Advertisement

Mammal Research

, Volume 62, Issue 1, pp 103–109 | Cite as

Did the historical range of the European bison (Bison bonasus L.) extend further south?—a new finding from the Yenikapı Metro and Marmaray excavation, Turkey

  • Vedat Onar
  • Julien Soubrier
  • Nezir Yaşar Toker
  • Ayla van Loenen
  • Bastien Llamas
  • Abu Bakar Siddiq
  • Edyta Pasicka
  • Małgorzata TokarskaEmail author
Open Access
Original Paper
First Online:

Abstract

The origin of the European bison (Bison bonasus, Linnaeus, 1758) has been widely discussed and investigated in recent years. The species had a wide historic geographic distribution throughout the European continent during the middle and late Holocene, ranging from France in the west to the Caucasus in the east. However, archaeological evidence is needed to resolve the southern extent of the European bison distribution. We discovered one bison skull fragment during archaeological excavations in 2008 in the area of Yenikapı Metro and Marmaray (Turkey). Radiocarbon dating indicated the skull was deposited during the Byzantine period (seventh to eighth century AD). Mitochondrial genome analyses provided clear evidence that the skull was from a European bison. This is the first unambiguous evidence of the presence of this species in southeastern Europe during Byzantine times, which validates the historical written records of a potentially wider range of the European bison in historical times.

Keywords

European bison Skull morphology mtDNA Radiocarbon dating Zooarchaeology Turkey 

Introduction

During the early Holocene, European bison (Bison bonasus) were widespread throughout the European continent, but did not occupy Scandinavia. B. bonasus appeared in Denmark and Sweden only at the end of the last glaciation period (c. 10,000 BP) (Pucek 2004). During the middle and late Holocene (last 6000 years), the population of the European bison was widely distributed from France in the west to Russia’s Volga River and the Caucasus in the east (Benecke 2005; Pucek 2004). It was proposed that bison were also present in other regions (modern Armenia, Azerbaijan, Georgia, Northern Iran and Asiatic parts of Russia) although evidence is needed to substantiate this hypothesis (Pucek 2004; Flint et al. 2002). About 100 years ago, B. bonasus reached an extinction threshold due to habitat degradation and fragmentation linked to agricultural and logging activities, as well as unlimited hunting and heavy poaching (Pucek 2004). Fortunately, extinction was prevented through several conservation initiatives and controlled breeding in recent years, which resulted in a population increase (Pucek 1986, 2004).

Information on the presence and distribution of the B. bonasus in historical times has been mainly based on ancient written sources (Benecke 2005). However, names used to describe European bison have varied wildly, which creates some confusion and weakens the reliability of historical written sources (Benecke 2005). For example, Aristotle used the word “bonasus” to describe European bison in his reports on the history of animals (Aristotle and Balme 1991). In later years, between 1450 and 1850, “auerochs” was used as the official name of wisent/bison/żubr. There were attempts to eliminate this confusion in subsequent accounts by assigning the names “aerox” for aurochs and “bisont” for wisent (Ahrens 1921). Yet, some twentieth century and medieval descriptions use the name “aurochs” for European bison (Avebury 1913; Von Lengerken 1953).

Natural habitats of B. bonasus include large deciduous forests, bushes, shrubs, meadows and marsh areas (Benecke 2005; Pucek 2004). Consequently, it is expected that European bison could have occupied an area from the northern European plains to interior Asia based on the suitability of niches (Filean 2006). In fact, archaeological evidence indicates the widespread presence of European bison in Europe at least during the sixteenth century (Aleksandrowicz 1999). However, interpretation of the archaeological record is problematic: domestic and wild cattle remains could easily be incorrectly identified as European bison because of their similar size and morphological features (Benecke 2005). In particular, domestic male cattle and wild female cattle were possibly described as bison in some written sources based on their basic features (Filean 2006). For example, a bison bone was allegedly reported in faunal remains from Sos Höyük (on the border of Turkey and Iran), although the finding was classified as “doubtful” (Howell-Meurs 2001). Similarly, two bones were described as bison remains in the faunal assemblage of Pınarbaşı, Central Anatolia, but the accuracy of the identification of these remains is also doubtful because of their possibility of being mixed with other bovid species (Carruthers 2005).

