Advertisement

Journal of Applied Genetics

, Volume 59, Issue 3, pp 365–375 | Cite as

Population analysis of Magnaporthe oryzae by using endogenous repetitive DNA sequences and mating-type alleles in different districts of Karnataka, India

  • D. Jagadeesh
  • M. K. Prasanna Kumar
  • N. S. Devaki
Microbial Genetics • Original Paper

Abstract

Rice is the staple food crop of more than 60% of the population of the world. This crop suffers from blast disease caused by Magnaporthe oryzae. Information on the mating-type allele distribution and diversity of the pathogen population for the state of Karnataka, India is scanty. With this background, a total of 72 isolates of M. oryzae from rice in different districts of Karnataka were examined for identifying sexual mating alleles MAT1, MAT2 and understanding the genetic diversity based on DNA fingerprint of pot2, an inverted repeat transposon. Among 72 isolates, 44 isolates belonged to MAT1 type (male fertile) and 28 isolates were of MAT2 (female fertile) and there were no hermaphrodite isolates. In a given geographical location, only one mating type was identified. Results revealed that the isolates obtained from these regions are not sexually fertile showing predominant asexual reproduction. Hence, genetic variation observed in the pathogen may be mainly because of high copy number of transposons. A high copy number transposon, namely Pot2, was selected in our study to detect genetic diversity of the pathogen. Pot2 rep-PCR DNA fingerprinting profile showed 27 polymorphic bands with bands ranging in size from 0.65 to 4.0 kb and an average of 10 to 14 bands per isolate. Five distinct clusters were formed with two major, two minor, and one outlier. Clusters 4 and 5 are further subdivided into three sub-clusters. Some of the isolates belonging to clusters 3, 4, and 5 are interlinked as these locations are close to one another sharing common geographical parameters and boundaries. This knowledge on the sexual behavior and genetic diversity of M. oryzae is important with respect to breeding for disease resistance.

Keywords

Magnaporthe oryzae Mating type MAT1 MAT2 Pot2-TIR Genetic diversity 

Introduction

Magnaporthe oryzae B.C. Couch, (Anamorph: Pyricularia oryzae Cavara) is a heterothallic and occasionally a hermaphroditic ascomycetus fungus (Couch and Kohn 2002). It is one of the major fungal pathogens of paddy. Rice is the global staple food for over half the world’s population. It provides 50% dietary caloric value for 520 million people who are living in poverty in Asian countries. Blast disease-resistant rice varieties are much desired for cultivation, so that we can reduce fungicide application, eventually minimize the agrochemical use and their effects in the rice fields, thus reducing the cost of production. Ability of M. oyzae to breakdown resistance within a short time after release of a new rice variety has created challenges to breeders in developing blast disease resistant variety. Analysis of genetic diversity and instability of M. oryzae populations is required for understanding coevolution in the plant pathosystem (McDonald et al. 1989). Knowledge of virulence among isolates collected from rice in different regions is one of the steps towards developing blast resistant varieties of rice.

Blast fungus shows both anamorph and telemorph stages. Teleomorph stage was originally described as M. grisea (Herbert 1971) and later as M. oryzae (Couch and Kohn 2002). In this stage, the genes of two parents are mixed resulting in higher variability which enables the fungus to successfully adapt with environmental change. The fungus is known for its high genetic diversity, sexual recombination, and random mating (Kotasthane et al. 2004). Asexual stage of the fungus is more common compared to sexual stage which is extremely rare (Zeigler et al. 1994). Sexual recombination leading to the formation of ascospores is controlled by a single locus with two different alleles, namely MAT1 (male fertile) and MAT2 (female fertile) (Kang et al. 1994). During the formation of perithecia which contain ascospores, several other genes are also expressed (Fathy and Prashanthi 2016).

Studies on the population structure of M. oryzae around the world were carried out using morphological, biochemical, and molecular markers mainly based on MGM 586 repetitive DNA sequence, Pot2 inverted repeat transposon, and DNA markers like RAPD, RFLP, AFLP, SSR, and SNP. Pot2, an inverted repeat transposon with a copy number of approximately 100 per haploid genome, is one of the major repetitive DNAs shared by both rice and non-rice pathogens of M. grisea (Kachroo et al. 1994). It is found scattered throughout the genome. Pot2 analysis for population structure is easier to perform with minimum equipment, low cost, and easy to analyze than that of other DNA markers, namely RFLP and AFLP. Some isolates of M. oryzae appear genetically unstable and generate new pathogenic variants at a high frequency in short period of time (Ou and Ayad 1968). This can be understood by assessing the inverted repeat transposons and mating-type alleles which help to measure the population diversity of M. oryzae.

