support growth) and containing metal ions (0.1 mM CuCl2, CoCl2, MnCl2 or NiCl2, or 0.02 mM CdCl2). Cultures were incubated in an orbital shaker (200 rpm, 25 °C). At the specified times, the cells were harvested by centrifugation. The removal of metal ions by yeast cells was assessed by the decrease of the metal ion concentration in the supernatant, determined by ICP-MS. Values are mean ± standard deviation of three independent data. Removal of a Cu2+, b Mn2+, c Co2+, d Ni2+, e Cd2+, and f Ag+. Asterisks indicate that the mean obtained for the myrGFP-MeBHxP strain was significantly different from the mean of myrGFP control, according to two-way ANOVA followed by Bonferroni’s test. *p < 0.05; **p < 0.01; ***p < 0.001

In the case of Co2+, the cells expressing myrGFP-H6 removed more than 70% of the ions in the first hour of incubation and more than 80% after 2 h of incubation (Fig. 4c); this was in good correlation with the highly accumulative activity towards Co2+ manifested by this strain (Fig. 3c). By contrast, cells expressing myrGFP removed less than 30% of the Co2+ present after 2 h of incubation. A similar behavior was noted in relation with Ni2+: around 60% Ni2+ removal by myrGFP-H6 cells was recorded in the first hour of cell exposure to Ni2+ (Fig. 3d). Just as in the case of accumulation (Fig. 3c, d), myrGFP-H6 cells did better in removing Co2+ than Ni2+. Co2+ was also removed (≈50%) from the medium by myrGFP-(DE)3 (Fig. 4d).

Special attention was paid to Cd2+, one of the most studied toxic metals. At 20 μM, a concentration often encountered in contaminated sites, Cd2+ was efficiently removed by myrGFP-C6 (more than 75–80%) or more modestly, but still significant, by myrGFP-(DE)3 (Fig. 4e). The buffer used also provided good conditions for Ag+ removal by myrGFP-C6 and myrGFP-(DE)3 cells: 75 and 60% after 2 h, respectively (Fig. 4f). This is especially encouraging for approaches seeking to concentrate Ag+ from dilute solutions using living cells grown in the presence of glucose.

Ni2+ or Mn2+ exposure induce Zn2+ accumulation by yeast cells expressing myrGFP-MeBHxP

While performing multi-elemental analysis of yeast cells exposed to various metals, we noted that Ni2+ exposure was systematically accompanied by significant increase in Zn2+ cellular content. We checked the level of Zn2+ in cells exposed to high but non-toxic concentrations of Cu2+, Co2+, Mn2+, Ni2+, Cd2+, and Ag+. Among the metals tested, Ni2+ and to a lesser extent Mn2+ induced significantly the intake of Zn2+ in strain myrGFP-C6, but also in strains myrGFP-H6 and myrGFP-(DE)3 (Fig. 5a). The level of intracellular Zn2+ was slightly elevated in all strains expressing myrGFP-MeBHxP under normal concentration conditions (Table 1), and this elevation was clearly augmented by exposure to Ni2+ or Mn2+ (Fig. 5a).
Fig. 5

Ni2+ and Mn2+ induce Zn2+ accumulation in yeast strains expressing myrGFP-MeBHxP. a Zn2+ accumulation by cells exposed to various heavy metals. Exponentially growing cells (106 cells/mL) transformed with pYX212-myrGFP::MeBHxP and incubated in SD-Ura which contained approximately 2 μM ZnCl2 were treated with various metal ions: 0.5 mM of Cu2+, Mn2+, Ni2+, or Co2+ or 0.05 mM Cd2+. After 1 h of metal exposure, the cells were harvested, washed, and mineralized for Zn2+ assay by ICP-MS. Zn2+ accumulation was calculated relatively to the Zn2+ content of the cells expressing control myrGFP incubated in the absence of other supplemental cations. Values are mean ± standard deviation of three independent data. b Relative abundance (RA) of ZAP1, ZRT1, and ZRT2 mRNA-s in strains expressing myrGFP::MeBHxP. Wild-type BY4741 cells transformed with GAL1 promoter-driven constructs (pGRD-myrGFP::MeBHxP series) were grown in SD-Ura (OD600 = 0.5) before being shifted to SG-Ura for transgene induction. Six hours after the galactose shift, cells were treated or not with 0.5 mM MeCl2, then incubated for one additional hour before being harvested for RNA isolation. Analysis of transcript abundance was done by reverse transcription followed by real-time PCR as described in the “ Materials and methods ” section. Expression of ZAP1, ZRT1, and ZRT2 mRNA was normalized to the relative expression of ACT1 in each sample. Values are mean ± standard deviation of triplicate qRT-PCR-s using cDNA obtained from three distinct transformants. Asterisks indicate that the mean obtained for the myrGFP-MeBHxP strain was significantly different from the mean of myrGFP control under the same conditions, according to one sample t test. *p < 0.05; **p < 0.01; ***p < 0.001