A bison skull fragment was found in Yenikapı Metro and Marmaray (Turkey) excavation in 2008. This was one of the most important findings from the Byzantine period found at this site. The 58-km2 excavation area is located in the Yenikapı area of Istanbul, about 1.5 km from the Marmara Sea (Başaran et al. 2007) (Fig. 1).
Fig. 1

Yenikapı Metro and Marmaray excavation area

Relatively large number of animal species have been found during subsequent excavations (Onar et al. 2013a, b). Amongst these, one identified European bison skull fragment was excavated during the 2008 season. Geographically, the nearest findings of other bison remains have been reported from the southeastern Europe (Bulgaria and Romania) (Benecke 2005). This paper reports a unique finding of the bison remains from the Istanbul site is of utmost importance in relation to the addition of new geographical ancient distribution range.

Material and methods

A single skull fragment identified as European bison, from level −4.00 of trench 1Hc2 from the 2008 excavation season of Istanbul Yenikapi Metro and Marmaray excavation area, was used in this study (Fig. 2). The skull fragment was sent to the Oxford Radiocarbon Accelerator Unit, Oxford University, for radiocarbon dating.
Fig. 2

The Yenikapı Metro and Marmaray European bison skull fragment. a Dorsal view. b Basal (ventral) view. c Oral (rostral) view. d Aboral (nuchal) view

Ancient DNA work

Samples were sent to the Australian Centre for Ancient DNA (University of Adelaide, Australia) where sample preparation and DNA extraction were performed in an off-campus, purpose-built, physically isolated, ancient DNA facility equipped with positive air pressure. The laboratory follows strict clean-room conditions to minimise the impact of DNA contamination. All rooms and workbenches are routinely decontaminated with a 3% sodium hypochlorite solution (bleach) and UV irradiated overnight. Consumable packages are discarded where possible or extensively wiped with 3% bleach and UV irradiated before entering the facility. Workers use sterile and disposable hooded coveralls, face masks, dedicated shoes and two pairs of gloves. A second laboratory on campus accommodates all post-DNA-amplification work. A strict one-way movement of materials and personnel is implemented, from pre- to post-amplification laboratory. Methodological precautions include total removal of sample surface, repeated irradiation with UV light, mock extractions, DNA amplification reaction blanks and replication of DNA amplification.

Sample preparation and DNA extraction

Potential DNA contamination on the surface of the bison skull fragment was reduced by UV irradiation (260 nm) of all surfaces for 15 min, thorough wiping with 3% bleach and removal of ∼1 mm of the sample surface by abrasion using a dremel tool and a disposable carborundum disk. The sample (200 mg) was powdered using a Mikrodismembrator (Sartorius) and immediately decalcified and lysed overnight in 4 mL 0.5 M EDTA pH 8.0, 200 μL SDS and 40 μL proteinase K at 55 °C under constant rotation. After lysis, DNA was purified using an in-solution silica-based method previously described (Brotherton et al. 2013) and resuspended in 200 μL of 10 mM Tris–1 mM EDTA buffer.