Information about the occurrence of mating-type alleles and population structure is lacking regarding M. oryzae in Karnataka. With this background, the current investigation on distribution of mating types and Pot2 inverted repeat transposon of M. oryzae infecting rice from various geographical locations of Karnataka, India were carried out.

Materials and methods

Collection of blast disease samples

The Rice blast disease samples were collected from farmers’ fields from different districts of Karnataka including different agro climatic zones, namely Northern Dry Zone, Central Dry Zone, Southern Dry Zone, Southern Transition Zone, Northern Transition Zone and in some parts of Hilly Zone. Blast-infected tissue samples viz., leaf, node, neck, and panicles of paddy plant were collected during 2012–2013 and 2013–2014 Kharif season (Table 1). Different parameters like severity of the disease, variety name, age of the crop, and type of infection were recorded. Samples were taken in different brown envelop paper covers and labeled separately and brought to laboratory for isolation of blast fungus.
Table 1

Mating-type distribution of 72 isolates of Magnaporthe oryzae based on mating-type alleles of MAT locus in Karnataka, India

Sl. no.

District

Isolate code*

Place of collection

Latitude

Longitude

Host variety

MAT

1

Chamarajnagar

CKDS01

Dasanapura

12° 10′ 55.0″ N

77° 05′ 49.7″ E

MTU 1010

1

CKHM02

Hampapura

12° 10′ 22.5″ N

77° 04′ 53.0″ E

Jaya

1

CKHR03

Harale

12° 10′ 49.9″ N

77° 06′ 57.7″ E

MTU 1001

2

CKHR04

Harale

12° 10′ 48.6″ N

77° 06′ 59.8″ E

Gowri sanna

1

CKKL05

Kollegal

12° 09′ 38.2″ N

77° 05′ 52.0″ E

Minilong

1

CKML06

Mullur

12° 09′ 33.7″ N

77° 03′ 57.7″ E

IR-64

1

CKST07

Settahalli

12° 11′ 38.9″ N

77° 03′ 05.4″ E

Minilong

1

CKST08

Settahalli

12° 11′ 25.1″ N

77° 03′ 23.9″ E

Jyothi

2

CKTR09

Teramballi

12° 08′ 14.1″ N

77° 03′ 26.5″ E

MTU 1001

2

CYAG10

Agara

12° 06′ 44.0″ N

77° 03′ 46.4″ E

KCP-1

2

CYJM11

Jodimellahalli

12° 02′ 03.3″ N

77° 02′ 15.1″ E

Jyothi

1

CYKT12

Katnavadi

12° 06′ 44.4″ N

77° 02′ 40.8″ E

Gowri sanna

1

CYKS13

Kestur

12° 05′ 43.7″ N

77° 01′ 04.2″ E

MTU 1001

2

CYKK14

Kinakahalli

12° 06′ 57.5″ N

77° 03′ 23.0″ E

IR64

2

CYLR15

Yelandur Rural

12° 02′ 16.0″ N

77° 01′ 59.1″ E

KCP-1

1

2

Kodagu

KMBT16

Bethu

12° 17′ 57.4″ N

75° 41′ 09.4″ E

Tunga

1

KMHK17

Hakathoor

12° 21′ 32.2″ N

75° 46′ 16.6″ E

Jeerige sanna

2

KMHD18

Hoddur

12° 18′ 48.3″ N

75° 43′ 08.9″ E

Rajamudi

1

KVAM19

Ammatti

12° 14′ 41.6″ N

75° 51′ 43.7″ E

Mangala

1

KVBL20

Balele

12° 09′ 57.7″ N

76° 02′ 02.8″ E

Rajbhoga

2

KVBG21

Bilugunda

12° 12′ 33.1″ N

75° 50′ 33.1″ E

Sona Masuri

1

KVBL22

Bilur

12° 08′ 11.1″ N

76° 01′ 11.8″ E

Rajamudi

2

KVHG23

Halligattu

12° 08′ 20.4″ N

75° 54′ 58.3″ E

MTU 1001

2

KVKM24

Kalathmadu

12° 11′ 36.8″ N

