Skip to main content

Chromatin affinity-precipitation using a small metabolic molecule: its application to analysis of O-acetyl-ADP-ribose

Cellular and Molecular Life Sciences volume 69, pages 641–650 (2012)Cite this article

Abstract

In the cell, many small endogenous metabolic molecules are involved in distinct cellular functions such as modulation of chromatin structure and regulation of gene expression. O-acetyl-ADP-ribose (AAR) is a small metabolic molecule that is generated during NAD-dependent deacetylation by Sir2. Sir2 regulates gene expression, DNA repair, and genome stability. Here, we developed a novel chromatin affinity-precipitation (ChAP) method to detect the chromatin fragments at which small molecules interact with binding partners. We used this method to demonstrate that AAR associated with heterochromatin. Moreover, we applied the ChAP method to whole genome tiling array chips to compare the association of AAR and Sir2. We found that AAR and Sir2 displayed similar genomic binding patterns. Furthermore, we identified 312 potential association cluster regions of AAR. The ChAP assay may therefore be a generally useful strategy to study the small molecule association with chromosomal regions. Our results further suggest that the small metabolic molecule AAR associates with silent chromatin regions in a Sir2-dependent manner and provide additional support for the role of AAR in assembly of silent chromatin.

This is a preview of subscription content, access via your institution.

Access options

Buy single article

Instant access to the full article PDF.

43,34 €

Price includes VAT (Finland)
Tax calculation will be finalised during checkout.

Fig. 1
Fig. 2
Fig. 3
Fig. 4
Fig. 5

References

  1. Aparicio OM, Billington BL, Gottschling DE (1991) Modifiers of position effect are shared between telomeric and silent mating-type loci in S. cerevisiae. Cell 66:1279–1287

    PubMed  Article  CAS  Google Scholar 

  2. Avalos JL, Boeke JD, Wolberger C (2004) Structural basis for the mechanism and regulation of Sir2 enzymes. Mol Cell 13:639–648

    PubMed  Article  CAS  Google Scholar 

  3. Bitterman KJ, Anderson RM, Cohen HY, Latorre-Esteves M, Sinclair DA (2002) Inhibition of silencing and accelerated aging by nicotinamide, a putative negative regulator of yeast Sir2 and human SIRT1. J Biol Chem 277:45099–45107

    PubMed  Article  CAS  Google Scholar 

  4. Blander G, Guarente L (2004) The Sir2 family of protein deacetylases. Annu Rev Biochem 73:417–435

    PubMed  Article  CAS  Google Scholar 

  5. Borra MT, O’Neill FJ, Jackson MD, Marshall B, Verdin E, Foltz KR, Denu JM (2002) Conserved enzymatic production and biological effect of O-acetyl-ADP-ribose by silent information regulator 2-like NAD+-dependent deacetylases. J Biol Chem 277:12632–12641

    PubMed  Article  CAS  Google Scholar 

  6. Bryk M, Banerjee M, Murphy M, Knudsen KE, Garfinkel DJ, Curcio MJ (1997) Transcriptional silencing of Ty1 elements in the RDN1 locus of yeast. Genes Dev 11:255–269

    PubMed  Article  CAS  Google Scholar 

  7. Carmen AA, Milne L, Grunstein M (2002) Acetylation of the yeast histone H4 N-terminus regulates its binding to heterochromatin protein SIR3. J Biol Chem 277:4778–4781

    PubMed  Article  CAS  Google Scholar 

  8. Cheung P, Allis CD, Sassone-Corsi P (2000) Signaling to chromatin through histone modifications. Cell 103:263–271

    PubMed  Article  CAS  Google Scholar 

  9. Chou C–C, Li Y-C, Gartenberg MR (2008) Bypassing Sir2 and O-acetyl-ADP-ribose in transcriptional silencing. Mol Cell 31:650–659

    PubMed  Article  CAS  Google Scholar 

  10. Denu JM (2003) Linking chromatin function with metabolic networks: Sir2 family of NAD+-dependent deacetylases. Trends Biochem Sci 28:41–48