In S. cerevisiae, Zn2+ uptake is ensured by two plasma membrane transporters: the high-affinity Zrt1p and the low-affinity Zrt2p. The levels of ZRT1 and ZRT2 mRNAs are controlled by the Zap1p transcription regulator in response to intracellular zinc levels (for review, Eide 2003). The influence of myrGFP-MeBHxP expression in wild-type cells on the transcription levels of ZAP1, ZRT1, and ZRT2 was determined by qRT-PCR, in the absence or in the presence of supplemental Ni2+ or Mn2+ (Fig. 5b). To exclude the gene induction by Zn2+ deficiency, the growth media were supplemented with an extra 2 μM Zn2+. It was found that the relative abundance (RA) of ZAP1 mRNA doubled in cells expressing myrGFP-C6 or myrGFP-(DE)3 in normal medium increase 8–10 times in the presence of Mn2+ or Ni2+ (Fig. 5b, left). The increase of ZAP1 mRNA was mirrored by ZRT1 mRNA induction (Fig. 5b, middle). The levels of ZRT2 mRNA were not influenced by the sole myrGFP-MeBHxP expression, but a significant induction was recorded in the presence of Ni2+ or Mn2+ (Fig. 5b, right). These results suggested that accumulation of Zn2+ by strains myrGFP-MeBHxP exposed to Ni2+ or Mn2+ require an active Zn2+ transport across the plasma membrane. It is possible that expression of myrGFP-MeBHxP (especially of myrGFP-C6 or myrGFP-(DE)3) leads to depletion of cytosolic Zn2+ (probably by binding to hexapeptide tags), which in turn induces ZAP1 mRNA induction.

Further, the effect of expressing myrGFP-MeBHxP in zap1Δ, zrt1Δ, or zrt2Δ (strains lacking the ZAP1, ZRT1 or ZRT2 genes, respectively) was tested. Transformation with plasmids expressing myrGFP-MeBHxP from the constitutive promoter proved extremely difficult; therefore, we returned to the series expressing myrGFP-MeBHxP from the GAL1 promoter. It was noted that the expression of myrGFP-C6 and myrGFP-(DE)3 was toxic to both zap1Δ and zrt1Δ cells (Fig. 6a, middle). This toxicity was alleviated by supplementary Zn2+ in the case of zap1Δ, but not of zrt1Δ cells (Fig. 6a, right, and b). In contrast, zrt2Δ cells were not visibly affected by myrGFP-MeBHxP expression (Fig. 6a, bottom).
Fig. 6