75° 53′ 09.4″ E

KHP-11

1

KVKR25

Kirgur

12° 08′ 33.6″ N

75° 58′ 10.3″ E

Athira

1

KVPN26

Ponnampet

12° 08′ 40.7″ N

75° 56′ 30.2″ E

BR 2655

2

KSAB27

Abbimatta

12° 37′ 41.0″ N

75° 48′ 25.4″ E

Jeerige sanna

1

KSHB28

Hebbale

12° 31′ 32.4″ N

75° 58′ 51.4″ E

Jyothi

2

KSKK29

Kalakandur

12° 36′ 59.9″ N

75° 49′ 48.3″ E

Rajbhoga

1

KSSR30

Sirangala

12° 33′ 40.5″ N

76° 00′ 14.3″ E

Intan

1

3

Mandya

MKKN31

Kurnenahalli

12° 37′ 28.4″ N

76° 25′ 17.6″ E

Tunga

1

MKMD32

Maduvinakodi

12° 35′ 03.4″ N

76° 26′ 23.2″ E

Mandya Vijaya

1

MMMG33

Malagaranahalli

12° 33′ 03.3″ N

77°03′37.4″E

Thanu

2

MMNG34

Nagarakere

12° 33′ 34.3″ N

77° 03′ 01.0″ E

KRH-4

2

MMAD35

Aladahalli

12° 27′ 44.7″ N

76° 51′ 24.8″ E

Jaya

1

MMKO36

Koregala

12° 25′ 05.4″ N

77° 02′ 09.8″ E

MTU 1010

1

MMGV37

Goravale

12° 34′ 55.5″ N

76° 50′ 33.1″ E

KHP-10

1

MMSV38

Shivalli

12° 35′ 15.4″ N

76° 49′ 35.6″ E

Jaya

2

MMVF39

V.C. Farm

12° 34′ 22.9″ N

76° 49′ 32.1″ E

IR64

1

MMVF40

V.C. Farm

12° 34′ 24.1″ N

76° 49′ 43.4″ E

HR-12

2

MPAK41

Aralakuppenala

12° 25′ 58.7″ N

76° 37′ 31.8″ E

Rasi

1

MPDY42

Devarayanapatna

12° 33′ 21.9″ N

76° 39′ 04.3″ E

KRH 4

2

MPPD43

Pandavapura

12° 29′ 40.0″ N

76° 40′ 08.1″ E

Raksha

1

MSCH44

Chandagalu

12° 32′ 24.2″ N

76° 49′ 57.1″ E

Sona Masuri

1

MSKM45

Karimanti

12° 24′ 53.9″ N

76° 39′ 22.3″ E

MTU 1001

2

4

Mysuru

MHHM46

Hommaragahalli

12° 07′ 19.4″ N

76° 26′ 48.5″ E

Jyothi

1

MHSR47

Sagare

11° 59′ 13.5″ N

76° 21′ 47.1″ E

Thanu

1

MHHN48

Hunsur

12° 18′ 08.0″ N

76° 16′ 40.1″ E

KRH-4

1

MKBD49

Byadarahalli Hantha

12° 30′ 46.2″ N

76° 19′ 40.7″ E

MTU 1001

1

MKHB50

Hebbalu

12° 27′ 59.1″ N

76° 21′ 09.2″ E

Jyothi

2

MKML51

Mirle

12° 32′ 29.0″ N

76° 19′ 10.9″ E

MTU 1001

1

MMKL52

Kalasthavadi

12° 22′ 44.6″ N

76° 40′ 24.0″ E

Thanu

2

MMNG53

Naganahalli

12° 22′ 52.1″ N

76° 39′ 21.1″ E

Jyothi

2

MMSD54

Siddalingapura

12° 22′ 10.9″ N

76° 39′ 57.3″ E

MTU 1001

1

MNHJ55

Hejjige

12° 07′ 41.3″ N

76° 41′ 36.0″ E

Sona Masuri

2

MNHU56

Hullahalli

12° 06′ 07.6″ N

76° 32′ 57.6″ E

Jyothi

1

MNHM57

Hullimavu

12° 09′ 24.8″ N

76° 44′ 09.2″ E

Jyothi

1

MNRM58

Rampura

12° 06′ 48.2″ N

76° 33′ 45.5″ E

JGL 1798

1

MTHR59

Hiriyuru

12° 12′ 02.0″ N

76° 57′ 00.6″ E

Jyothi

2

MTSS60

Sosale

12° 14′ 26.7″ N

76° 54′ 51.0″ E

KCP-1

1

5

Bellary

BBEM61

Emmiganur

15° 24′ 01.0″ N

76° 43′ 00.1″ E

Sona Masuri

2

BHDS62

Devasamudra

15° 20′ 42.6″ N

76° 38′ 38.2″ E

Sona Masuri

2

BHBG63

Belugoduhal

15° 25′ 22.6″ N

76° 37′ 09.8″ E

Sona Masuri

1

6

Davangere

DDNS64

Nagarasanahalli

14° 19′ 15.1″ N

75° 50′ 39.7″ E

Mugad Siri 1253

1

7

Dharwad

DDMU65

Mugad

15° 26′ 09.6″ N

74° 54′ 51.0″ E

Mugad Sugandha

2

8

Hassan

HHCC66

Chikkchagahalli

12° 45′ 32.2″ N

76° 15′ 12.0″ E

MTU 1001

1

HHHM67

Hallimysore

