Molecular and General Genetics MGG

, Volume 205, Issue 1, pp 90–96 | Cite as

Complete nucleotide sequence of the low copy number plasmid pRAT11 and replication control by the RepA protein inBacillus subtilis

  • Tadayuki Imanaka
  • Hirokazu Ishikawa
  • Shuichi Aiba
Article

Summary

The 2.6 kb kanamycin-resistant (Kmr) plasmid, pRAT11, was constructed using both the replication determinant (repA) region of the 10.8 kb tetracycline-resistant (Tcr) low copy number plasmid pTB52 and another fragment (0.9 kb) that contained solely the Kmr gene of pUB110. The complete nucleotide sequence of this plasmid was determined. The repA region contained a large open reading frame encoding RepA protein (396 amino acid residues). In vitro transcription and translation of therepA gene were confirmed. RepA protein was shown to be indispensable for plasmid replication, and acted intrans on DNA. The part of therepA gene encoding the specific recognition region of the RepA protein was located and contained 3.5 direct repeats of 24 bp (GGTTTCAAAAATGAAACGGTGGAG). Upstream and downstream of the direct repeats were the recognition sequence (TTATCCACA) of theEscherichia coli DnaA protein and an AT-rich region, respectively. The replication control mechanism of the low copy numberBacillus plasmid is discussed.

Key words

Nucleotide sequence of pRAT11 Low copy number plasmid Bacillus subtilis RepA protein Direct repeat 

Preview

Unable to display preview. Download preview PDF.

Unable to display preview. Download preview PDF.