    PubMed  Article  CAS  Google Scholar 

  11. Denu JM (2005) The Sir2 family of protein deacetylases. Curr Opin Chem Biol 9:431–440

    PubMed  Article  CAS  Google Scholar 

  12. Gaba A, Jacobson A, Schs MS (2005) Ribosome occupancy of the yeast CPA1 upstream open reading frame termination codon modulates nonsense-mediated mRNA decay. Mol Cell 20:449–460

    PubMed  Article  CAS  Google Scholar 

  13. Gasser SM, Cockell MM (2001) The molecular biology of the SIR proteins. Gene 279:1–16

    PubMed  Article  CAS  Google Scholar 

  14. Gottschling DE, Aparicio OM, Billington BL, Zakian VA (1990) Position effect at S. cerevisiae telomeres: reversible repression of pol II transcription. Cell 63:751–762

    PubMed  Article  CAS  Google Scholar 

  15. Grubisha O, Rafty LA, Takanishi CL, Xu X, Tong L, Perraud A-L, Scharengerg AM, Denu JM (2006) Metabolite of Sir2 reaction modulates TRPM2 ion channel. J Biol Chem 281:14057–14065

    PubMed  Article  CAS  Google Scholar 

  16. Grundy FJ, Henkin TM (2003) The T box and S box transcription termination control system. Fornt Biosci 8:d20–d31

    Article  CAS  Google Scholar 

  17. Guse AH (2005) Second messenger function and the structure-activity relationship of cyclic adenosine diphosphoribose (cADPR). FEBS J 272:4590–4597

    PubMed  Article  CAS  Google Scholar 

  18. Hecht A, Strahl-Bolsinger S, Grunstein M (1996) Spreading of transcriptional represser SIR3 from telomeric heterochromatin. Nature 383:92–96

    PubMed  Article  CAS  Google Scholar 

  19. Hecht A, Strahl-Bolsinger S, Grunstein M (1999) Mapping DNA interaction sites of chromosomal proteins crosslinking studies in yeast. Methods Mol Biol 119:469–479

    PubMed  CAS  Google Scholar 

  20. Huang J, Moazed D (2003) Association of the RENT complex with nontranscribed and coding regions of rDNA and a regional requirement for the replication fork block protein Fob1 in rDNA silencing. Genes Dev 17:2162–2176

    PubMed  Article  CAS  Google Scholar 

  21. Imai S, Armstrong CM, Kaeberlein M, Guarente L (2000) Transcriptional silencing and longevity protein Sir2 is an NAD-dependent histone deacetylase. Nature 403:795–800

    PubMed  Article  CAS  Google Scholar 

  22. Jenuwein T, Allis CD (2001) Translating the histone code. Science 293:1074–1080

    PubMed  Article  CAS  Google Scholar 

  23. Klar AJS, Fogel S, MacLeod K (1979) MAR1—a regulator of the HMa and HMα loci in Saccharomyces cerevisiae. Genetics 93:37–50

    PubMed  CAS  Google Scholar 

  24. Kustatscher G, Hothorn M, Pugieux C, Scheffzek K, Ladurner AG (2005) Splicing regulates NAD metabolite binding to histone macroH2A. Nat Struct Mol Biol 12:624–625

    PubMed  Article  CAS  Google Scholar 

  25. Ladurner AG (2006) Rheostate control of gene expression by metabolites. Mol Cell 24:1–11

    PubMed  Article  CAS  Google Scholar 

  26. Landry J, Sutton A, Tafrov ST, Heller RC, Stebbins J, Pillus L, Sternglanz R (2000) The silencing protein SIR2 and its homologs are NAD-dependent protein deacetylases. Proc Natl Acad Sci USA 97:5807–5811

    PubMed  Article  CAS  Google Scholar 

  27. Lee S, Tong L, Denu JM (2008) Quantification of endogenous sirtuin metabolite O-acetyl-ADP-ribose. Anal Biochem 15:174–179

    Article  Google Scholar 

  28. Lieb JD, Liu X, Botstein D, Brown PO (2001) Promoter-specific binding of Rap1 revealed by genome-wide maps of protein-DNA association. Nat Genet 28:327–334

