Advertisement

Oral Cancer

pp 1–7 | Cite as

Single nucleotide polymorphism rs17849071 G/T in the PIK3CA gene is inversely associated with oral cancer

  • Sejal Shah
  • Girish Mishra
  • Kiran Kalia
Original Article
Part of the following topical collections:
  1. Basic Science

Abstract

Purpose

Oral squamous cell carcinoma (OSCC)—a subset of head and neck cancer is the sixth most common cancer worldwide and leading disease in India. The genes involved in PI3 K/AKT (Phosphatidylinositol 3-kinase—Akt) pathway, such as PIK3CA (Phosphoinositide-3-kinase catalytic α) and PTEN (Phosphatase and tensin homologue) were found to be associated with OSCC. The present study was aimed to find the genetic association of various polymorphisms in intron 9 of the PIK3CA gene and intron 5 of PTEN gene with primary OSCC tumors.

Methodology

50 OSCC patients for PIK3CA gene, 60 OSCC patients for PTEN gene and 72 healthy individuals were included in the study. PCR-direct sequencing analyzed the polymorphisms in intron 9 of PIK3CA and intron 5 of PTEN gene.

Results and conclusion

We observed rs114587137 (C>T) and rs17849071 (T>G) SNPs in intron 9 of the PIK3CA gene and rs35560700 (C>T) SNP in intron 5 of the PTEN gene. T allele of rs17849071 (T>G) was associated with the high-risk allele for developing OSCC; while G allele seemed to have the protective effect against OSCC (P = 0.02). We found an inverse association of rs17849071 (T>G) with OSCC development.

Keywords

OSCC PIK3CA PTEN SNP Indian 

Abbreviations

PIK3CA

Phosphoinositide-3-kinase catalytic α

PTEN

Phosphatase and tensin homologue

OSCC

Oral squamous cell carcinoma

HNSCC

Head and neck squamous cell carcinomas

SNP

Single nucleotide polymorphism

Introduction

Oral squamous cell carcinoma (OSCC)—the subset of head and neck cancer and the eighth most common cancer worldwide [1] and prominent amongst men in India [2]. Emerging nations especially, India, Pakistan, Bangladesh, Taiwan and Srilanka have reported the higher incidence of OSCC and the data shows there are 274,300 new cases of OSCC registered each year. Hence, one-third of the total cancer burden is accredited to oral cancer (OC) [3]. The risk of developing OSCC seems much higher in men than women. The Indian market is flooded with very attractive gutkha and pan masala as cheap and convenient betel quid (bq) substitutes and is a favorite amongst all age groups. It has been proven that chewing of tobacco in any form with any combinations is carcinogenic in humans, it increases the risk of developing cancer to 5.4 times [2, 4]. Though tobacco consumption in any way is hazardous, the molecular mechanism is yet to be clearly understood. In addition to the formation of DNA adducts, a number of tobacco carcinogens, activate the several molecular signaling pathways, in both normal and cancer cells [5].

Cancer is the multistep and multifactorial genetic disease, frequently associated with genomic volatility which, activate and deactivate oncogenes and tumor-suppressor genes, respectively, end up with uncontrolled cell proliferation leading to neoplasia [6, 7]. Cancer cells are showing secondary resistance to chemo- and radiotherapy followed by activation of signaling cascades. New strategies to overcome this resistance by targeting certain signaling pathways are evaluated [8]. Phosphatidylinositol 3-kinase/AKT (PI3K/AKT) is the crucial pathway that has commanded a great deal of recent attention, it has an imperative role in cell survival, cell proliferation, apoptosis, mortality and angiogenesis and has a central role in carcinogenesis. This pathway is highly volatile in a broad range of human cancers by gain or loss of oncogenes and tumor suppressor genes present in the pathway. Genetic variations in the oncogene phosphatidylinositol 3-kinase (PIK3CA) and tumor-suppressor gene, Phosphatase and tensin homolog (PTEN), has been reported previously, which led to carcinogenesis [9].

