Skip to main content
SpringerLink
Log in

Members of a new family of DNA-binding proteins bind to a conserved cis-element in the promoters of α-Amy2 genes

  • Research Article
  • Published:
Plant Molecular Biology Aims and scope Submit manuscript

Abstract

The promoters of wheat, barley and wild oat α-Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved region of 56–58 amino acids that consists of 25 highly conserved amino acids followed by a putative zinc finger motif, C-X4–5-C-X22–23-H-X1-H. ABF1 contains two such conserved regions, whereas ABF2 possesses only one but also contains a potential leucine zipper motif, suggesting that it could form homo- or heterodimers. ABF1 and ABF2 expressed in Escherichia coli bound specifically to Box 2 probes in gel retardation experiments; this binding was abolished by the transition-metal-chelating agent, 1,10-o-phenanthroline and by EDTA. We propose that ABF1 and ABF2 are representatives of two classes of a new family of plant sequence-specific DNA-binding proteins.

This is a preview of subscription content, log in via an institution to check access.

Access this article

Log in via an institution

Price excludes VAT (USA)
Tax calculation will be finalised during checkout.

Instant access to the full article PDF.

Institutional subscriptions

Similar content being viewed by others

References

  1. Baxevanis AD, Vinson CR: Interactions of coiled coils in transcription factors: where is the specificity? Curr Opin Genet Devel 3: 278–285 (1993).

    Google Scholar 

  2. Bradford MM: A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248–254 (1976).

    Google Scholar 

  3. Dehesh K, Hung H, Tepperman JM, Quail PH: GT-2: a transcription factor with twin autonomous DNA-binding domains of closely related but different target sequence specificity. EMBO J 11: 4131–4144 (1992).

    Google Scholar 

  4. Devereux J, Haeberli P, Smithies O: A comprehensive set of sequence-analysis programs for the VAX. Nucl Acids Res 12: 387–395 (1984).

    Google Scholar 

  5. Feinberg AP, Vogelstein B: A technique for radiolabelling DNA restriction endonuclease fragments to high specific activity. Anal Biochem 132: 6–13 (1983).

    Google Scholar 

  6. Goldman S, Mawal YR, Tanida I, Wu R: Studies of a gibberellin-dependent DNA-binding protein related to the expression of a rice α-amylase gene. Plant Sci 99: 75–88 (1994).

    Google Scholar 

  7. Grasser KD, Feix G: Isolation and characterization of maize cDNAs encoding a high mobility group protein displaying a HMG-box. Nucl Acids Res 19: 2573–2577 (1991).

    Google Scholar 

  8. Gubler F, Jacobsen JV: Gibberellin-responsive elements in the promoter of a barley high-PI α-amylase gene. Plant Cell 4: 1435–1441 (1992).

    Google Scholar 

  9. Hanas JS, Hazuda DJ, Bogenhagen DF, Wu FY-H, Wu C-W: Xenopus transcription factor A requires zinc for binding to the 5 S RNA gene. J Biol Chem 258: 14120–14125 (1983).

    Google Scholar 

  10. Harrington RE, Winicov I: New concepts in protein-DNA recognition: sequence-directed DNA bending and flexibility. Prog Nucl Acids Res Mol Biol 47: 195–270 (1994).

    Google Scholar 

  11. Huang N, Sutliff TD, Litts JC, Rodriguez RL: Classification and characterisation of the rice α-amylase multigene family. Plant Mol Biol 14: 655–668 (1990).

    Google Scholar 

  12. Huttly AK, Baulcombe DC: A wheat α-Amy2 promoter is regulated by gibberellin in transformed oat aleurone protoplasts. EMBO J 8: 1907–1913 (1989).

    Google Scholar 

  13. Huttly AK, Phillips AL: Gibberellin-regulated expression of two protein kinases in oat aleurone cells which show homology to MAP kinase and a ribosomal protein kinase. Plant Mol Biol 27: 1043–1052 (1995).

    Google Scholar 

  14. Huttly AK, Phillips AL, Tregear JW: Localisation of cis elements in the promoter of a wheat α-Amy2 gene. Plant Mol Biol 19: 903–911 (1922).

    Google Scholar 

  15. Ishiguro S, Nakamura K: Characterization of a novel DNA-binding protein, SPF1, that recognizes SP8 sequences in the 5′ upstream regions of genes coding for sporamin and β-amylase from sweet potato. Mol Gen Genet 244: 563–571 (1994).