12° 38′ 52.3″ N

76° 15′ 33.2″ E

Rajamudi

2

9

Koppal

KGGV68

Gangavathi

15° 26′ 19.5″ N

76° 33′ 06.2″ E

Gangavathi Sona

1

10

Raichur

RRKD69

Kadlur

16° 22′ 04.3″ N

77° 16′ 48.7″ E

Sona Masuri

1

11

Shivamogga

SBGN70

Guninarasipura

13° 49′ 18.6″ N

75° 43′ 52.3″ E

KRH-4

2

SBBM71

Balemaranahalli

13° 47′ 44.7″ N

75° 41′ 27.0″ E

KHP-2

1

SSHB72

Holebenavalli

13° 55′ 08.9″ N

75° 37′ 18.1″ E

Hemavathi

1

*Isolate code: the first, second, third, and fourth letters of the isolates indicate the district, taluk, and place of sample collection, respectively. These letters are followed by collection numbers

Isolation of mono-conidial isolates of M. oryzae and maintenance of pure culture

The fungus M. oryzae was isolated from blast infected tissue like leaf, neck, collar, node, stem, and panicle. Diseased samples were cut into small bits. These bits were surface sterilized and kept inside moist chamber. This set up was incubated at 28 °C for 48 h to induce sporulation. These spores were transferred to sterile water agar taken in petri plates and single germinated conidium from water agar was picked up and transferred to fresh oat meal agar (OMA) plate with streptomycin sulfate (40 mg/L) and incubated at 28 °C for 14 days.

Pathogenicity test

Pathogenicity test was carried out for all isolates of Magnaporthe oryzae to confirm etiology of the disease. For this purpose, sterilized soil was filled in 20-cm diameter plastic pots. HR12 (susceptible variety) paddy seeds were sown and conidial suspension of M. oryzae was sprayed over 10-day-old seedlings and disease severity was recorded after 72 h of inoculation.

The conidial suspensions of each isolates of the fungus was inoculated at 3 to 4 leaf stage of rice plant HR12 by spraying approximately at 0.2 ml/plant. The controls were sprayed with water containing 0.05% Tween 20. The inoculated plants were incubated at 25 to 28 °C under 100% relative humidity for 48 h under darkness for successful penetration of germ tube and disease development. The humidity was maintained using humidifier for another 8 days after inoculation and then was exposed to open air. Three replications were kept for each treatment and data on disease incidence and severities were recorded.

Disease assessment and data recording

Leaf blast severity of each isolate was recorded from individual plant using standard leaf blast scoring procedure developed by IRRI 0–5 scale and 0–9 scale (IRRI, 1996). To complete Koch’s postulates, re-isolations of few isolates from the infected leaves obtained by artificial inoculation were made following the protocol previously described.

Molecular characterisation of M. oryzae isolates

Genomic DNA isolation

DNA was extracted from single spore cultures of M. oryzae isolates from rice plant using DNA extraction method as described by Viji et al. (2000) with minor modifications.