Overexpression of myrGFP-MeBHxP can be deleterious to cells with defective Zn2+ transport. a Effect of myrGFP-MeBHxP expression on cells depleted of Zap1p (Zn2+-regulated transcription factor) or of the Zap1-regulated Zrt1p and Zrt2p. The zap1Δ, zrt1Δ, or zrt2Δ cells transformed with pGRD-GFP::MeBHxP series were tenfold serially diluted before being stamped on agar plates by means of a pin replicator (approximately 4 μL/spot). The toxicity of myrGFP-C6 or myrGFP-(DE)3 overexpression was alleviated by Zn2+ supplementation (2 mM) in zap1Δ but not in zrt1Δ cells. The plates were photographed after 3 days at 30 °C. The experiments were repeated three times and the results were similar. One representative set is shown. b Effect of supplemental Zn2+ or Ni2+ on the growth of cells expressing myrGFP-H6. c Effect of supplemental Zn2+ or Cd2+ on the growth of cells expressing myrGFP-C6. WT, zap1Δ, zrt1Δ, and zrt2Δ transformed with pGRD-myrGFP::H6 (b) or pGRD-myrGFP::C6 (c) were shifted to SG-Ura for transgene induction (time 0). When added, also at time 0, Zn2+, Ni2+, or Cd2+ had final concentrations of 2 μM, 0.5 mM, and 0.05 mM, respectively. The growth was determined spectrophotometrically (OD600) and expressed relatively to time 0 for each strain. Values are means ± standard deviation of three independent data. Asterisks indicate that the growth of myrGFP-MeBHxP strain was significantly worse than the mean growth of myrGFP control under normal conditions, according to one sample t test. *p < 0.05; **p < 0.01; ***p < 0.001

The expression of myrGFP-H6 was also partially deleterious in zap1Δ and zrt1Δ cells, better detected by growth measurements in liquid media (Fig. 6b). Surprisingly, it was noted that the growth of zrt1Δ cells expressing myrGFP-H6 was improved by Ni2+ (but not by Co2+ or Zn2+, data not shown) suggesting that Ni2+ binding to the –H6 tag was actually beneficial to the cell (Fig. 6b). In the case of cells expressing myrGFP-C6, the alleviation came from Cd2+ for both zap1Δ and to a lower extent for zrt1Δ cells (Fig. 6c), indicating that the C6-sequestered Zn2+ may be released by the competing Cd2+ (chemically similar to Zn2+), thus eliminating the deleterious effects of Zn2+ deficiency caused by an impaired Zn2+ transport. Interestingly, the same concentration of Cd2+ which was benefic to zap1Δ was deleterious to zrt2Δ cells expressing myrGFP-C6 (Fig. 6c).

Discussion

In the attempt to obtain heavy metal-accumulating yeast strains, we engineered cells towards expression of non-natural meta-binding hexapeptides (MeBHxP). Because we wanted the metal ions to be sequestered immediately after penetrating the cells, the MeBHxP were targeted to the inner face of the plasma membrane via a myristoylation sequence N-fused to a GFP domain. Apart from easy monitoring by fluorescence microscopy, the myrGFP domain acted like a giant linker, allowing the MeBHxP to have a degree of flexibility and to float freely in the cytosolic space adjacent to the plasma membrane (Fig. 1a). Three MeBHxP added to myrGFP (H6, C6 and (DE)3) did not affect cell growth, and they did not induce a clear heavy metal-hyperaccumulating phenotype under normal concentration conditions; this desiderate was accomplished in environments enriched in heavy metals. While defining a heavy metal-hyperaccumulating phenotype in plants is straightforward (for a review, Farcasanu et al. 2012), extrapolation to other kingdoms is not an easy task. Gifford et al. (2007) introduced the concept of zooremediation and defined an animal heavy metal hyperaccumulator, by similitude with plants, as animal species known to accumulate >100 mg/kg Cd2+ and Co2+, or >1000 mg/kg Ni2+ and Cu2+, or >10,000 mg/kg Zn2+ and Mn2+. During this study, we expressed the metal accumulation by yeast cells as nmol/mg cell protein. Considering that one yeast cell has approximately 6 pg proteins and 15 pg dry weight (Sherman 2002), 1 nmol/mg cell protein would correspond to roughly 0.4 mmol/kg dry weight. A simple calculation made on the data presented in Fig. 3 showed that strain myrGFP-H6 accumulated >4000 mg/kg Co2+, >1000 mg/kg Cu2+, >2000 mg/kg Ni2+, and >100 mg/kg Cd2+, making this strain a promising hyperaccumulator for the abovementioned metals. In the same line of evidence, strain myrGFP-C6 accumulated >3000 mg/kg Co2+, >2000 mg/kg Cu2+, and >200 mg/kg Cd2+, while strain myrGFP-(DE)3 accumulated >1000 mg/kg Co2+, >4000 mg/kg Cu2+, >1500 mg/kg Ni2+, and >150 mg/kg Cd2+. Based on such type of calculations, none of the strains described in this study would be a hyperaccumulator suitable for Mn2+.