Sequencing of the mitochondrial control region

Polymerase chain reaction (PCR) was prepared in the ancient DNA laboratory. To test if the sample contained bison DNA, the mitochondrial DNA D-loop was amplified in six overlapping fragments. PCR was performed using 0.4 mM of each primer (see Table 1 for primer sequences), 2.5 mM MgSO4, 0.25 mM dNTPs, 1 mg/mL rabbit serum albumin (Sigma, fraction V) and 1.25 U Platinum Taq Hi-Fi polymerase (Invitrogen). Thermal cycling parameters were 94 °C for 2 min, 50 cycles of 94 °C for 20 s, 58 °C for 30 s and 68 °C for 30 s, then 68 °C for 10 min. Resulting PCR products were visualised on a pre-stained 3.5% agarose gel under UV light. For successful PCR, amplicons were purified using Agencourt Ampure (Beckman Coulter) according to the manufacturer’s protocol. Sanger sequencing was performed at the Australian Genome Research Facility Ltd (AGRF). For successfully sequenced amplicons, forward and reverse sequences were aligned to the bison control region, cleaned from primer sequences, and a consensus was made using the software Geneious v7 (Kearse et al. 2012).
Table 1

Primer sequences for DNA typing

Amplicon

Primer

Primer sequence (5′-3′)

Length with primers

1

Bovid 16351F

CAACCCCCAAAGCTGAAG

133 bp

BISCR-16457R

TGGTTRGGGTACAAAGTCTGTG

2

BISCR-16420F

CCATAAATGCAAAGAGCCTCAYCAG

240 bp

BISCR-16642R

TGCATGGGGCATATAATTTAATGTA

3

BISCR-16507F

AATGCATTACCCAAACRGGG

248 bp

BISCR-16755R

ATTAAGCTCGTGATCTARTGG

4

BisonCR-16633Fa

GCCCCATGCATATAAGCAAG

170 bp

BisonCR_16810Ra

GCCTAGCGGGTTGCTGGTTTCACGC

5

BisonCR-16765Fa

GAGCTTAAYTACCATGCCG

180 bp

BISCR-16998R

CGAGATGTCTTATTTAAGAGGAAAGAATGG

6

BISCR-16960F

CATCTGGTTCTTTCTTCAGGGCC

153 bp

BisonCR-80Ra

CAAGCATCCCCCAAAATAAA

aPrimer sequences from Shapiro et al. (2004)

Sequencing of the whole mitochondrial genome

Double-stranded Illumina libraries were built from 20 μL of DNA extract using partial uracil-DNA glycosylase (UDG) treatment (Rohland et al. 2015) and truncated Illumina adapters with dual 7-mer internal barcodes, following the protocol from (Soubrier et al. 2016). The complete mitochondrial genome of the Marmaray sample was captured using hybridisation with commercial RNA baits (MYcroarray) (Soubrier et al. 2016). The enriched library was sequenced in paired-end reactions on an Illumina MiSeq machine. Sequencing reads were processed using the pipeline Paleomix v1.0.1 (Schubert et al. 2014). AdapterRemoval v2 (Lindgreen 2012) was used to trim adapter sequences, merge the paired reads and discard reads shorter than 25 bp (Li and Durbin 2009). BWA v0.6.2 was then used to map the processed reads to the reference mitochondrial genome of the European bison (GenBank ref. NC_014044). Minimum mapping quality was set at 25, seeding was disabled, the maximum number or fraction of gap opens was set to 2 and the edit distance was relaxed. MapDamage v2 (Jónsson et al. 2013) was used to verify the presence of expected contextual mapping and damage patterns considering the partial UDG treatment of the library (i.e. only the first and last base of sequencing reads should show higher levels of C-to-T and G-to-A transitions, respectively). Finally, the Marmaray consensus sequence was called using samtools/bcftools (Li et al. 2009) with minimum base quality at 30 and minimum depth of coverage at 3, and the Paleomix script “vcf_to_fasta”.

Phylogenetic analysis

The Marmaray consensus mitochondrial genome sequence was aligned to 36 published bovid sequences by hand using the software SeaView v4.3.5 (Gouy et al. 2010). Published sequences represented the following species: European bison (Bison bonasus), American bison (Bison bison), steppe bison (Bison priscus), yak (Bos grunniens), zebu (Bos indicus), cattle (Bos taurus) and aurochs (Bos primigenius).