M. oryzae isolates were grown on a corn meal broth for 14 days in 250-ml Erlenmeyer flasks under continuous shaking at 50 rpm at 28 °C. The fungal mycelium was filtered through sterilized miracloth and ground in a mortar with a pestle in liquid nitrogen to a fine powder. This was taken in 2-ml Eppendorf tube with 1 ml of CTAB buffer and kept at 65 °C for 30 min with occasional shaking. A volume of 750 μl of chloroform-isoamyl alcohol mixture (24:1) was added to each tube and the samples were centrifuged at 8000 rpm for 10 min (Remi Cooling centrifuge, Mumbai, India). After centrifugation, the aqueous, viscous supernatant (approximately 400 μl) was transferred to a fresh Eppendorf tube. 0.7 volumes (approximately 280 μl) of cold isopropanol (kept at – 20 °C) was added to this tube to precipitate the nucleic acid. The solutions were carefully mixed and the tubes were kept at – 20 °C for 1 h. The samples were centrifuged at 8000 rpm for 15 min.

The supernatant was decanted under fume-hood and pellets were vacuum dried for 10 min. Two hundred microliters of low-salt TE buffer (1 mM Tris-Cl and 0.5 mM EDTA) and 3 μl of RNase (stock 10 mg/μl) were added in order to remove co-isolated RNA to each tube containing dry pellet and mixed properly. The solution was incubated at room temperature overnight. After incubation, 200 μl of phenol-chloroform-isoamyl alcohol mixture (25:24:1) was added to each tube, mixed and centrifuged at 8000 rpm for 10 min. The aqueous layer was transferred to fresh tubes and chloroform-isoamylalcohol (24:1) mixture was added to each tube, gently mixed and centrifuged at 8000 rpm for 10 min. The aqueous layer was transferred to fresh tubes. Fifteen microliters (approximately 1/10th volume) of 3 M sodium acetate (pH 5.2) and 300 μl (2 volume) of absolute ethanol (kept at – 20 °C) were added to the tubes containing aqueous layer and the tubes were subsequently placed in a freezer (− 20 °C) for 30 min. The tubes were centrifuged at 8000 rpm for 15 min following incubation. After centrifugation, supernatant was carefully decanted from each tube ensuring that the pellets remained inside the tubes and 200 μl of 70% ethanol was added to the tubes followed by centrifugation at 8000 rpm for 5 min. Pellets were obtained by decanting the supernatant from each tube and then dried in vacuum for 10 min. Completely dried pellets were re-suspended in 100 μl of TE (10 mM Tris-Cl and 1 mM EDTA) buffer and incubated overnight at room temperature to allow them to dissolve. Dissolved DNA samples were stored at 4 °C. Quality and quantity of DNA were checked with nanodrop as well as by running on 0.8% agarose gel.

PCR amplification of ITS and sequencing

The internal transcribed spacer (ITS) regions of M. oryzae isolates were amplified using universal primers ITS1 (5″-TCCGTAGGTGAACCTGCGG-3″) and ITS4 (5″-TCC TCC GCTTATTGATATGC-3″) (White et al. 1990). PCR reactions were performed in 20 μl mixture containing 1.6 μl of 50 ng of total DNA, 1 μl Taq DNA polymerase (1 U/μl), 0.5 μl of both forward and reverse primers (1 μM), and 1.6 μl of dNTPs (10 mM). The reaction mixture was made up to 20 μl using Milli Q water. The reaction was carried out in Mastercycler Pro thermal cycler (Eppendorf, Hamburg, Germany). For amplification of the ITS regions of the rDNA, the following temperature profiles were used: 5 min initial denaturation at 94 °C followed by 35 cycles of 94 °C for 45 s, 58 °C for 1 min, 72 °C for 1 min, and a final extension step at 72 °C for 5 min. The PCR product was analyzed by electrophoresis in 1.5% agarose using 1 × TAE buffer. Sequencing was done at Chromous Biotech Pvt. Ltd., Bangalore, India. The sequences obtained in this study were compared with those already available in the GenBank database using BLAST software on the National Center for Biotechnology Information website (http://www.ncbi.nlm.nih.gov/BLAST/) and these sequences were submitted to GenBank database using BankIt submission tool.