It was interesting to notice that Ni2+ and Mn2+ exposure induced massive Zn2+ accumulation (Fig. 5a) from an environment which contained as little as 2 μM Zn2+. Whether Zn2+ accumulation is a defense mechanism against Ni2+ or Mn2+ toxicity or whether it is triggered by Zn2+ depletion caused by myrGFP-MeBHxP expression are issues that are still under investigation. Even though the myrGFP-MeBHxP expression triggered the expression of both ZAP1 and ZRT1 (Fig. 5b), apparently, it is Zrt2p which is responsible for the majority of Zn2+ intake under high Ni2+ or high Mn2+ conditions, since we found that the zrt2Δ cells expressing myrGFP-MeBHxP do not accumulate Zn2+ in these conditions (data not shown). Why would Zn2+ be transported predominantly via Zrt2p (a low affinity transporter)? One explanation would be that Ni2+ or Mn2+ (and not other cations) would change the Zrt2p conformation leading to a hyperactive state. Another plausible explanation would be that the Zn2+ ions that are transported by the high-affinity Zrt1p would activate Zrt2p for an enhanced transport activity. That would explain why Zn2+ accumulation is no longer recorded in the zrt2Δ cells expressing myrGFP-MeBHxP, in spite of a functional Zrt1p. No matter the explanation, zrt2Δ cells expressing myrGFP-MeBHxP can be used when metal accumulation is targeted without having to worry about Zn2+ overload.

During this study, a recurrent question arose: why would yeast cells armed with metal-binding peptides targeted to the inner face of plasma membrane be preferred to the known methodology that used yeast cells with a surface displaying metal-binding peptides (for review Kuroda and Ueda 2010). The latter approach has three unbeatable advantages: it is metabolism-independent, rapid, and reversible. Our method, based on anchoring MeBHxP to the inner face of the plasma membrane, opens other possibilities though: while still taking advantage of the innate biosorptive capacity of the yeast cell wall, it clearly adds the possibility to directionally sequester the heavy metals inside the cell, providing that excess metal ions present in the environment do not affect cell membrane integrity. This study demonstrated that the growth conditions of the engineered strains under metal surplus can be optimized for both normal growth and metal (hyper)accumulation. In fact, when expressing MeBHxPs in yeast cells, the recorded accumulation was 10–30 times the accumulation determined for the control strain (Fig. 4a). This was clearly better than the strains expressing metal-binding peptides on the cell surface, reportedly increasing the accumulative capacity significantly, but seldom more than 10 times (usually 2–4 times) compared to the control strain (Kuroda and Ueda 2010, and references within). Perhaps more important than the quantitative aspects or the clear hyperaccumulating potential is the possibility to use strains similar to those described in this study to entrap metal ions less usual for cells, for example ions with magnetic or luminescent properties, aimed for various technological applications. Alternatively, it will be interesting to extrapolate the concept of metal-binding peptides targeted to the inner face of the plasma membrane to industrial strains (flocculating strains, easily removable from the medium), abundantly growing strains (e.g., Pichia spp.), or to fungi which are symbiotic with plants grown on metal-contaminated soils (e.g., mycorrhizae).

Notes

Acknowledgements

The research leading to these results has received funding from the Romanian—EEA Research Program operated by the Ministry of National Education under the EEA Financial Mechanism 2009-2014 and Project Contract No 21 SEE/30.06.2014.

Compliance with ethical standards

Funding

This study was funded by the EEA Financial Mechanism 2009–2014 (Contract No 21 SEE/30.06.2014).

Conflict of interest

The authors declare that they have no conflict of interest.

This article does not contain any studies with human participants or animals performed by any of the authors.