    PubMed  Article  CAS  Google Scholar 

  29. Liou G-G, Chang HY, Lin CS, Lin-Chao S (2002) DEAD box RhlB RNA helicase physically associates with exoribonuclease PNPase to degrade double-stranded RNA independent of the degradosome-assembling region of RNase E. J Biol Chem 277:41157–41162

    PubMed  Article  CAS  Google Scholar 

  30. Liou G-G, Tanny JC, Kruger RG, Walz T, Moazed D (2005) Assembly of the SIR complex and its regulation by O-acetyl-ADP-ribose, a product of NAD-dependent histone deacetylation. Cell 121:515–527

    PubMed  Article  CAS  Google Scholar 

  31. Martino F, Kueng S, Robinson P, Tsai-Pflugfelder M, van Leeuwen F, Ziegler M, Cubizolles F, Cockell MM, Rhodes D, Gasser SM (2009) Reconstitution of yeast silent chromatin: multiple contact sites and O-AADPR binding load SIR complexes onto nucleosomes in vitro. Mol Cell 33:323–334

    PubMed  Article  CAS  Google Scholar 

  32. Matthews KS, Nichols JC (1998) Lactose repressor protein: functional properties and struccture. Prog Nucleic Acid Res Mol Biol 58:127–164

    PubMed  Article  CAS  Google Scholar 

  33. Moazed D (2001) Common themes in mechanisms of gene silencing. Mol Cell 8:489–498

    PubMed  Article  CAS  Google Scholar 

  34. Moazed D, Johnson D (1996) A deubiquitinating enzyme interacts with SIR4 and regulates silencing in S. cerevisiae. Cell 86:667–677

    PubMed  Article  CAS  Google Scholar 

  35. Moazed D, Kistler A, Axelrod A, Rine J, Johnson AD (1997) Silent information regulator protein complexes in Saccharomyces cerevisiae: a SIR2/SIR4 complex and evidence for a regulatory domain in SIR4 that inhibits its interaction with SIR3. Proc Natl Acad Sci 94:2186–2191

    PubMed  Article  CAS  Google Scholar 

  36. Moretti P, Freeman K, Coodly L, Shore D (1994) Evidence that a complex of SIR proteins interacts with the silencer and telomere-binding protein RAP1. Genes Dev 8:2257–2269

    PubMed  Article  CAS  Google Scholar 

  37. Motta MC, Divecha N, Lemieux M, Kamel C, Chen D, Gu W, Bultsma Y, McBurney M, Guarente L (2004) Mammalian SIRT1 represses forkhead transcription factors. Cell 116:551–563

    PubMed  Article  CAS  Google Scholar 

  38. North BJ, Marshall BL, Borra MT, Denu JM, Verdin E (2003) The human Sir2 ortholog, SIRT2, is an NAD + -dependent tubulin deacetylase. Mol Cell 11:437–444

    PubMed  Article  CAS  Google Scholar 

  39. Onishi M, Liou G-G, Buchberger JR, Walz T, Moazed D (2007) Role of the conserved Sir3-BAH domain in nucleosome binding and silent chromatin assembly. Mol Cell 28:1015–1028

    PubMed  Article  CAS  Google Scholar 

  40. Richards EJ, Elgin SC (2002) Epigenetic codes for heterochromatin formation and silencing rounding up the usual suspects. Cell 108:489–500

    PubMed  Article  CAS  Google Scholar 

  41. Rine J, Herskowitz I (1987) Four genes responsible for a position effect on expression from HML and HMR in Saccharomyces cerevisiae. Genetics 116:9–22

    PubMed  CAS  Google Scholar 

  42. Rudner AD, Hall BE, Ellenberger T, Moazed D (2005) A nonhistone protein-protein interaction required for assembly of the SIR complex and silent chromatin. Mol Cell Biol 25:4514–4528

    PubMed  Article  CAS  Google Scholar 

  43. Rusche LN, Kirchmaier AL, Rine J (2003) The establishment, inheritance, and function of silenced chromatin in Saccharomyces cerevisiae. Annu Rev Biochem 72:481–516

    PubMed  Article  CAS  Google Scholar 

  44. Shore D (2000) The Sir2 protein family: a novel deacetylase for gene silencing and more. Proc Natl Acad Sci USA 97:14030–14032