Mating-type assay

The gene encoding the mating type was amplified by polymerase chain reaction (PCR) using the primers as reported by Tredway et al. (2003): MAT1 forward primer (5′ATGAGAGCCTCATCAACGGCA3′) and reverse primer (5′-ACAGGATGTAGGCATTCGCAGGAC3′) and MAT2 forward primer (5′ACAAGGCAACCATCTGGACCCTG3′) and reverse primer (5′CCAAAACACCGAGTGCCATCAAGC3′). PCRs were done in a final volume of 20 μl containing 1.6 μl of 25 ng of template DNA, 2 μl of Taq buffer with 15 mM MgCl2, 1.6 μl of 0.25 mM of each dNTP, 1.6 μl of 1 μM of each set of primer, and 1 μl of 0.2 unit of Taq polymerase. The reaction mixture was made up to 20 μl using Milli Q water. The following temperature profile was used for amplification of the mating-type gene: an initial denaturation step at 95 °C for 5 min, 35 cycles of 95 °C for 1 min, 56 °C for 1 min, and 72 °C for 1 min, followed by 72 °C for 5 min. PCR products were separated by electrophoresis in a 1.5% agarose gel at 80 V for 90 min and photographed.

Rep-PCR amplification of Pot2-terminal inverted repeat transposon (Pot2-TIR) and analysis

Rep-PCR amplifications were performed using oligonucleotide primers reported by George et al. (1998), namely forward primer (5′ CGGAAGCCCTAAAGCTGTTT 3′) and reverse primer (5′ CCCTCATTCGTCACACGTTC 3′). PCR was done in a final volume of 20 μl containing 1.6 μl of 30 ng of template DNA, 2 μl of Taq buffer with 15 mM MgCl2, 1.6 μl of 0.25 mM of each dNTP, 1.6 μl of 1 μM of primer, and 2 μl of 0.5 unit of Taq polymerase. The reaction mixture was made up to 20 μl using Milli Q water. The following temperature profile was used for amplification of the Pot2-terminal inverted repeat (TIR) regions: an initial denaturation step at 95 °C for 5 min, 35 cycles of 95 °C for 1 min, 58 °C for 1 min, and 72 °C for 2.5 min, followed by 72 °C for 5 min. PCR products were separated by electrophoresis in 1.5% agarose gel at 80 V for 90 min, stained with ethidium bromide, and photographed. This experiment was repeated thrice.

Bands of various molecular weight sizes were scored for the presence (1) and absence (0) of the corresponding band among the genotypes in the form of a binary matrix, and the data matrix was subjected to further analysis using NTSYS-pc version ver.2.0. (Rohlf 1998). The SIMQUAL program was used to calculate Jaccard’s similarity coefficients. The resulting similarity matrix was used for unweighted pairgroup method with arithmetic mean (UPGMA)-based dendrogram construction.

Results

Collection of blast-diseased samples and maintenance of pure culture

Pure cultures of 72 mono-conidial isolates were established from blast-infected tissue samples collected from farmers’ fields at different districts of Karnataka, India and maintained at −20 °C with unique code numbers with four letters and two numbers, with the first, second, third, and fourth letters of the isolates indicating the district, taluk, and place of sample collection, respectively. These letters are followed by collection numbers (Table 1).

Pathogenicity test

Among the 60 isolates, 16 leaf blast pathogen isolates were found to be highly virulent. The severity of each of these isolates was found to be between 4 and 9 according to the standard leaf blast scoring procedure developed by IRRI.

Molecular characterization of M. oryzae isolates

A single band of 550 bp in all the isolates was obtained during PCR amplification using universal primer ITS1/ITS4. The output sequences obtained matched with already submitted M. oryzae sequences in the database confirming the species. Accession numbers for 72 sequences were obtained from GenBank database.

Mating-type assay

The 72 isolates of M. oryzae collected from different geographical locations of Karnataka, India showed clear status of mating-type distribution in these regions. Each isolate produced an intact single band of expected size. MAT1 mating type (male) generated the band of 522 bp where as MAT2 (female) generated a 390-bp amplicon (Fig. 1). Among 72 isolates, 44 isolates were MAT1 (61.11%) while 28 (38.89%) were of MAT2. The MAT1-type predominated in Koppal (100%), Raichur (100%), Davangere (100%), Shivamogga (66.67%), Mysuru (66.66%), Chamarajnagar (60%), Kodagu (60%), and Mandya (60%) districts. MAT2 type was predominant in Dharwad (100%) and Bellary (66.67) districts. Both MAT1 and MAT2 types were found to be equally distributed in the isolates collected from Hassan district (50%) (Fig. 2).
Fig. 1

DNA fingerprinting pattern of 72 Magnaporthe oryzae isolates obtained from different districts of Karnataka, India. