Abstract
We have determined DNA sequences of four VNTR loci; three in the peritelomeric region of Chromosome (Chr) 6q and one at 6p21. Heterozygosities of these loci among 80 CEPH parents are 78% (D6S139), 69% (D6S149), 76% (D6S161), and 94% (D6S193), respectively. The consensus sequences of repeating units at these VNTR loci are GAGCGGGCAGGGGCAGCGGGGCCTGGCCAGAGAG-(34 bp) at D6S139, CCAGGCTGGTTCACAGGCTGTGGGGTGTGATGGGTGATG (39 bp) at D6S149, GGATGGGGTTGGAGGAACTACAGAGCGGTGGTGAAGAGGA (40 bp) at D6S161, and GAGGAGGTGGGGCCT (16 bp) at D6S193. The GC content of the consensus sequences is 62% as high as reported previously. Furthermore, we have established a PCR assay for D6S193 locus and this will be useful for individual identification or for a study of loss of heterozygosity on the long arm of Chr 6 in malignant tumors.
This is a preview of subscription content, log in via an institution to check access.
Similar content being viewed by others
References
Budowle, B., Giusti, A.M., Waye, J.S., Baechtel, F.S., Fourney, R.M., Adams, D.E., Presley, L.A., Deadman, H.A., and Monson, K.L.: Fixed-bin analysis for statistical evaluation of continuous distributions of allelic data from VNTR loci, for use in forensic comparisons. Am J Hum Genet 48: 841–855, 1991a.
Budowle, B., Chakraborty, R., Giusti, A.M., Eisenberg, A.J., and Allen, R.C.: Analysis of the VNTR locus DIS80 by the PCR followed by high-resolution PAGE. Am J Hum Genet 48: 137–144, 1991b.
Fujimori, M., Tokino, T., Hino, O., Kitagawa, T., Imamura, T., Okamoto, E., Mitsunobu, M., Ishikawa, T., Nakagama, H., Harada, H., Yagura, M., Matsubara, K., and Nakamura, Y.: Allelotype study of primary hepatocellular carcinoma. Cancer Res 51: 89–93, 1991.
Gatti, R., Nakamura, Y., Nussmeier, M., Susi, E., Shan, W., and Grody, W.: Informativeness of VNTR genetic markers for detecting chimerism after bone marrow transplantation. Disease Markers 7: 105–112, 1989.
Jarman, A.P., Nicholls, R.D., Weatherall, D.J., Clegg, J.B., and Higgs, D.R.: Molecular characterization of a hypervariable region downstream of the human α-globin gene cluster. EMBO J 5: 1857–1863, 1986.
Jeffreys, A.J., Wilson, V., and Thein, S.L.: Hypervariable “minisatellite” regions in human DNA. Nature 314: 67–73, 1985.
Kasai, K., Nakamura, Y., and White, R.: Amplification of a variable of tandem repeats (VNTR) locus (pMCT118) by the polymerase chain reaction (PCR) and its application to forensic science. J Forensic Sci 35: 1196–1200, 1990.
Morita, R., Ishikawa, J., Tsutsumi, M., Hikiji, K., Tsukada, Y., and Kamidono, S.: Allelotype of renal cell carcinoma. Cancer Res 51: 820–823, 1991.
Nakamura, Y., Leppert, M., O'Connell, P., Wolff, R., Holm, T., Culver, M., Martin, C., Fujimoto, E., Hoff, M., Kumlin, E., and White, R.: Variable number of tandem repeat (VNTR) markers for human gene mapping. Science 235: 1616–1622, 1987.
Royle, N.J., Clarkson, R.E., Wong, Z., and Jeffreys, A.J.: Clustering of hypervariable minisatellites in the preterminal region of human autosomes. Genomics 8: 352–360, 1988.
Saiki, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R., Horn, G.T., Mullis, K.R., and Erlich, H.A.: Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239: 487–491, 1988.
Saito, S., Okui, K., Tokino, T., Oshimura, M., and Nakamura, Y.: Isolation and mapping of 68 RFLP markers on human chromosome 6. Am J Hum Genet, in press, 1992.
Sato, T., Tanigami, A., Yamakawa, K., Akiyama, F., Kasumi, F., Sakamoto, G., and Nakamura, Y.: Allelotype of breast cancer: cumulative allele losses promote tumor progression in primary breast cancer. Cancer Res 50: 7184–7189, 1990.
Sato, T., Saito, H., Morita, R., Koi, S., Lee, J.H., and Nakamura, Y.: Allelotype of human ovarian cancer. Cancer Res 51: 5118–5121, 1991.
Tsuchiya, E., Nakamura, Y., Weng, S., Nakagawa, K., Tsuchiya, S., Sugano H., and Kitagawa, T.: Allelotype of non-small cell lung carcinoma—comparison of loss of heterozygosity between squamous cell carcinoma and adenocarcinoma. Cancer Res 52: 2478–2481, 1992.
VanTuinen, P., Dobyns, W.B., Rich, D.C., Summers, K.M., Robinson, T.J., Nakamura, Y., and Ledbetter, D.H.: Molecular detection of microscopic and submicroscopic deletions associated with Miller-Dieker syndrome. Am J Hum Genet 43: 587–596, 1988.
Vogelstein, B., Fearon, E.R., Kern, S.E., Hamilton, S.R., Preisinger, A.C., Nakamura, Y., and White, R.: Allelotype of colorectal carcinomas. Science 244: 207–211, 1989.
Wyman, A.R., Mulholland, J., and Botstein, D.: Oligonucleotide repeats involved in the highly polymorphic locus D14S1 Am J Hum Genet 39: A-226, 1986.
Author information
Authors and Affiliations
Rights and permissions
About this article
Cite this article
Takiguchi, S., Saito, S. & Nakamura, Y. Characterization of four VNTR loci on human Chromosome 6. Mammalian Genome 4, 21–24 (1993). https://doi.org/10.1007/BF00364658
Received:
Accepted:
Issue Date:
DOI: https://doi.org/10.1007/BF00364658