Advertisement

Applied Entomology and Zoology

, Volume 54, Issue 3, pp 319–322 | Cite as

Rapid detection of the red fire ant Solenopsis invicta (Hymenoptera: Formicidae) by loop-mediated isothermal amplification

  • Nobuyoshi NakajimaEmail author
  • Yoshiko Sakamoto
  • Koichi Goka
Open Access
Technical Note

Abstract

We developed a loop-mediated isothermal amplification (LAMP) assay to detect the red imported fire ant, Solenopsis invicta Buren, an invasive species in Japan. We designed species-specific LAMP primers on the basis of the nucleotide sequence of the S. invicta mitochondrial cytochrome c oxidase subunit 1 region. The system we developed has a sensitivity and specificity enabling detection of one S. invicta in a mixed sample including nine individuals of a non-target ant species. We were easily able to detect the S. invicta DNA visually based on the turbidity of the reaction mixture. This rapid and easy LAMP assay system provides a powerful tool for the early detection and identification of S. invicta in invaded regions.

Keywords

Invasive alien species Solenopsis invicta Loop-mediated isothermal amplification COX1 

Introduction

The red imported fire ant, Solenopsis invicta Buren (Hymenoptera: Formicidae), has been documented as entering Japan within ship cargo since June 2017. S. invicta queens and workers have been captured around international port areas, as well as in inland areas, and have even been seen in premises (Ministry of the Environment 2017; http://www.env.go.jp/nature/dobutsu/fireant.html#ABOUT). Although no established S. invicta nests have been found, it is believed to be only a matter of time before this species will naturalize in Japan.

Early detection is an important strategy to prevent S. invicta expansion. Because S. invicta may be artificially introduced across broad geographic regions via commercial transport, wider monitoring by officials and citizens is needed. However, non-experts cannot easily identify S. invicta based on morphological characteristics alone. In fact, we ourselves have needed specialists to confirm our identification of S. invicta, a process requiring at least several days. Therefore, it is crucial to develop a rapid and easy procedure to identify S. invicta.

Recently, Valles et al. (2016) developed a lateral-flow immunoassay detection system for S. invicta identification by raising monoclonal antibodies against S. invicta-specific venom proteins. However, that system requires protein from at least five workers to identify the species. Because the number of S. invicta individuals captured in the field during the early stages of invasion will be very small, the sensitivity of that immunoassay system is likely insufficient.

We considered that the loop-mediated isothermal amplification (LAMP) assay (Notomi et al. 2000) may enable easy and rapid detection of S. invicta. The assay is a single-tube isothermal technique for DNA amplification. Because the assay procedure is simple and rapid, LAMP has proven to be a powerful tool for monitoring invasive species. For example, Ide et al. (2018) developed a LAMP assay protocol to detect another invasive ant, Linepithema humile (Mayr).

In the present study, we designed S. invicta-specific LAMP primers and evaluated their specificity by performing LAMP assay amplification of DNA extracted from whole or partial individuals of S. invicta and several other ant species.

Materials and methods

Ant samples

Solenopsis invicta workers were collected from the Tokyo, Nagoya, and Kobe Ports in June and July 2017. They were stored individually at − 20 °C in a microtube until DNA extraction. Workers of Cardiocondyla sp., Crematogaster osakensis, Formica japonica, Monomorium chinense, Pheidole noda, Solenopsis japonica, Temnothorax sp., and Tetramorium tsushimae were collected from Tokyo and Tsukuba City, Japan in July 2017. These eight ant species are commonly found in port areas and are likely to be mistakenly identified as S. invicta. These samples were immersed in 99.5% ethanol and stored at − 20 °C until DNA extraction.

Primer design

In this study, we designed S. invicta-specific LAMP primers based on several genetically distinct populations collected at Japanese ports by the Ministry of the Environment. We selected the mitochondrial cytochrome c oxidase subunit 1 (COX1) gene as a target sequence. In arthropods, the nucleotide sequence of the COX1 region is highly divergent, and therefore is useful for species identification (Valles and Porter 2003). The nucleotide sequence of mitochondrial COX1 was obtained from the mitochondrial genome data of S. invicta registered in NCBI (https://www.ncbi.nlm.nih.gov/nuccore/NC_014672.1; accession no. NC_014672). Based on the sequence data, we designed seven sets of LAMP primer candidates using Primer Explorer Ver. 5.0 (https://primerexplorer.jp/v5_manual/index.html) under default conditions.

Evaluation of species specificity using purified DNA

DNA was isolated through SDS–phenol extraction with a modified RNA isolation method described by Nakajima et al. (1988). The whole body of each ant was separately homogenized with a mortar and pestle in 200 μL of extraction buffer (50 mM Tris–HCl (pH 8.0), 10 mM EDTA, and 1% SDS) and an equivalent amount of water-saturated phenol. The extracts were incubated at 60 °C for 10 min. After centrifugation at 20,000×g, the upper phases were transferred to fresh microcentrifuge tubes and sequentially extracted in phenol:chloroform (1:1) and then chloroform. DNA was recovered by ethanol precipitation and washed with 70% ethanol. The air-dried DNA was dissolved in 100 μL of Tris–EDTA (TE) buffer (10 mM Tris–HCl (pH 8.0) and 1 mM EDTA). DNA concentrations were determined with a TapeStation 2200 system (Agilent, Santa Clara, CA, USA).