    PubMed  Article  CAS  Google Scholar 

  45. Smith JS, Boeke JD (1997) An unusual form of transcriptional silencing in yeast ribosomal DNA. Genes Dev 11:241–254

    PubMed  Article  CAS  Google Scholar 

  46. Smith JS, Brachmann BC, Celic I, Kenna MA, Muhammad KS, Starai VJ, Avalos JL, Escalante-Semerena JC, Grubmeyer C, Wolberger C, Boeke JD (2000) A phylogenetically conserved NAD+-dependent protein deacetylase activity in the Sir2 protein family. Proc Natl Acad Sci USA 97:6658–6663

    PubMed  Article  CAS  Google Scholar 

  47. Strahl-Bolsinger S, Hecht A, Luo K, Grunstein M (1997) SIR2 and SIR4 interactions differ in core and extended telomeric heterochromatin in yeast. Genes Dev 11:83–93

    PubMed  Article  CAS  Google Scholar 

  48. Tanny JC, Moazed D (2001) Coupling of histone deacetylation to NAD breakdown by the yeast silencing protein Sir2: evidence for acetyl transfer from substrate to an NAD breakdown product. Proc Natl Acad Sci 98:415–420

    PubMed  Article  CAS  Google Scholar 

  49. Tanny JC, Kirkpatrick DS, Gerber SA, Gygi SP, Moazed D (2004) Budding yeast silencing complexes and regulation of Sir2 activity by protein-protein interactions. Mol Cell Biol 24:6931–6946

    PubMed  Article  CAS  Google Scholar 

  50. Taunton J, Hassig CA, Schreiber ST (1996) A mammalian histone deacetylase related to the yeast transcriptional regulator Rpd3p. Science 272:408–411

    PubMed  Article  CAS  Google Scholar 

  51. Tong L, Lee S, Denu JM (2009) Hydrolase regulates NAD+ metabolites and modulates cellular REDOX. J Biol Chem 284:11256–11266

    PubMed  Article  CAS  Google Scholar 

  52. Turner BM (2000) Histone acetylation and an epigenetic code. BioEssays 22:836–845

    PubMed  Article  CAS  Google Scholar 

  53. Winkler WC, Breaker RR (2005) Regulation of bacterial gene expression by riboswitches. Annu Rev Microbiol 59:487–517

    PubMed  Article  CAS  Google Scholar 

  54. Yang B, Kirchmaier L (2006) Bypassing the catalytic activity of SIR2 for SIR protein spreading in Saccharomyces cerevisiae. Mol Biol Cell 17:5287–5297

    PubMed  Article  CAS  Google Scholar 

  55. Zhang J, Kaasik K, Blackburn MR, Lee CC (2006) Constant darkness is a circadian metabolic signal in mammals. Nature 439:340–343

    PubMed  Article  CAS  Google Scholar 

  56. Zhao K, Chai X, Clements A, Marmorstein R (2003) Structure and autoregulation of the yeast Hst2 homolog of Sir2. Nat Struct Biol 10:864–871

    PubMed  Article  CAS  Google Scholar 

  57. Zhao K, Chai X, Marmorstein R (2003) Structure of the yeast Hst2 protein deacetylase in ternary complex with 2′-O-acetyl ADP ribose and histone peptide. Structure 11:1403–1411

    PubMed  Article  CAS  Google Scholar 

Download references

Acknowledgments

We thank Drs. Yun-Shien Lee and Tina Fu for helpful discussion of chip analysis and lab members of G.-G.L. and of D.M. for discussion and technical help on this work. We also thank Yu-Hsin Kao of the Microarray Core Facility and Hsilin Cheng of the Mass Spectrometry Facility at the Institute of Molecular Biology, Academia Sinica for technical assistance. This work was supported by grant number NSC-97-2311-B-400-001-MY3 to G.-G.L. and by a grant from the NIH to D.M. (GM61641). D.M. and T.W. are HHMI investigators.