Recently, several studies confirmed the risk of carcinogenesis due to genetic polymorphisms [10] that is single nucleotide polymorphisms (SNPs)—variations in the human genome and have concerned considerable interest in cancer genetics. Though the function of most of the intronic SNPs is unknown and gene product does not get altered, but the combinations of such SNPs with the coding region may be functional. Previous studies reported a multitude of SNPs in the intronic region of PIK3CA and had shown an association of such SNPs with apoptosis and protein expression level in the tissue [11]. Though there is not enough evidence to prove a correlation between SNPs of PIK3CA and PTEN gene and OSCC patient outcome, a change in PIK3CA and PTEN protein expression might be responsible for cancer susceptibility.

Many studies have been carried out on PIK3CA gene, very few reports are available for intronic SNPs and its association with onset of OSCC or OSCC predisposition Hence, the functional role of the SNPs are yet to be studied [11]. Moreover, petite information is available for intronic SNPs including allelic frequency and genotype frequency in various populations to understand their importance.

Materials and methods

Subjects

Sixty OSCC patients were enrolled for this study from P.S. Medical College and Shri Krishna Hospital, Karamsad, Gujarat from May 2012 to May 2014. All the case subjects were properly detected as SCC by the team of experienced pathologists. Seventy-two volunteers without any type of cancer history for three degree generation, without any tobacco history, age and gender-matched, were enrolled as controls during the same period. Clinical data, such as age, gender, chewing and smoking tobacco, pathological characteristics of each OSCC patient were documented. Tumor tissue and control tissue (histopathologically normal cells from adjacent tissue) from the cancer patient at the time of surgery and 5-mL peripheral blood from healthy individual was drawn and stored at − 80 °C. All the participants gave written voluntarily informed consent and personally interviewed for structured questionnaire. The demographic and etiological histories were recorded for each of the participant. The primary tumors were obtained from 60 OSCC patients who underwent surgery at the Department of Otorhinolaryngology, P.S. Medical College and proceeded for the downstream analysis. This study was ethically approved by the Human Ethics and Research Committee of Shree Krishna hospital and medical college. Biopsy and histopathological examination were performed as per guidelines, inclusion criteria and exclusion criteria were the same [16, 30] except the inclusion of blood samples from healthy individuals without having any history of tobacco, smoking and history of any type of carcinoma since last three genera. The collected sample [tumor tissue, control tissue and control samples (blood sample from healthy individual)] were proceeded for DNA isolation using a DNeasy Blood and tissue mini kit (Qiagen) by following the manufacturer’s tissue protocol. The quality and quantity of DNA was checked by UV spectrophotometer and 0.8% agarose gel electrophoresis, respectively. The targeted regions of the PTEN (887 bp) and PIK3CA (487) were amplified using the primers shown in Table 1. The SNPs were identified by performing PCR-direct sequencing. Thermocycler-ABS verity 96 was used for the amplification. The total reaction mixture of 25-µL containing Taq 2x master mix (New England Biolabs), 400 nmol forward and reverse primers, and 80 ng of DNA, were used for the PCR. The PCR conditions were kept for 5 min at 95 °C; 30 cycles of denaturation for 25 s at 95 °C, annealing for 30 s at 58 °C (PIK3CA)/60 °C (PTEN) and extension for 25 s at 68 °C, followed by the final step of extension for 5 min at 68 °C and kept it on a hold at 4 °C according to the Taq 2x master mix manufacturer’s protocol [16, 30]. The quality of the PCR products were checked by 1.2% agarose gel electrophoresis to ensure the integrity of the targeted amplification before sequencing. The DNA sequencing of PCR products was carried out by Macrogen, Inc. (Korea) using forward and reverse primers. The SNPs were further confirmed by sequencing an independent PCR product from original template.
Table 1

Primer used for PCR amplification, amplicon size and Tm

Gene

Exon

Forward primer

Reverse primer

Amplicon size

Tm (°C)