DNA amplification via the LAMP assay was performed according to the protocol described by Notomi et al. (2000, 2015) using a Loopamp DNA Amplification Kit (Eiken Chemical, Tokyo, Japan). Each reaction contained 12.5 μL of reaction mix provided in the kit, 2 μL of FIP3 primer (20 μM), 2 μL of BIP3 primer (20 μM), 1 μL of F3_3 primer (5 μM), 1 μL of B3_3 primer (5 μM), 3.5 μL of nuclease-free water, 1 μL of Bst polymerase, and 2 μL of DNA. The reactants were placed in a dedicated clean PCR tube, and reactions were performed at 60 °C for 90 min. Turbidity indicative of the reaction progress was recorded with an LA-320C turbidimeter (Eiken Chemical).

Simplification of sample treatment for the LAMP assay

To simplify the DNA extraction processes, we also evaluated DNA samples obtained by the following methods. When an excised leg was used, the sample was homogenized in 40 μL of TE. Nucleases were inactivated by heating at 90 °C for 10 min. Then, 2 μL of the supernatant was used as a template for the LAMP reaction.

When a whole body was used, the sample was homogenized in 40 μL of TE. It was allowed to settle for 1 min, and 20 μL of the supernatant was transferred to another tube and mixed with 200 μL of InstaGene matrix (Bio-Rad, Hercules, CA, USA). The mixture was incubated at 56 °C for 30 min, vortexed for 10 s, incubated at 100 °C for 8 min, and then vortexed for 10 s. After the insoluble material was precipitated for 5 min, 2 μL of the supernatant was used as a LAMP reaction template.

Analysis of mixed samples

We also tested an extract from a mixed sample comprising one S. invicta worker and nine F. japonica workers. This native ant species is easily obtained and has a large amount of DNA per individual because of its large body size; so it is considered as an ideal sample for verifying the specificity of the LAMP method in the case of amplification using a contaminated DNA sample. In addition, about 10 ants can be homogenized in a microtube; so we chose to use one S. invicta and nine F. japonica workers in each microtube. The sample was homogenized in 400 μL of TE, and the extract was allowed to settle for 1 min for precipitation. Then, 20 μL of the supernatant was transferred to another tube and mixed with 200 μL of InstaGene. The mixture was treated as described above, and 2 μL of the supernatant was used as a template for the LAMP reaction.

Results and discussion

Species specificity of the LAMP primers

Among the seven primer sets designed, the FIP3 primer set showed the best amplification of S. invicta DNA. This primer set could amplify all DNA templates extracted from the S. invicta samples. The primer sequences are listed in Table 1, and their locations in the S. invicta COX1 gene are shown in Fig. 1. On the other hand, the other six primer sets were unable to detect some of the DNA templates.
Table 1

The FIP3 primer set used for the LAMP reaction to detect Solenopsis invicta DNA

Primer

Sequence (5′ → 3′)

FIP3

AGGCTCGTGTATCAACGTCAAGGTTTTATTGTTTGGGCACA

BIP3

TGAATTTCCACTCTCCACGGACCTATCGATCATCAGAGTGTG

F3_3

TGCTATAATCGCTATCGGAT

B3_3

CCTGTTAATCCTCCTATAGTGAAT

Fig. 1

Nucleotide sequences of the FIP3 primer set for the LAMP reaction and their locations in the S. invicta mitochondrial COX1 gene. Italic indicates the nucleotide sequence of S. invicta mitochondrial COX1 DNA (NC_014672.1). The bases that correspond to COX1 DNA are colored as follows: red, F2 and B2 regions of FIP3 and BIP3; green: F1c and B1c regions of FIP3 and BIP3; and blue: F3_3 and B3_3

We then performed LAMP assays with the FIP3 primer set for the eight Japanese native ant species (Fig. 2). Whereas marked turbidity was observed in the assay using S. invicta DNA, the diagnostic turbidity did not rise to the threshold level (OD = 0.1) in the reactions with native species’ DNA, indicating the specificity of the FIP3 set for S. invicta. Therefore, we selected the FIP3 set as the diagnostic primers.
Fig. 2

Specificity of the LAMP reaction with the FIP3 primer set, as measured by the optical density of LAMP reactions containing RNase-free water as a negative control (DW), DNA of eight Japanese native ant species, and DNA of S. invicta. Error bars represent the standard deviation of three independent reactions

Utility of the LAMP assay for field samples

To check for S. invicta at monitoring sites where their presence is assumed to be possible (e.g., port areas, green spaces, and playgrounds), we will occasionally need to use mixed samples of various ant species collected by traps. In some cases, we must identify S. invicta only from body parts, such as a leg. In addition, these DNA extracts should be obtained as easily as possible. Therefore, we tested the mixed DNA sample and single-leg DNA sample extracted by our rough protocol.