Supplementary material

253_2017_8335_MOESM1_ESM.pdf (407 kb)
ESM 1 (PDF 407 kb)

Reference

  1. Amberg DC, Burke DJ, Strathern JN (2005) “Quick and dirty” plasmid transformation of yeast colonies. In: Burke D, Dawson D, Stearns T (eds) Methods in yeast genetics. A Cold Spring Harbor laboratory course manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, pp 113–114Google Scholar
  2. Blaby-Haas CE, Merchant SS (2014) Lysosome-related organelles as mediators of metal homeostasis. J Biol Chem 289:28129–28136CrossRefPubMedPubMedCentralGoogle Scholar
  3. Brachmann CB, Davies A, Cost GJ, Caputo E, Li J, Hieter P, Boeke JD (1998) Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast 14:115–132CrossRefPubMedGoogle Scholar
  4. Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254CrossRefPubMedGoogle Scholar
  5. Bradl H (ed) (2002) Heavy metals in the environment: origin, interaction and remediation, vol 6. Academic, LondonGoogle Scholar
  6. Brady D, Stoll AD, Starke L, Duncan JR (1994) Chemical and enzymatic extraction of heavy metal binding polymers from isolated cell walls of Saccharomyces cerevisiae. Biotechnol Bioeng 44:297–302CrossRefPubMedGoogle Scholar
  7. Cohen R, Engelberg D (2007) Commonly used Saccharomyces cerevisiae strains (e.g. BY4741, W303) are growth sensitive on synthetic complete medium due to poor leucine uptake. FEMS Microbiol Lett 273:239–243CrossRefPubMedGoogle Scholar
  8. Dalcorso G, Fasani E, Furini A (2013) Recent advances in the analysis of metal hyperaccumulation and hypertolerance in plants using proteomics. Front Plant Sci 4:280CrossRefPubMedPubMedCentralGoogle Scholar
  9. Dürr G, Strayle J, Plemper R, Elbs S, Klee SK, Catty P, Wolf DH, Rudolph HK (1998) The medial-Golgi ion pump Pmr1 supplies the yeast secretory pathway with Ca2+ and Mn2+ required for glycosylation, sorting, and endoplasmic reticulum-associated protein degradation. Mol Biol Cell 9:1149–1162CrossRefPubMedPubMedCentralGoogle Scholar
  10. Egel-Mitani M, Andersen AS, Diers I, Hach M, Thim L, Hastrup S, Vad K (2000) Yield improvement of heterologous peptides expressed in yps1-disrupted Saccharomyces cerevisiae strains. Enzym Microb Technol 26:671–677CrossRefGoogle Scholar
  11. Eide DJ (2003) Multiple regulatory mechanisms maintain zinc homeostasis in Saccharomyces cerevisiae. J Nutr 133:1532S–1535SPubMedGoogle Scholar
  12. Eide DJ (2009) Homeostatic and adaptive responses to zinc deficiency in Saccharomyces cerevisiae. J Biol Chem 284:18565–18569CrossRefPubMedPubMedCentralGoogle Scholar
  13. Farcasanu IC, Matache M, Iordache V, Neagoe A (2012) Hyperaccumulation: a key to heavy metal bioremediation. Soil Biol 31:251–278CrossRefGoogle Scholar
  14. Feldmann H (ed) (2012) Transition metal transport. In Yeast: molecular and cell biology, 2nd edn. Wiley-Blackwell, Hoboken, pp 226–232Google Scholar
  15. Francois JM (2016) Cell surface interference with plasma membrane and transport processes in yeasts. Adv Exp Med Biol 892:11–31CrossRefPubMedGoogle Scholar
  16. Georgiou G, Stathopoulos C, Daugherty PS, Nayak AR, Iverson BL, Curtiss R 3rd (1997) Display of heterologous proteins on the surface of microorganisms: from the screening of combinatorial libraries to live recombinant vaccines. Nat Biotechnol 15:29–34CrossRefPubMedGoogle Scholar