PIK3CA

Exon 9

5′ GATTGGTTCTTTCCTGTCTCTG 3′

5′ CCACAAATATCAATTTACAACCATTG 3′

487

58

PTEN

Exon 5

5′ TGTGACCTATGCTACCAGTCC 3′

5′ GCTCTACTGGACAGCATAGTGA 3′

887

60

Statistical analysis

The data were analyzed statistically using SPSS (Chicago, IL, USA) with a two-sided test. The Chi-square test was performed to examine the Hardy–Weinberg equilibrium (HWE) for the distribution of genotypes at individual polymorphic loci. The frequency of alleles and genotypes between patients and controls were compared using Fisher’s exact test. Odds ratios (ORs) and 95% confidence intervals (CIs) were used to measure the strength of association between the polymorphism’s OSCC risks. P < 0.05 was considered sufficient for statistical significance.

Results

Demographic data of the OSCC patients were included into the study

The study included a total of 60 OSCC patients (tumor samples and respective adjacent control tissue of the same patient). We have analyzed fifty OSCC primary tumors for PIK3CA gene, sixty OSCC primary tumor samples for the PTEN gene and seventy-two healthy individuals as a control in the current study. The OSCC subjects included in the study were between the age group 26–70 years of which 44 were male. The control healthy subjects were between the age group 21–75 years, of which 41 subjects were male. A detailed history of the tobacco habits revealed that 72% of the patients had a history of tobacco in chewing form. The four patients had the history of tobacco chewing and smoking, while only one patient had a history of smoking. The duration of tobacco use was for more than 10 years and consumption was around 8–10 packet/day. The control healthy subjects recruited in the study neither have tobacco history in their lifetime nor any history the genetic disease or cancer. In our study, histopathological examination of OSCC patients was categorized using Broder’s classification as well differentiated, moderately differentiated and poorly differentiated SCC. Thirty-three subjects (55%) had a well-differentiated type of SCC, fifteen (25%) had moderately differentiated SCC and twelve (20%) had poorly differentiated SCC. Forty (67%) patients were in advanced stage of carcinoma. 43 (72%) patients had positive node. Detailed clinicopathological characteristics of OSCC patients have been described in Table 2.
Table 2

Clinical characteristics of OSCC patients and control samples included into the study

Variable

Experimental OSCC samples, n = 60

Frequency (%)

Healthy control (n = 72)

Gender

 Male

44

73

41

 Female

16

27

31

Age

 Mean

45.98

44.90

 Range

45.98

 

44.90

Risk habits

 Tobacco chewing

43

72

 Smoking

1

2

 Chewing + smoking

4

7

 None

8

13

Tumor site

 Buccal mucosa

41

68

 Tongue

6

10

 GB complex

7

12

 Hard palate

2

3

 Alveolus

3

5

 Lip

1

2

Tumor stage

 Early stage (I and II)

50

83

 Late stage (III and IV)

10

17

Tumor size

 T1, T2

20

33

 T3 and T4

40

67

Lymph node metastasis

 Negative

17

28

 Positive

43

72

 

Tumor differentiation

 Well

33

55

 Moderate

15

25

 Poor

12

20

Single nucleotide polymorphisms (SNPs) in PIK3CA gene

Although our previous study has identified certain driver mutations in PIK3CA gene and PTEN gene in only tumor tissue, SNP rs114587137, SNP rs17849071 (G/T) and SNP rs35560700 (C>T) were found in both tumor and control tissue of the same OSCC patient (16, 30). Hence, the current study was aimed to validate these SNPs and its role in healthy individual, whether these SNPs are associated with OSCC susceptibility or not.