To place the studied individual within the modern bovid assemblage, a maximum-likelihood phylogenetic tree was constructed using the program PhyML v3 (Guindon et al. 2010), HKY+G6 as the model of nucleotide substitution selected by comparison of Bayesian information criterion (BIC) scores in ModelGenerator v0.85 (Keane et al. 2006), NNI and SPR rearrangements to search for the tree topology and approximate likelihood-ratio tests to establish statistical support for the internal branches. The resulting tree, comparing the Marmaray skull DNA with DNA of other Bovini tribe representatives, is shown in Fig. 4.

Results

Radiocarbon dating

The skull fragment belonged to the seventh–eighth century AD as determined by radiocarbon dating (OxA-32358—Table 2). Calibration of the radiocarbon date was performed using OxCal v4.2.4 and the IntCal13 curve (Reimer et al. 2013), and the calibrated age range curve is given in Fig. 3.
Table 2

Radiocarbon dating of the Marmaray bison skull fragment

Site

Species

δ13C

OxA-32358 uncalBPa

Confidence

calAD

Century

Yenikapı Metro and Marmaray

European bison (Bison bonasus)

−20.98

1283 ± 26

95.4%

669–770

7-8th

aBefore present (BP)–AD 1950

Fig. 3

Calibrated date range (calAD) of the European bison from Yenikapı Metro and Marmaray. This plot shows how the radiocarbon measurement 1283 ± 26 BP was calibrated. The left-hand axis shows radiocarbon concentration expressed in years “before present, 1950”, and the bottom axis shows calendar years (derived from the IntCal13 calibration curve). The blue curve shows the IntCal13 calibration curve derived from direct 14C measurements (±one standard deviation), and the red curve on the left indicates the radiocarbon concentration in the sample. The grey histogram shows possible ages for the sample (the higher the histogram, the more likely that age is)

Ancient DNA analysis

No amplicons were detected for the PCR amplification negative controls. Fragments of expected sizes were detected for amplicons 1, 4, 5 and 6, a larger fragment than expected was detected for amplicon 2, and amplicon 3 could not be generated. Sanger sequencing results showed that fragments 1, 4, 5 and 6 corresponded to the bison control region, whereas fragment 2 was identified as cattle, therefore considered as a potential contaminant. Based on these results, hybridisation capture and sequencing of the whole mitochondrial genome were attempted. A total of 25,486 sequencing reads mapped uniquely to the European bison mitochondrial reference sequence (NC_014044), covering 100% of the reference at an average depth of 123×. Damage pattern analysis showed 13.8% of C-to-T at 5′ ends and 7.1% of G-to-A at 3′ ends, with less than 0.5% substitution level at all other positions, as expected from an ancient sample and the partial UDG treatment of the DNA library. The phylogenetic analysis showed that the Marmaray specimen is nested within the B. bonasus clade, with very high confidence (Fig. 4).
Fig. 4

Maximum-likelihood phylogenetic tree of whole mitochondrial genomes showing the position of the Yenikapı Metro and Marmaray excavation sample within the European bison clade. Numbers above branches represent approximate likelihood-ratio test support values, and the scale bar represents nucleotide substitutions per site

Discussion and conclusions

The B. bonasus skull fragment found in Istanbul, at the meeting point of Asia and Europe, is the only remain of this species ever found in this region. Previous reports of European bison bones in Anatolian sites such as Sos Höyük (Howell-Meurs 2001) and Pınarbaşı (Carruthers 2005) are debatable because of the highly likely possibility of confounding some morphological features with other bovid species. We propose that DNA analysis of these other Anatolian remains is required to identify them accurately, such as in the present study. Thus, the nearest unequivocal presence of B. bonasus archaeological remains is in Bulgaria and Romania, in southeastern Europe (Benecke 2005).

In Byzantine times, the Theodosius Harbour, being the second largest port of the Mediterranean Sea, was used as the most important centre for grain shipments from Egypt and remained a large harbour until the twelfth century (Kocabaş 2008, 2015). The discovery of seventh–eighth century European bison remains in this harbour area suggests that commercial activities related to this species may have spread through Bulgaria and Romania to interior areas of Thrace. Bison may have been traded from the Balkans/Carpates as food supply for people living in the Constantinople area, although there was no sign of cut marks on the Marmaray bison skull fragment.

This is the 57th animal species found in the Yenikapı Harbour area, which exhibits an extraordinarily diverse faunal assemblage from Byzantine times (Onar et al. 2013a, b). More importantly, the presence of a B. bonasus skull fragment in the Yenikapı Metro and Marmaray area strongly suggests that the historic distribution of European bison may have extended in the south as far as Asia Minor. This finding supports historical reports of the presence of European bison in the Constantinople area during the Byzantine period (Ahrens 1921).

Notes

Acknowledgments

The authors of this study offer their grateful thanks to Prof. Alan Cooper and Dr. Pere Bover Arbos for their substantial contributions of expertise and knowledge to this study as well as Amy Eycott.

This work was supported by the Scientific Research Projects Coordination Unit of Istanbul University (Project number: THZ-2016-20107) and the Australian Research Council.

Compliance with ethical standards

Conflict of interest

The authors declare that they have no conflict of interest.

Data availability

The Marmaray European bison whole mitochondrial sequence is available at GenBank under the accession number KX773459.