  17. Gifford S, Dunstan RH, O’Connor W, Koller CE, MacFarlane GR (2007) Aquatic zooremediation: deploying animals to remediate contaminated aquatic environments. Trends Biotechnol 25:60–65CrossRefPubMedGoogle Scholar
  18. Gillen KM, Pausch M, Dohlman HG (1998) N-terminal domain of Gpa1 (G protein α) subunit is sufficient for plasma membrane targeting in yeast Saccharomyces cerevisiae. J Cell Sci 111(Pt. 21):3235–3244PubMedGoogle Scholar
  19. Guthrie C, Fink GR (eds) (1991) Guide to yeast genetics and molecular biology. Methods Enzymol 194:1–863Google Scholar
  20. He ZL, Yang XE, Stoffella PJ (2005) Trace elements in agroecosystems and impacts on the environment. J Trace Elem Med Biol 19:125–140CrossRefPubMedGoogle Scholar
  21. Ito R, Kuroda K, Hashimoto H, Ueda M (2016) Recovery of platinum(0) through the reduction of platinum ions by hydrogenase-displaying yeast. AMB Express 6:88CrossRefPubMedPubMedCentralGoogle Scholar
  22. Jansen G, Wu C, Schade B, Thomas DY, Whiteway M (2005) Drag&Drop cloning in yeast. Gene 344:43–51CrossRefPubMedGoogle Scholar
  23. Kambe-Honjoh H, Ohsumi K, Shimoi H, Nakajima H, Kitamoto K (2000) Molecular breeding of yeast with higher metal-adsorption capacity by expression of histidine-repeat insertion in the protein anchored to the cell wall. J Gen Appl Microbiol 46:113–117CrossRefPubMedGoogle Scholar
  24. Kotrba P, Rumi T (2010) Surface display of metal fixation motifs of bacterial P1-type ATPase specifically promotes biosorption of Pb(2+) by Saccharomyces cerevisiae. Appl Environ Microbiol 76:2615–2622CrossRefPubMedPubMedCentralGoogle Scholar
  25. Krämer U (2005) Phytoremediation: novel approaches to cleaning up polluted soils. Curr Opin Biotechnol 16:133–141CrossRefPubMedGoogle Scholar
  26. Krämer U (2010) Metal hyperaccumulation in plants. Annu Rev Plant Biol 61:517–534CrossRefPubMedGoogle Scholar
  27. Krzciuk K, Gałuszka A (2015) Prospecting for hyperaccumulators of trace elements: a review. Crit Rev Biotechnol 35:522–532CrossRefPubMedGoogle Scholar
  28. Kuroda K, Ueda M (2003) Bioadsorption of cadmium ion by cell surface-engineered yeasts displaying metallothionein and hexa-his. Appl Microbiol Biotechnol 63:182–186CrossRefPubMedGoogle Scholar
  29. Kuroda K, Ueda M (2006) Effective display of metallothionein tandem repeats on the bioadsorption of cadmium ion. Appl Microbiol Biotechnol 70:458–463CrossRefPubMedGoogle Scholar
  30. Kuroda K, Ueda M (2010) Engineering of microorganisms towards recovery of rare metal ions. Appl Microbiol Biotechnol 87:53–60CrossRefPubMedGoogle Scholar
  31. Kuroda K, Shibasaki S, Ueda M, Tanaka A (2001) Cell surface engineered yeast displaying a histidine oligopeptide (hexa-his) has enhanced adsorption of and tolerance to heavy metal ions. Appl Microbiol Biotechnol 57:697–701CrossRefPubMedGoogle Scholar
  32. Kuroda K, Ueda M, Shibasaki S, Tanaka A (2002) Cell surface engineered yeast with ability to bind, and self-aggregate in response to, copper ion. Appl Microbiol Biotechnol 59:259–264CrossRefPubMedGoogle Scholar
  33. Kuroda K, Ebisutani K, Iida K, Nishitani T, Ueda M (2014) Enhanced adsorption and recovery of uranyl ions by NikR mutant-displaying yeast. Biomol Ther 4:390–401Google Scholar