Identification of SNPs in intron 9 of PIK3CA gene

We have analyzed fifty OSCC samples and seventy-two control samples for SNP evaluation. We found two SNPs rs114587137 (C>T) and rs17849071 (G/T) in fifteen and three OSCC patients, respectively, in intron 9 of the PIK3CA gene. We found rs114587137 (C>T) heterozygous mutated in 30% of the cases and 19.4% in the control samples. We did not find homozygous T/T genotype in tumor tissue, whereas, we found homozygous T/T genotype (2.9%) in control samples. We did not find association of rs114587137 (C>T) with OSCC susceptibility (Table 3a, Fig. 1a).
Table 3

The association between observed SNPs and OSCC risk

SNP

Genotype

Experimental (tumor)

Control

Odds ratio (95% CI)

p value

(a)

rs114587137 (C>T)

CC

35 (70%)

56 (77.7%)

  

CT

15 (30%)

14 (19.4%)

1.714 (0.73–3.97)

0.2

TT

00

02 (2.9%)

0

0.5

C Allele

85 (85%)

126 (87.5%)

1.23 (0.59–2.58)

0.7

T Allele

15 (15%)

18 (12.5%)

(b)

rs17849071 (T>G)

TT

47 (94%)

58 (80.5%)

  

TG

3 (6%)

12 (16.6%)

0.30 (0.08–1.1)

0.09

GG

00 (0%)

02 (2.9%)

0

0.5

T Allele

97 (97%)

128 (88.8%)

0.247 (0.07–0.87)

0.02

G Allele

3 (3%)

16(11.2%)

(c)

rs35560700 (C>T)

CC

55 (91.6%)

70 (97.2%)

  

CT

05 (8.4%)

02 (2.8%)

3.181 (0.59–17.02)

0.2

TT

00 (0%)

00 (0%)

NaN

NaN

C Allele

115 (95.8%)

142 (98.6%)

3.08 (0.5–16.2)

0.2

T Allele

5 (4.2%)

2 (1.4%)

Fig. 1

a CT genotype of SNP rs114587137 (C>T), b GT genotype of SNP rs17849071 (G>T), c CT genotype of SNP rs35560700 (C>T)

We observed one more SNP, rs17849071 G/T in intron 9 of the PIK3CA gene. The occurrence of the heterozygous genotype G/T at rs17849071 was a frequent genetic event in the healthy control group, occurring in 12/72 (16.6%) control subjects. In striking contrast, however, only 6% (3/50) OSCC patients harbored rs17849071 (G/T), indicating a lower prevalence observed than that in a healthy population, with an odds ratio of 0.30 (95% CI 0.08–1.1). Moreover, we noted homozygous G/G in two cases of control, whereas, there was the absence of G/G genotype in tumor samples. These data revealed an interesting mutual exclusion between rs17849071G/T and OSCC, suggesting a protective effect of rs17849071G/T against OSCC. We found a significant inverse association of G allele with OSCC development with an odds ratio (0.247) (95% CI 0.07–0.87) (P = 0.02). Hence, T/T genotype of rs17849071 (T>G) is associated with higher risk of developing OSCC; while T/G genotype seemed to have protective effect against OSCC (Table 3b, Fig. 1b).

Identification of SNPs in intron 5 of the PTEN gene

We identified one SNP rs35560700(C>T) in the intron 5 of the PTEN with the dominant allele being C and the minor allele being T.

We identified heterozygous C/T genotype in five tumors (8.4%), and two control (2.8%) samples. Neither had we observed homozygous T/T genotype in a tumor nor control samples. We did not find a significant association of rs35560700 (C>T) with OSCC susceptibility (Table 3c, Fig. 1c).

Discussion

Previously reported genetic studies on the PIK3CA gene in OSCC had been mostly focused on driver mutations and genomic amplification. Very few studies have reported about the role of SNPs in the PIK3CA gene in the development of OSCC. It has been previously reported and confirmed that polymorphisms in PI3K/AKT-signaling pathway play a vital role in cell growth, apoptosis, and metastasis [12]. SNPs account 90% of sequence variations in the human genome [13]. Most of the SNPs, are not located in the exons and thus not directly involved in protein function but they may affect the genetic expression. Thus, they are linked with the high risk for development of the particular disease or disease characteristics [14]. This concluding group of SNPs found in promoters, silencers, and enhancers and may interfere with the splicing mechanism and alter the binding properties of the regulatory region, which modulate the gene expression. The binding pattern of the mRNA and miRNA is based on complementary base pairing, the SNPs of the seed region may disturb the binding efficacy, which modulate the expression level of the respective gene. For example, the miR-184-binding site SNP (rs8126 T>C) in the 3 UTR of TNFAIP2 could modulate TNFAIP2 expression and contributes to head and neck squamous cell carcinoma (HNSCC) susceptibility [15]. The previous study has shown the reduced risk of follicular thyroid cancer and its relation to the PIK3CA gene polymorphism [11].

SNP rs114587137 (C>T)—91st nucleotide of intron 9 of the PIK3CA gene (calculated downstream from the start of the intron), located on 3′ enhancer domain. The location of the observed intronic polymorphisms was confirmed using human splicing finder software. This SNP is not earlier reported in OSCC; in fact, the clinical significance of the polymorphism is yet to be reported. SNP rs114587137 (C>T) was observed heterozygous mutated in 30% of OSCC tumor control pair, which confirmed that it is a polymorphism. The observed polymorphism located at 3′ enhancer domain may involve in regulation and expression of the gene. Initially, we found this polymorphism in high percentage of OSCC tumor control pair [16], hence, we have validated that finding in age, sex-matched healthy individuals as a control. The homozygous T/T genotype was not observed in OSCC samples, whereas, it was found in two healthy control samples. Though we could not find a significant association with OSCC susceptibility, as per our knowledge, it has not been reported in earlier studies.

The second polymorphism observed was rs17849071G/T—105th nucleotide of intron 9 of the PIK3CA gene (calculated downstream from the start of the intron) located on 3′ enhancer domain. It signifies a different genomic study in OSCC tumors in the Indian cohort. The outstanding result was rare frequency of heterozygous genotype G/T at rs17849071 in the PIK3CA gene especially in OSCC patients and has an inverse association for the development of OSCC. The study identified only 6% (3/60) of OSCC patients with G/T genotype vs 16.7% (12/72) healthy controls having G/T genotype. Likewise, 2.7% (2/72), control cases have demonstrated homozygous G/G genotype, in contrast, G/G genotype was absent in all of OSCC patients. It means that the presence of G allele has a role in disease protection. These findings suggest that the occurrence of rs17849071G/T in the specific subject would substantially protect against the development of OSCC. Though previous studies by Kostakis et al. and Qiu et al. reported rs17849071G/T polymorphism in Greek and American population, they did not find G allele to have protective effect [9, 17]. Our results support the notion of previous studies reported by Xing et al. in thyroid tumors, where they observed a converse association of rs17849071G/T with thyroid tumors [11]. Although, the findings still need to be validated in larger Gujarati Indian cohort, when we compared our data with Gujarati Indian population from Houstan, Texas (https://www.ncbi.nlm.nih.gov/variation/tools/1000genomes/), We observed allelic frequency for the SNP rs17849071 (T = 0.9126, G = 0.0874). Which support the notion that G allele may be protecting allele for the onset of OSCC. As our inclusion criteria for the patients and healthy controls were limited to only non-migrant Gujarati subjects, the study still need validation in the same population to establish SNP rs17849071 as a biomarker.

Several SNPs has been reported to affect OSCC. For example, the GSTM1 (glutathione-S-transferase M1) null genotype is a risk factor for oral cancer among the Indian tobacco-habituated inhabitants, and the increased prevalence of GSTM1 null polymorphism is associated with the severity of the lesions. It has been recently reported that in these patients the abrasions developed from oral leukoplakia to OSCC [18]. A study in Thai population have shown XRCC3 241Met, XRCC1 194Trp, and XPD exon six polymorphisms contribute to OSCC development [19]. An investigation with matrix metalloproteinase-9 (MMP-9)-1562 C>T SNP is associated with oral cancer risk only in teen-aged areca chewers [20]. A previous study has reported the potential combined XRCCs 1–4 SNPs linked with oral cancer risk in Taiwanese population [21].

Xing et al. reported an exciting converse relationship of the heterozygous rs17849071G/T with increased copy number of the PIK3CA gene [11]. Though we have not checked amplification, and it may be possible that the rs17849071G/T affects the expression of the PIK3CA negatively, reduces its oncogenicity and hence has a protective effect in the development of OSCC. As the rs17849071 G/T is located in enhancer domain of intron 9 of the PIK3CA gene, which may affect the binding and function of the splicing machinery, it limits the transcription of the PIK3CA gene. This polymorphism was found in patients with buccal mucosa SCC, GB complex SCC and lower lip SCC, at an advanced stage of carcinoma.

Phosphatase and tensin homolog (PTEN)—a tumor suppressor gene has been found germline mutated in patients with multiple hamartoma conditions, as well as breast and thyroid tumors. In some precancerous or cancerous lesions, PTEN gene has been found somatically mutated, or loss of function of the gene was reported due to deletion of the whole gene [22, 23]. Recently, PTEN has also been concerned in the pathogenesis of several fibrotic disorders, such as scleroderma [24], hepatic fibrosis [25], kidney [26], pulmonary [27, 28] and cardiac fibrosis [29]. Our previous study reported intronic frameshift mutation in the Indian population [30]. However, the PTEN expression in the carcinogenesis is yet to be studied, the evaluation of the intronic SNPs in the tyrosine phosphatase domain of the PTEN gene is a much needed study as it is a crucial domain of the gene. The clinical significance of SNP rs35560700 (C>T) is still unknown, and yet to be reported in any genetic disease. The SNP rs35560700 (C>T) is located at branch point sequence of intron 5. Though it did not have a significant association with the disease, it may have a role in splicing or genetic regulation.

The limitation of the study was the sample size of the healthy individual. With the larger sample size, the association of the observed SNPs may vary. Future studies will be warranted in a more significant cohort to establish found SNPs as a biomarker.

Conclusion

SNP rs17849071 (T>G) of the PIK3CA gene was found to have a significant inverse association with the development of OSCC for the studied population. It represents a novel pathway that plays a critical role in oral carcinogenesis. Mechanistic illumination of this phenomenon will lead to valuable perceptions at the molecular level in the OSCC development.

Notes

Acknowledgements

We acknowledge the Dean and medical staff of the Pramukh Swami Medical College and Hospital, Karamsad, for the collection of cancerous as well as healthy tissues for the present study. Sejal Shah has been awarded as a woman scientist in this project.

Funding

Department of Science and Technology, Women Scientist Scheme-A, New Delhi, India. Sanction no: -SR/WOS-A/LS/511/2011-G dated on 24/5/2012.

Compliance with ethical standards

Conflict of interest

The authors declare that they have no conflict of interest.

References

  1. 1.
    India Project Team of ICGC (2013) Mutational landscape of gingivobuccal oral squamous cell carcinoma reveals new recurrently mutated genes and molecular subgroups. Nat Commun 4:2873CrossRefGoogle Scholar
  2. 2.
    Anantharaman D, Chaubal PM, Kannan S, Bhisey RA, Mahimkar MB (2007) Susceptibility to oral cancer by genetic polymorphisms at CYP1A1, GSTM1 and GSTT1 loci among Indians: tobacco exposure as a risk modulator. Carcinogenesis 28(7):1455–1462CrossRefPubMedGoogle Scholar
  3. 3.
    Parkin DM, Bray F, Ferlay J et al (2005) Global cancer statistics, 2002. CA Cancer J Clin 55:74–108CrossRefPubMedGoogle Scholar
  4. 4.
    Jayalekshmi PA, Gangadharan P, Akiba S et al (2011) Oral cavity cancer risk in relation to tobacco chewing, bidi smoking among men in Karunagappally, Kerala, India: Karunagappally cohort study. Cancer Sci 102:460–467CrossRefPubMedGoogle Scholar
  5. 5.
    Du L, Shen J, Weems A, Lu S-L (2012) Role of phosphatidylinositol-3-kinase pathway in head and neck squamous cell carcinoma. J Oncol 2012:1–12CrossRefGoogle Scholar
  6. 6.
    Molinolo AA, Amornphimoltham P, Squarize CH, Castilho RM, Patel V, Gutkind SJ (2009) Dysregulated molecular networks in head and neck carcinogenesis. Oral Oncol 45:324–334CrossRefPubMedGoogle Scholar
  7. 7.
    Leemans CR, Braakhuis BJ, Brakenhoff RH (2011) The molecular biology of head and neck cancer. Nat Rev Cancer 11:9–22CrossRefPubMedGoogle Scholar
  8. 8.
    Kang S, Bader AG, Vogt PK (2005) Phosphatisidynositol 3 kinase mutations identified in human cancer are oncogenic. PNAS 102(3):802–807CrossRefPubMedGoogle Scholar
  9. 9.
    Qiu W, Schönleben F, Li X et al (2006) PIK3CA mutations in head and neck squamous cell carcinoma. Clin Cancer Res 12:1441–1446CrossRefPubMedPubMedCentralGoogle Scholar
  10. 10.
    Ma Z et al (2013) Role of KAI1/CD82 polymorphisms in colon cancer risk in Han Chinese population. Med Oncol 30(3):668CrossRefPubMedGoogle Scholar
  11. 11.
    Xing JC, Tufano RP, Murugan AK, Liu D, Wand G et al (2012) Single nucleotide polymorphism rs17849071 G/T in the PIK3CA gene is inversely associated with follicular thyroid cancer and PIK3CA amplification. PLoS One 7(11):e49192CrossRefPubMedPubMedCentralGoogle Scholar
  12. 12.
    Liu P, Cheng H, Roberts TM et al (2009) Targeting the phosphoinositide 3-kinase pathway in cancer. Nat Rev Drug Discov 8:627–644CrossRefPubMedPubMedCentralGoogle Scholar
  13. 13.
    Collins F, Brooks L, Chakravarti A (1998) A DNA polymorphism discovery resource for research on human genetic variation. Genome Res 8(12):1229–1231CrossRefPubMedGoogle Scholar
  14. 14.
    Wang X, Tomso D, Liu X, Bell D (2005) Single nucleotide polymorphism in transcriptional regulatory regions and expression of environmentally responsive genes. Toxicol Appl Pharmacol 207(2):84–90CrossRefPubMedGoogle Scholar
  15. 15.
    Liu Z, Wei S, Ma H, Zhao M, Myers JN, Weber RS, Sturgis EM, Wei Q (2011) A functional variant at the miR-184 binding site in TNFAIP2 and risk of squamous cell carcinoma of the head and neck. Carcinogenesis 32(11):1668–1674CrossRefPubMedPubMedCentralGoogle Scholar
  16. 16.
    Shah S, Shah S, Padh H, Kalia K (2015) Genetic alterations of the PIK3CA oncogene in human oral squamous cell carcinoma in an Indian population. Oral Surg Oral Med Oral Pathol Oral Radiol 120(5):628–635CrossRefPubMedGoogle Scholar
  17. 17.
    Kostakis GC, Papadogeorgakis N, Koumaki V, Kamakari S, Koumaki D, Alexandridis C (2010) Absence of hotspot mutations in exons 9 and 20 of the PIK3CA gene in human oral squamous cell carcinoma in the Greek population. Oral Surg Oral Med Oral Pathol Oral Radiol 109:53–58CrossRefGoogle Scholar