References

  1. Ahrens TG (1921) The present status of the European bison or wisent. J Mammal 2:58–62CrossRefGoogle Scholar
  2. Aleksandrowicz NP (1999) Zubr (Bison bonasus bonasus Linnaeus 1758) v okhotnichei dobyche naseleniya sredniovekovych beloruskich gorodov (Bones remains of European bison in the hunt trophies of medieval Belarussian towns). In: Proceedings of conference: Nauchno-prakticheskaya konferentsiya posvyashchenna 60-letiyu so dnia obrazovanya Gosudarstvennogo zapovednika “Belovezhskaya Pushcha”, Minsk, 22–24 Dec 1999 [In Russian]Google Scholar
  3. Aristotle, Balme DM (1991) History of animals. Cambridge, MA: Harvard UP. PrintGoogle Scholar
  4. Avebury L (1913) Prehistoric times. As illustrated by ancient remains and the manners and customs of modern savages. Williams and Norgate, LondonGoogle Scholar
  5. Başaran S, Kocabas U, Kocabas I, Yılmaz R (2007) Istanbul University Yenikapı shipwrecks project: Documentation, lifting, conservation and reconstruction. In: Istanbul: 8000 years brought to daylight, Marmaray, Metro, Sultanahmet excavations. Istanbul: Vehbi Koc¸ Foundation. pp.190–195Google Scholar
  6. Benecke N (2005) The Holocene distribution of European bison—the archaeozoological record. MUNIBE (Anthropologia-Arkeologia) 57: 421–428. Brehm-Bücherei 105. LeipzigGoogle Scholar
  7. Brotherton P, Haak W et al (2013) Neolithic mitochondrial haplogroup H genomes and the genetic origins of Europeans. Nat Commun 4:1764CrossRefPubMedPubMedCentralGoogle Scholar
  8. Carruthers DB (2005) Hunting and herding in central Anatolian prehistory: the sites at Pınarbaşı. Archaezoology of the near east VI. Proceedings of the sixth international symposium on the archaeozoology of southwestern Asia and adjacent areas. ARC-Publicaties 123 Groningen, The Netherlands, pp.85–95Google Scholar
  9. Filean EP (2006) Domestic cattle and economic change in the Roman period lower Rhineland: the Civitas Batavorum. Thesis The University of Iowa, IowaGoogle Scholar
  10. Flint VE, Belousova IP, Pererva VI, Kazmin VD, Kiseleva EG, Kudryavtsev IV, Pierozikov EN, Sipko TP (2002) Strategy for conservation the European bison in the Russian Federation. Russian Academy of Sciences, Moscow, pp. 1–45Google Scholar
  11. Gouy M, Guindon S, Gascuel O (2010) SeaView version 4: a multiplatform graphical user interface for sequence alignment and phylogenetic tree building. Mol Biol Evol 27:221–224CrossRefPubMedGoogle Scholar
  12. Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, Gascuel O (2010) New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Syst Biol 59:307–321CrossRefPubMedGoogle Scholar
  13. Howell-Meurs S (2001) Archaeozoological evidence for pastoral systems and herd mobility: the remains from Sos Höyük and Büyüktepe Höyük. Int J Osteoarchaeol 11:321–328CrossRefGoogle Scholar
  14. Jónsson H, Ginolhac A, Schubert M, Johnson PLF, Orlando L (2013) mapDamage2.0: fast approximate Bayesian estimates of ancient DNA damage parameters. BİOİNFORMATİCS 29:1682–1684. doi: 10.1093/bioinformatics/btt193 PubMedPubMedCentralGoogle Scholar
  15. Keane TM, Creevey CJ, Pentony MM, Naughton TJ, Mclnerney JO (2006) Assessment of methods for amino acid matrix selection and their use on empirical data shows that ad hoc assumptions for choice of matrix are not justified. BMC Evol Biol 6:29. doi: 10.1186/1471-2148-6-29 CrossRefPubMedPubMedCentralGoogle Scholar
  16. Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A, Markowitz S, Duran C et al (2012) Geneious basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28:1647–1649CrossRefPubMedPubMedCentralGoogle Scholar
  17. Kocabaş U (2008) Life at the Theodosian Harbour, wrecks and a rapid siting. In: Kocabaş U (ed) The “old ships” of the “new gate” 1. Ege Publishing, İstanbul, pp. 23–36Google Scholar
  18. Kocabaş U (2015) Geçmişe açılan kapı Yenikapı Batıkları. Ege Yayınları, İstanbulGoogle Scholar
  19. Krasińska M, Krasiński Z A (2013) European bison. The nature monograph. Second Ed., Springer-Verlag Berlin HeidelbergGoogle Scholar
  20. Lengerken HV (1953) Der Ur und seine Beziehungen zum Menschen. Neue Brehm-Bücherei/Leipzig 105:1–80Google Scholar