Author information

Affiliations

  1. Institute of Molecular Biology, Academia Sinica, Taipei, 11529, Taiwan, ROC

    Shu-Yun Tung

  2. Institute of Molecular and Genomic Medicine, National Health Research Institutes, Miaoli, 35053, Taiwan, ROC

    Jia-Yang Hong & Gunn-Guang Liou

  3. Department of Cell Biology, Harvard Medical School, Boston, MA, 02115, USA

    Thomas Walz, Danesh Moazed & Gunn-Guang Liou

  4. Howard Hughes Medical Institute, Harvard Medical School, Boston, MA, 02115, USA

    Thomas Walz & Danesh Moazed

Authors
  1. Shu-Yun Tung
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Jia-Yang Hong
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Thomas Walz
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Danesh Moazed
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Gunn-Guang Liou
    View author publications

    You can also search for this author in PubMed Google Scholar

Corresponding authors

Correspondence to Danesh Moazed or Gunn-Guang Liou.

Electronic supplementary material

Below is the link to the electronic supplementary material.

18_2011_771_MOESM1_ESM.pdf

Association of AAR with SirT1. Affinity pull-down assays showing the binding of SirT1 to the indicated small molecules and antibody, which were immobilized on beads. WCE, SirT1, Bead, and IgG represent whole cell extract, SirT1 antibody, Affigel 10 resin, and agarose IgG bead, respectively. (PDF 52 kb)

18_2011_771_MOESM2_ESM.pdf

Genome-wide distribution of Sir2 and AAR. Chromosomal display of genomic association patterns of Sir2 and AAR in wild type strain, and of AAR in sir2 deleted strain are on the top, middle, and bottom of each chromosome panel, respectively. The chromosomal sequence numbers from 1 to 550 k of chromosome 1~11 are shown on S2-1. The chromosomal sequence numbers from 550 k to 1,100 k of chromosome 1~11 are shown on S2-2 and the sequence numbers from 1100 k to the right end of chromosome 4 are shown on the window panel of S2-2. The chromosomal sequence numbers from 1 to 550 k and 550 k to 1100 k of chromosome 12~16 are shown on the top and bottom panels of S2-3, respectively. Chromosome number and sequence number are indicated. (PDF 475 kb)

18_2011_771_MOESM3_ESM.pdf

AAR association regions. ChAP assays showing the association of AAR with some newly identified regions in sir2 + wild type (Wt) and sir2 deleted (Δsir2) cells. Tot represents total cell lysate. Actin primer was used as internal control and for normalization of signal. Primers 5’GCGTGTCCGGTTGAGTTTAT3’ and 5’TCACTTCCAAAGCGTTTTCC3’ were for YAR035C-A. Primers 5’ACGACAAGGGCAAATACTGG3’ AND 5’CGTGCCTGAACTCCTTCAAT3’ were for YDL161 W. Primers 5’CACAGCCCCATAACAAACAA3’ and 5’ACAATTTTCCAGGCTGTTGG3’ were for YHR096C. Primers 5’ATGGAGTGGTGTCGTGATGA3’ and 5’AACCACCGCTCCTGCTACA3’ were for YIR019C. Primers 5’TGGCATCATTGTCGGTTAGT3’ and 5’AGGGAGACAGTGCCTCTGAA3’ were for YMR273C. (PDF 379 kb)

Supplementary material 4 (PDF 454 kb)

Supplementary material 5 (PDF 49 kb)

Supplementary material 6 (PDF 118 kb)

Supplementary material 7 (PDF 113 kb)

Rights and permissions

Reprints and Permissions

About this article

Cite this article

Tung, SY., Hong, JY., Walz, T. et al. Chromatin affinity-precipitation using a small metabolic molecule: its application to analysis of O-acetyl-ADP-ribose. Cell. Mol. Life Sci. 69, 641–650 (2012). https://doi.org/10.1007/s00018-011-0771-x

Download citation

  • Received:

  • Revised:

  • Accepted:

  • Published:

  • Issue Date:

  • DOI: https://doi.org/10.1007/s00018-011-0771-x

Keywords

  • Chromatin affinity-precipitation (ChAP)
  • O-acetyl-ADP-ribose (AAR, OAADPR)
  • Sir2
  • Chromatin immunoprecipitation (ChIP)
  • Silent chromatin