  34. Kwolek-Mirek M, Zadrag-Tecza R (2014) Comparison of methods used for assessing the viability and vitality of yeast cells. FEMS Yeast Res 14:1068–1079PubMedGoogle Scholar
  35. Lapinskas PJ, Cunningham KW, Liu XF, Fink GR, Culotta VC (1995) Mutations in PMR1 suppress oxidative damage in yeast lacking superoxide dismutase. Mol Cell Biol 15:1382–1388CrossRefPubMedPubMedCentralGoogle Scholar
  36. Lauer Júnior CM, Bonatto D, Mielniczki-Pereira AA, Schuch AZ, Dias JF, Yoneama ML, Pêgas Henriques JA (2008) The Pmr1 protein, the major yeast Ca2+-ATPase in the Golgi, regulates intracellular levels of the cadmium ion. FEMS Microbiol Lett 285:79–88CrossRefPubMedGoogle Scholar
  37. Leitenmaier B, Küpper H (2013) Compartmentation and complexation of metals in hyperaccumulator plants. Front Plant Sci 4:374CrossRefPubMedPubMedCentralGoogle Scholar
  38. Liu Z, Ho SH, Hasunuma T, Chang JS, Ren NQ, Kondo A (2016) Recent advances in yeast cell-surface display technologies for waste biorefineries. Bioresour Technol 215:324–333CrossRefPubMedGoogle Scholar
  39. Machado MD, Santos MS, Gouveia C, Soares HM, Soares EV (2008) Removal of heavy metals using a brewer’s yeast strain of Saccharomyces cerevisiae: the flocculation as a separation process. Bioresour Technol 99:2107–2115CrossRefPubMedGoogle Scholar
  40. Machado MD, Janssens S, Soares HM, Soares EV (2009) Removal of heavy metals using a brewer’s yeast strain of Saccharomyces cerevisiae: advantages of using dead biomass. J Appl Microbiol 106:1792–1804CrossRefPubMedGoogle Scholar
  41. Massé E, Arguin M (2005) Ironing out the problem: new mechanisms of iron homeostasis. Trends Biochem Sci 30:462–468CrossRefPubMedGoogle Scholar
  42. Mosa KA, Saadoun I, Kumar K, Helmy M, Dhankher OP (2016) Potential biotechnological strategies for the cleanup of heavy metals and metalloids. Front Plant Sci 7:303CrossRefPubMedPubMedCentralGoogle Scholar
  43. Murai T, Ueda M, Yamamura M, Atomi H, Shibasaki Y, Kamasawa N, Osumi M, Amachi T, Tanaka A (1997) Construction of a starch-utilizing yeast by cell surface engineering. Appl Environ Microbiol 63:1362–1366PubMedPubMedCentralGoogle Scholar
  44. Nakajima H, Iwasaki T, Kitamoto K (2001) Metalloadsorption by Saccharomyces cerevisiae cells expressing invertase-metallothionein (Suc2-Cup1) fusion protein localized to the cell surface. J Gen Appl Microbiol 47:47–51CrossRefPubMedGoogle Scholar
  45. Ofiteru AM, Ruta LL, Rotaru C, Dumitru I, Ene CD, Neagoe A, Farcasanu IC (2012) Overexpression of the PHO84 gene causes heavy metal accumulation and induces Ire1p-dependent unfolded protein response in Saccharomyces cerevisiae cells. Appl Microbiol Biotechnol 94:425–435CrossRefPubMedGoogle Scholar
  46. Pollard AJ, Reeves RD, Baker AJ (2014) Facultative hyperaccumulation of heavy metals and metalloids. Plant Sci 217-218:8–17CrossRefPubMedGoogle Scholar
  47. Rascio N, Navari-Izzo F (2011) Heavy metal hyperaccumulating plants: how and why do they do it? And what makes them so interesting? Plant Sci 180:169–181CrossRefPubMedGoogle Scholar
  48. Ratherford JC, Bird AJ (2004) Metal-responsive transcription factors that regulate iron, zinc, and copper homeostasis in eukaryotic cells. Eukaryot Cell 3:1–13CrossRefGoogle Scholar