  21. Li H, Durbin R (2009) Fast and accurate short read alignment with Burrows–Wheeler transform. BİOİNFORMATİCS 25(14):1754–1760. doi: 10.1093/bioinformatics/btp324 PubMedPubMedCentralGoogle Scholar
  22. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R (2009) 1000 genome project data proc the sequence alignment/map format and SAMtools. Bioinformatics 25(16):2078–2079CrossRefPubMedPubMedCentralGoogle Scholar
  23. Lindgreen S (2012) AdapterRemoval: easy cleaning of next generation sequencing reads. BMC RES NOTES 5:337. doi: 10.1186/1756-0500-5-337 CrossRefPubMedPubMedCentralGoogle Scholar
  24. Onar V, Alpak H, Pazvant G, Armutak A, Gezer İnce N, Kızıltan Z (2013a) A bridge from Byzantium to modern day Istanbul: an overview of animal skeleton remains found during Metro and Marmaray excavations. JOURNAL OF THE FACULTY OF VETERINARY MEDICINE, Istanbul University 39:1–8Google Scholar
  25. Onar V, Pazvan G, Alpak H, Gezer-İnce N, Armutak A, Kızıltan ZS (2013b) Animal skeletal remains of the Theodosius harbor: general overview. Turk J Vet Anim Sci 37:81–85Google Scholar
  26. Pucek Z (1986) Bison bonasus (Linnaeus 1758)—Wisent. In. Niethammer J, Krapp F (eds) Handbuch der Saugetiere Europas. Band 2/II (Paarhufer), AULA-Verlag GmnH, Wiesbaden: 278–315Google Scholar
  27. Pucek Z (ed); Pucek Z, Belousova IP, Krasińska M, Krasiński ZA, Olech W (comps.) (2004) European bison. Status survey and conservation action plan. IUCN/SSB Bison Specialist Group IUCN, Gland, CambridgeGoogle Scholar
  28. Reimer PJ, Bard E, Bayliss A, Warren Beck J, Blackwell PG, Bronk Ramsey C, Buck et al (2013) IntCal13 and Marine13 radiocarbon age calibration curves 0–50,000 years cal BP. RADİOCARBON 55(4):1869–1887. doi: 10.2458/azu_js_rc.55.16947 CrossRefGoogle Scholar
  29. Rohland N, Harney E, Mallick S, Nordenfelt S, Reich D (2015) Partial uracil–DNA–glycosylase treatment for screening of ancient DNA. PHILOS T ROY SOC B 22:939–949Google Scholar
  30. Shapiro B, Drummond AJ, Rambaut A, Wilson MC, Matheus PE, Sher AV, Pybus OG, Thomas M, Gilbert P, Barnes I, Binladen J, Willerslev E, Hansen AJ, Baryshnikov GF, Burns JA, Davydov S, Driver JC, Froese DG, Harington CR, Keddie G, Kosintsev P, Kunz ML, Martin LD, Stephenson RO, Storer J, Tedford R, Zimov S, Cooper A (2004) Rise and fall of the Beringian steppe bison. Science 306:1561–1565CrossRefPubMedGoogle Scholar
  31. Schubert M, Ermini L, Der Sarkissian C, Jónsson H, Ginolhac A, Schaefer R, Martin MD et al (2014) Characterization of ancient and modern genomes by SNP detection and phylogenomic and metagenomic analysis using PALEOMIX. Nat Protoc 9(5):1056–1082. doi: 10.1038/nprot.2014.063 CrossRefPubMedGoogle Scholar
  32. Soubrier J, Gower G, Chen K, Richards SM, Llamas B, Mitchell KJ, Ho SYW, Kosintsev P, Lee MSY, Baryshnikov G, Bollongino R, Bover P, Burger J, Chivall D, Crégut-Bonnoure E, Decker JE, Doronichev VB, Douka K, Fordham DA, Fontana F, Fritz C, Glimmerveen J, Golovanova LV, Groves C, Guerreschi A, Haak W, Higham T, Hofman-Kamińska E, Immel A, Julien MA, Krause J, Krotova O, Langbein F, Larson G, Rohrlach A, Scheu A, Schnabel RD, Taylor JF, Tokarska M, Tosello G, vander Plicht J, vanLoenen A, Vigne JD, Wooley O, Orlando L, Kowalczyk R, Shapiro B, Cooper A (2016) Early cave art and ancient DNA record the origin of European bison. Nat Commun 7:13158. doi: 10.1038/ncomms13158 CrossRefPubMedPubMedCentralGoogle Scholar

Copyright information

© The Author(s) 2016

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.

Authors and Affiliations

  1. 1.Osteoarchaeology Practice and Research Center and Faculty of Veterinary MedicineIstanbul UniversityIstanbulTurkey
  2. 2.Australian Centre for Ancient DNA, School of Biological SciencesThe University of AdelaideAdelaideAustralia
  3. 3.Department of Biochemistry, Faculty of Veterinary MedicineIstanbul UniversityIstanbulTurkey
  4. 4.Department of Prehistory, Archaeology Division, Faculty of LettersIstanbul UniversityIstanbulTurkey
  5. 5.Department of Biostructure and Animal Physiology, Faculty of Veterinary MedicineWrocław University of Environmental and Life SciencesWrocławPoland
  6. 6.Department of Genetics and Evolution, Mammal Research Institute Polish Academy of SciencesBialowiezaPoland

Personalised recommendations