  18. 18.
    Tanwar R, Iyengar AR, Nagesh KS, Patil S, Subhash BV (2015) Prevalence of glutathione S-transferase M1 null polymorphism in tobacco users, oral leukoplakia and oral squamous cell carcinoma patients in South Indian population: a polymerase chain reaction study. Contemp Clin Dent 6(Suppl 1):S59–S64CrossRefPubMedPubMedCentralGoogle Scholar
  19. 19.
    Kietthubthew S, Sriplung H, Au W, Ishida T (2006) Polymorphism in DNA repair genes and oral squamous cell carcinoma in Thailand. Int J Hyg Environ Health 209(1):21–29CrossRefPubMedGoogle Scholar
  20. 20.
    Tu H, Wu C, Kao S, Liu C, Liu T, Lui M (2007) Functional − 1562 C-to-T polymorphism in matrix metalloproteinase-9 (MMP-9) promoter is associated with the risk for oral squamous cell carcinoma in younger male areca users. J Oral Pathol Med 36(7):409–414CrossRefPubMedGoogle Scholar
  21. 21.
    Yen C, Liu S, Chen C, Tseng H, Chuang L, Yang C et al (2008) Combinational polymorphisms of four DNA repair genes XRCC1, XRCC2, XRCC3, and XRCC4 and their association with oral cancer in Taiwan. J Oral Pathol Med 37(5):271–277CrossRefPubMedGoogle Scholar
  22. 22.
    Dahia PM (2000) PTEN, a unique tumor suppressor gene. Endocr Relat Cancer 7:115–129CrossRefPubMedGoogle Scholar
  23. 23.
    Yamada KM, Araki M (2001) Tumor suppressor PTEN: modulator of cell signaling, growth, migration and apoptosis. J Cell Sci 114:2375–2382PubMedGoogle Scholar
  24. 24.
    Bu S, Asano Y, Bujor A, Highland K, Hant F, Trojanowska M (2010) Dihydrosphingosine 1-phosphate has a potent antifibrotic effect in scleroderma fibroblasts via normalization of phosphatase and tensin homolog levels. Arthritis Rheum 62:2117–2126PubMedPubMedCentralGoogle Scholar
  25. 25.
    Hao LS, Zhang XL, An JY, Karlin J, Tian XP, Dun ZN, Xie SR, Chen S (2009) PTEN expression is down-regulated in liver tissues of rats with hepatic fibrosis induced by biliary stenosis. APMIS 117:681–691CrossRefPubMedGoogle Scholar
  26. 26.
    Kato M, Putta S, Wang M, Yuan H, Lanting L, Nair I, Gunn A, Nakagawa Y, Shimano H, Todorov I, Rossi JJ, Natarajan R (2009) TGF beta activates Akt kinase through a microRNA-dependent amplifying circuit targeting PTEN. Nat Cell Biol 11:881–889CrossRefPubMedPubMedCentralGoogle Scholar
  27. 27.
    Xia H, Diebold D, Nho R, Perlman D, Kleidon J, Kahm J, Avdulov S, Peterson M, Nerva J, Bitterman P, Henke C (2008) Pathological integrin signaling enhances proliferation of primary lung fibroblasts from patients with idiopathic pulmonary fibrosis. J Exp Med 205:1659–1672CrossRefPubMedPubMedCentralGoogle Scholar
  28. 28.
    Kuwano K (2006) PTEN as a new agent in the fight against fibrogenesis. Am J Respir Crit Care Med 173:5–6CrossRefPubMedGoogle Scholar
  29. 29.
    Teunissen BE, Smeets PJ, Willemsen PH, De Windt LJ, Van der Vusse GJ, Van Bilsen M (2007) Activation of PPAR delta inhibits cardiac fibroblast proliferation and the transdifferentiation into myofibroblasts. Cardiovasc Res 75:519–529CrossRefPubMedGoogle Scholar
  30. 30.
    Shah S, Jajal D, Mishra G, Kalia K (2017) Genetic profile of PTEN gene in Indian oral squamous cell carcinoma primary tumors. J Oral Pathol Med 46(2):106–111CrossRefPubMedGoogle Scholar

Copyright information

© Springer Nature Switzerland AG 2018

Authors and Affiliations

  1. 1.Lab #103 B, BRD School of BiosciencesSardar Patel UniversityVallabh VidhyanagarIndia
  2. 2.Otolaryngologist and Head and Neck Surgeon, E N T DepartmentP. S. Medical CollegeKaramsadIndia
  3. 3.National Institute of Pharmaceuticals Education and Research (NIPER) AhmedabadGandhinagarIndia
  4. 4.Department of Microbiology, School of ScienceRK UniversityRajkotIndia

Personalised recommendations