  49. Reddi AR, Jensen LT, Culotta VC (2009) Manganese homeostasis in Saccharomyces cerevisiae. Chem Rev 109:4722–4732CrossRefPubMedPubMedCentralGoogle Scholar
  50. Rosenfeld L, Reddi AR, Leung E, Aranda K, Jensen LT, Culotta VC (2010) The effect of phosphate accumulation on metal ion homeostasis in Saccharomyces cerevisiae. J Biol Inorg Chem 15:1051–1062CrossRefPubMedPubMedCentralGoogle Scholar
  51. Ruta L, Paraschivescu C, Matache M, Avramescu S, Farcasanu IC (2010) Removing heavy metals from synthetic effluents using “kamikaze” Saccharomyces cerevisiae cells. Appl Microbiol Biotechnol 85:763–771CrossRefPubMedGoogle Scholar
  52. Sharma SS, Dietz KJ, Mimura T (2016) Vacuolar compartmentalization as indispensable component of heavy metal detoxification in plants. Plant Cell Environ 39:1112–1126CrossRefPubMedGoogle Scholar
  53. Sherman F (2002) Getting started with yeast. Methods Enzymol 350:3–41CrossRefPubMedGoogle Scholar
  54. Shibasaki S, Ueda M, Iizuka T, Hirayama M, Ikeda Y, Kamasawa N, Osumi M, Tanaka A (2001) Quantitative evaluation of the enhanced green fluorescent protein displayed on the cell surface of Saccharomyces cerevisiae by fluorometric and confocal laser scanning microscopic analyses. Appl Microbiol Biotechnol 55:471–475CrossRefPubMedGoogle Scholar
  55. Shibasaki S, Kuroda K, Duc Nguyen H, Mori T, Zou W, Ueda M (2006) Detection of protein-protein interactions by a combination of a novel cytoplasmic membrane targeting system of recombinant proteins and fluorescence resonance energy transfer. Appl Microbiol Biotechnol 70:451–457CrossRefPubMedGoogle Scholar
  56. Shibasaki S, Maeda H, Ueda M (2009) Molecular display technology using yeast–arming technology. Anal Sci 25:41–49CrossRefPubMedGoogle Scholar
  57. Soares EV (2011) Flocculation in Saccharomyces cerevisiae: a review. J Appl Microbiol 110:1–18CrossRefPubMedGoogle Scholar
  58. Soares EV, Soares HM (2012) Bioremediation of industrial effluents containing heavy metals using brewing cells of Saccharomyces cerevisiae as a green technology: a review. Environ Sci Pollut Res Int 19:1066–1083CrossRefPubMedGoogle Scholar
  59. Soares EV, Soares HM (2013) Cleanup of industrial effluents containing heavy metals: a new opportunity of valorising the biomass produced by brewing industry. Appl Microbiol Biotechnol 97:6667–6675CrossRefPubMedGoogle Scholar
  60. Van der Heggen M, Martins S, Flores G, Soares EV (2010) Lead toxicity in Saccharomyces cerevisiae. Appl Microbiol Biotechnol 88:1355–1361CrossRefPubMedGoogle Scholar
  61. Van Ho A, Ward DM, Kaplan J (2002) Transition metal transport in yeast. Annu Rev Microbiol 56:237–261CrossRefPubMedGoogle Scholar

Copyright information

© Springer-Verlag Berlin Heidelberg 2017

Authors and Affiliations

  • Lavinia Liliana Ruta
    • 1
  • Ralph Kissen
    • 2
  • Ioana Nicolau
    • 1
  • Aurora Daniela Neagoe
    • 3
  • Andrei José Petrescu
    • 4
  • Atle M. Bones
    • 2
  • Ileana Cornelia Farcasanu
    • 1
  1. 1.Faculty of ChemistryUniversity of BucharestBucharestRomania
  2. 2.Cell, Molecular Biology and Genomics Group, Department of BiologyNorwegian University of Science and TechnologyTrondheimNorway
  3. 3.Faculty of BiologyUniversity of BucharestBucharestRomania
  4. 4.Institute of Biochemistry of the Romanian AcademyBucharestRomania

Personalised recommendations