References

  1. Aiba S, Kitai K, Imanaka T (1983) cloning and expression of thermostable α-amylase gene fromBacillus stearothermophilus inBacillus stearothermophilus andBacillus subtilis. Appl Environ Microbiol 46:1059–1065PubMedGoogle Scholar
  2. Ano T, Imanaka T, Aiba S (1986) The copy number ofBacillus plasmid pRBH1 is negatively controlled by RepB protein. Mol Gen Genet 202:416–420PubMedCrossRefGoogle Scholar
  3. Chattoraj DK, Snyder KM, Abeles AL (1985) P1 plasmid replication: multiple functions of RepA protein at the origin. Proc Natl Acad Sci USA 82:2588–2592PubMedCrossRefGoogle Scholar
  4. Fuller RS, Funnell BE, Kornberg A (1984) The dnaA protein complex with theE. coli chromosomal replication origin (oriC) and other DNA sites. Cell 38:889–900PubMedCrossRefGoogle Scholar
  5. Imanaka T, Fujii M, Aiba S (1981a) Isolation and characterization of antibiotic resistance plasmids from thermophilic bacilli and construction of deletion plasmids. J Bacteriol 146:1091–1097PubMedGoogle Scholar
  6. Imanaka T, Tanaka T, Tsunekawa H, Aiba S (1981b) Cloning of the genes for penicillinase,penP andpenI, ofBacillus licheniformis in some vector pasmids and their expression inEscherichia coli, Bacillus subtilis, andBacillus licheniformis. J Bacteriol 147:776–786PubMedGoogle Scholar
  7. Imanaka T, Fujii M, Aramori I, Aiba S (1982) Transformation ofBacillus stearothermophilus with plasmid DNA and characterization of shuttle vector plasmids betweenBacillus stearothermophilus andBacillus subtilis. J Bacteriol 149:824–830PubMedGoogle Scholar
  8. Imanaka T, Ano T, Fujii M, Aiba S (1984) Two replication determinants of an antibiotic-resistance plasmid, pTB19, from a thermophilic bacillus. J Gen Microbiol 130:1399–1408PubMedGoogle Scholar
  9. Imanaka T, Himeno T, Aiba S (1985) Effect of in vitro DNA rearrangement in the NH2-terminal region of the penicillinase gene fromBacillus licheniformis on the mode of expression inBacillus subtilis. J Gen Microbiol 131:1753–1763PubMedGoogle Scholar
  10. Imanaka T, Takagaki K, Aiba S (1986) Construction of high, intermediate and low-copy-number promoter-probe plasmids forBacillus subtilis. Gene, in pressGoogle Scholar
  11. Matsumura M, Katakura Y, Imanaka T, Aiba S (1984) Enzymatic and nucleotide sequence studies of a kanamycin-inactivating enzyme encoded by a plasmid from thermophilic bacilli in comparison with that encoded by plasmid pUB110. J Bacteriol 160:413–420PubMedGoogle Scholar
  12. Matsumura M, Aiba S (1985) Screening for thermostable mutant of kanamycin nucleotidyltransferase by the use of a transformation system for a thermophile,Bacillus stearothermophilus. J Biol Chem 260:15298–15303PubMedGoogle Scholar
  13. McEachern MJ, Filutowicz M, Helinski DR (1985) Mutations in direct repeat sequences and in a conserved sequence adjacent to the repeats result in a defective replication origin in plasmid R6K. Proc Natl Acad Sci USA 82:1480–1484PubMedCrossRefGoogle Scholar
  14. McLaughlin JR, Murray CL, Rabinowitz JC (1981) Unique features in the ribosome binding site sequence of the gram-positiveStaphylococcus aureus β-lactamase gene. J Biol Chem 256:11283–11291PubMedGoogle Scholar
  15. Messing J (1983) New M13 vectors for cloning. Methods Enzymol 101:20–78PubMedCrossRefGoogle Scholar
  16. Miller JF (1972) Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, New YorkGoogle Scholar
  17. Moran CP Jr, Lang N, LeGrice SFJ, Lee G, Stephens M, Sonenshein AL, Pero J, Losick R (1982) Nucleotide sequences that signal the initiation of transcription and translation inBacillus subtilis. Mol Gen Genet 186:339–346PubMedCrossRefGoogle Scholar
  18. Moriya S, Ogasawara N, Yoshikawa H (1985) Structure and function of the rgion of the replication origin of theBacillus subtilis chromosome; III nucleotide sequence of some 10,000 base pairs in the origin region. Nucleic Acids Res 13:2251–2265PubMedGoogle Scholar
  19. Muller RE, Ano T, Imanaka T, Aiba S (1986) Complete nucleotide sequences ofBacillus plasmids pUB110dB, pRBH1 and its copy mutants. Mol Gen Genet 202:169–171PubMedCrossRefGoogle Scholar
  20. Seiki M, Ogasawara N, Yoshikawa H (1979) structure of the region of the replication origin of theBacillus subtilis chromosome. Nature 281:699–701PubMedCrossRefGoogle Scholar
  21. Seiki M, Ogasawara N, Yoshikawa H (1981) Structure and function of the region of the replication origin of theBacillus subtilis chromosome: I isolation and characterization of plasmids containing the origin region. Mol Gen Genet 183:220–226PubMedCrossRefGoogle Scholar
  22. Shapira SK, Chou J, Richaud FV, Casadaban MJ (1983) New versatile plasmid vectors for expression of hybrid proteins coded by a cloned gene fused tolacZ gene sequences encoding an enzymatically active carboxy-terminal portion of β-galactosidase. Gene 25:71–82PubMedCrossRefGoogle Scholar
  23. Trawick JD, Kline BC (1985) A two-stage molecular model for control of mini-F replication. Plasmid 13:59–69PubMedCrossRefGoogle Scholar
  24. Vocke C, Bastia D (1985) The replication initiator protein of plasmid pSC101 is a transcriptional repressor of its own cistron. Proc Natl Acad Sci USA 82:2252–2256PubMedCrossRefGoogle Scholar

Copyright information

© Springer-Verlag 1986

Authors and Affiliations

  • Tadayuki Imanaka
    • 1
  • Hirokazu Ishikawa
    • 1
  • Shuichi Aiba
    • 1
  1. 1.Department of Fermentation Technology, Faculty of EngineeringOsaka UniversitySuita-shi, OsakaJapan

Personalised recommendations