    Google Scholar 

  16. Jacobsen JV, Beach LR: Control of transcription of α-amylase and rRNA genes in barley aleurone protoplasts by gibberellin and abscisic acid. Nature 316: 275–277 (1985).

    Google Scholar 

  17. Jones RL, Jacobsen JV: Regulation of synthesis and transport of secreted proteins in cereal aleurone. Int Rev Cytol 126: 49–88 (1991).

    Google Scholar 

  18. Katargiri F, Lam E, Chua N-H: Two tobacco DNA-binding proteins have homology to CREB. Nature 340: 727–730 (1989).

    Google Scholar 

  19. Laemmi UK: Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680–685 (1970).

    Google Scholar 

  20. Lam E, Kano-Murakami Y, Gilmartin P, Niner B, Chua N-H: A metal-dependent DNA-binding protein interacts with a constitutive element of a light-responsive promoter. Plant Cell 2: 857–866 (1990).

    Google Scholar 

  21. Lanahan MB, Ho T-HD, Rogers SW, Rogers JC: A gibberellin response complex in cereal α-amylase gene promoters. Plant Cell 4: 203–211 (1992).

    Google Scholar 

  22. Mitchell PJ, Tjian R: Transcriptional regulation in mammalian cells by sequence specific DNA-binding proteins. Science 245: 371–378 (1989).

    Google Scholar 

  23. O'Shea EK, Rutkowski R, Kim PS: Evidence that the leucine zipper is a coiled coil. Science 243: 538–542 (1989).

    Google Scholar 

  24. Ptashne M: How eukaryotic transcriptional activators work. Nature 335: 683–689 (1988).

    Google Scholar 

  25. Phillips AL, Huttly AK: Cloning of two gibberellin-regulated cDNAs from Arabidopsis thaliana by subtractive hybridisation: expression of the tonoplast water channel, γ-TIP, is increased by GA3. Plant Mol Biol 24: 603–615 (1994).

    Google Scholar 

  26. Rogers JC, Rogers SW: Definition and functional implications of gibberellin and abscisic acid cis-acting hormone response complexes. Plant Cell 4: 1443–1451 (1992).

    Google Scholar 

  27. Rogers JC, Lanahan MB, Rogers SW: The cis-acting gibberellin response complex in high-pI α-amylase gene promoters. Plant Physiol 105: 151–158 (1994).

    Google Scholar 

  28. Rushton PJ, Hooley R, Lazarus CM: Aleurone nuclear proteins bind to similar elements in the promoter regions of two gibberellin-regulated α-amylase genes. Plant Mol Biol 19: 891–901 (1992).

    Google Scholar 

  29. Sambrook J, Fritsch EF, Maniatis T: Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989).

    Google Scholar 

  30. Sanger F, Nicklen S, Coulsen AR: DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74: 5463–5467 (1977).

    Google Scholar 

  31. Schindler U, Beckmann H, Cashmore AR: HAT3.1, a novel Arabidopsis homeodomain protein containing a conserved cysteine-rich region. Plant J 4: 137–150 (1993).

    Google Scholar 

  32. Schmidt K, Burr FA, Aukerman MJ, Burr B: Maize regulatory gene opaque-2 encodes a protein with a ‘leucinezipper’ motif that binds to zein DNA. Proc Natl Acad Sci USA 87: 46–50 (1990).

    Google Scholar 

  33. Singh H, Lebowitz JH, Baldwin ASJr, Sharp PA: Molecular cloning of an enhancer binding protein: isolation by screening of an expression library with a recognition site DNA. Cell 52: 415–423 (1988).

    Google Scholar 

  34. Singh K, Dennis ES, Ellis JG, Llewellyn DJ, Tokuhisa JG, Wahleithner JA, Peacock WJ: OCSBF-1, a maize Ocs enhancer binding factor: Isolation and expression during development. Plant Cell 2: 891–903 (1990).

    Google Scholar 

  35. Skriver K, Olsen FL, Rogers JC, Mundy J: Cis-acting DNA elements responsive to gibberellin and its antagonist abscisic acid. Proc Natl Acad Sci USA 88: 7266–7270 (1991).

    Google Scholar 

  36. Struhl K: Helix-turn-helix, zinc finger, and leucine-zipper motifs for eukaryotic transcriptional regulatory proteins. Trends Biochem Sci 14: 137–140 (1989).