The assay using an extract from a mixed sample comprising one S. invicta worker and nine native ant workers clearly showed a positive turbidity signal for S. invicta (Fig. 3). Furthermore, our LAMP assay exhibited the same positive signal for whole-body extract and leg extract of S. invicta (Fig. 4a). After completion of the LAMP reaction, the turbidity of the solution in the tube containing the DNA of S. invicta could be confirmed visually (Fig. 4b). These results indicate that our LAMP system with the FIP3 primer set does not need highly purified DNA and has sufficient specificity to detect one S. invicta individual out of 10 ants.
Fig. 3

Detection specificity of the LAMP reaction with the FIP3 primer set. The optical densities of LAMP reactions containing RNase-free water as a negative control (DW), whole-body extract of F. japonica (Non-target), whole-body extract of S. invicta (S. invicta), or mixed extracts of one S. invicta worker and nine F. japonica workers (Mixed) are shown. Error bars represent the standard deviation of three independent reactions

Fig. 4

Detection of S. invicta DNA in leg and whole-body extracts via the LAMP reaction with the FIP3 primer set. a Optical density of LAMP reactions containing RNase-free water as a negative control (DW), whole-body extract of Formica japonica (Non-target), leg extract of S. invicta (Leg extract), and whole-body extract of S. invicta (Whole body) are shown. Error bars represent the standard deviation of three independent reactions. b Turbidity after LAMP reactions in microtubes containing (1) RNase-free water as a negative control, (2) whole-body extract of F. japonica, (3) leg extract of S. invicta, and (4) whole-body extract of S. invicta

Of note, given the very high intraspecific variation within ant species distributed worldwide (Ascunce et al. 2011), our LAMP primers might be unable to amplify some S. invicta haplotypes that have never been detected in Japan. However, because all S. invicta individuals that have been collected so far were detectable, our LAMP primers are currently the most effective tool for the rapid detection of S. invicta in Japan. To improve the sensitivity and reliability of the LAMP assay system, it is necessary to monitor the DNA variation of S. invicta in Japan.

This method can be easily used by non-scientists. Thus, it can be used not only for quarantine in port areas but also for the detection of S. invicta in public spaces such as schoolyards and parks. We are preparing to distribute our S. invicta detection system to various organizations throughout Japan to construct a national fire ant monitoring network.

Notes

Acknowledgements

We are grateful to Hitoshi Ohnishi of the National Institutes for Environmental Studies and the members of the Japan Wildlife Research Center for providing ant samples. We thank Mr. Seiji Narita for taking a beautiful picture of LAMP reactions. This research was supported by the Global Environment Research Fund (No. 4-1401, Leader: K. Goka) of the Ministry of the Environment, Japan.

References

  1. Ascunce MS, Yang CC, Oakey J, Calcaterra L, Wu WJ, Shih CJ, Goudet J, Ross KG, Shoemaker DW (2011) Global invasion history of the fire ant Solenopsis invicta. Science 331:1066–1068CrossRefGoogle Scholar
  2. Ide T, Kanzaki N, Masuya H, Okabe K (2018) Application of the LAMP assay for the detection of the Argentine ant, Linepithema humile (Hymenoptera: Formicidae), from captures of pan traps. Appl Entomol Zool 53:275–279CrossRefGoogle Scholar
  3. Nakajima N, Nakagawa N, Imaseki H (1988) Molecular size of wound-induced 1-aminocyclopropane-1-carboxylate synthase from Cucurbita maxima Duch. and change of translatable mRNA of the enzyme after wounding. Plant Cell Physiol 29:989–998Google Scholar
  4. Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, Hase T (2000) Loop-mediated isothermal amplification of DNA. Nucleic Acids Res 28:e63CrossRefGoogle Scholar
  5. Notomi T, Mori Y, Tomita N, Kanda H (2015) Loop-mediated isothermal amplification (LAMP): principle, features, and future prospects. J Microbiol 53:1–5CrossRefGoogle Scholar
  6. Valles SM, Porter SD (2003) Identification of polygyne and monogyne fire ant colonies (Solenopsis invicta) by multiplex PCR of Gp-9 alleles. Insect Soc 50:199–200CrossRefGoogle Scholar
  7. Valles SM, Strong CA, Callcott AMA (2016) Development of a lateral flow immunoassay for rapid field detection of the red imported fire ant, Solenopsis invicta (Hymenoptera: Formicidae). Anal Bioanal Chem 408:4693–4703CrossRefGoogle Scholar

Copyright information

© The Author(s) 2019

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.

Authors and Affiliations

  1. 1.Center for Environmental Biology and EcosystemsNational Institute for Environmental StudiesTsukubaJapan

Personalised recommendations