    Google Scholar 

  37. Sutliff TD, Lanahan MB, Ho T-HD: Gibberellin treatment stimulates nuclear factor binding to the gibberellin response complex in a barley α-amylase promoter. Plant Cell 5: 1681–1692 (1993).

    Google Scholar 

  38. Takatsuji H, Mori M, Benfey PN, Ren L, Chua N-H: Characterisation of a zinc finger DNA-binding protein expressed specifically in Petunia petals and seedlings. EMBO J 11: 241–249 (1992).

    Google Scholar 

  39. Takatsuji H, Nakamura N, Katsumoto Y: A new family of zinc finger proteins in Petunia: structure, DNA sequence recognition, anf floral organ-specific expression. Plant Cell 6: 947–958 (1994).

    Google Scholar 

  40. Tanida I, Kim K-J, Wu R: Functional dissection of a rice high-PI α-amylase gene promoter. Mol Gen Genet 244: 127–134 (1994).

    Google Scholar 

  41. Thomas PS: Hybridisation of denatured RNA and small DNA fragments transferred to nitrocellulose. Proc Natl Acad Sci USA 77: 5201–5205 (1980).

    Google Scholar 

  42. Travers A: DNA-Protein Interactions. Chapman and Hall, London (1993).

    Google Scholar 

  43. Tregear JW, Primavesi LF, Huttly AK: Functional analysis of linker insertions and point mutations in the α-Amy2/54 GA-regulated promoter. Plant Mol Biol in press.

  44. Vallee BL, Coleman JE, Auld DS: Zinc fingers, zinc clusters and zinc twists in DNA-binding protein domains. Proc Natl Acad Sci USA 88: 999–1003 (1991).

    Google Scholar 

  45. van Heeckeren WJ, Sellers JW, Struhl K: Role of the conserved leucines in the leucine zipper dimerization motif of yeast GCN4. Nucl Acids Res 20: 3721–3724 (1992).

    Google Scholar 

  46. Vinson CR, Lamarco KL, Johnson PF, Landschutz WH, McKnight SL: In situ detection of sequence-specific DNA-binding activity specified by a recombinant bacteriophage. Genes Devel 2: 801–806 (1988).

    Google Scholar 

  47. von Arnim AG, Deng X-W: Ring finger motif of Arabidopsis thaliana COP1 defines a new class of zinc-binding domain. J Biol Chem 268: 19626–19631 (1993).

    Google Scholar 

  48. Weisshaar B, Armstrong GA, Block A, da Costa e Silva O, Hahlbrock K: Light-inducible and constitutively expressed DNA-binding proteins recognizing a plant promoter element with functional relevance in light responsiveness. EMBO J 10: 1777–1786 (1991).

    Google Scholar 

  49. Winicov I: cDNA encoding putative zinc finger motifs from salt-tolerant alfalfa (Medicago sativa L.) cells. Plant Physiol 102: 681–682 (1993).

    Google Scholar 

  50. Zwar JA, Hooley R: Hormonal regulation of α-amylase gene transcription in wild oat (Avena fatua L.) aleurone protoplasts. Plant Physiol 80: 459–463 (1986).

    Google Scholar 

Download references

Author information

Author notes

  1. Paul J. Rushton

    Present address: Max-Planck-Institut für Züchtungsforschung, Abteilung Biochemie, Carl-von-Linné-Weg 10, D-5000, Köln 30, Germany

Authors and Affiliations

  1. IACR-Long Ashton Research Station, Department of Agricultural Sciences, University of Bristol, Long Ashton, BS18 9AF, Bristol, UK

    Paul J. Rushton, Alison K. Huttly & Richard Hooley

  2. School of Biological Sciences, University of Bristol, Woodland Road, BS8 1UG, Bristol, UK

    Heather Macdonald & Colin M. Lazarus

Authors
  1. Paul J. Rushton
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Heather Macdonald
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Alison K. Huttly
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Colin M. Lazarus
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Richard Hooley
    View author publications

    You can also search for this author in PubMed Google Scholar

Rights and permissions

Reprints and permissions

About this article

Cite this article

Rushton, P.J., Macdonald, H., Huttly, A.K. et al. Members of a new family of DNA-binding proteins bind to a conserved cis-element in the promoters of α-Amy2 genes. Plant Mol Biol 29, 691–702 (1995). https://doi.org/10.1007/BF00041160

Download citation

  • Received:

  • Accepted:

  • Issue Date:

  • DOI: https://doi.org/10.1007/BF00041160

Key words

Search

Navigation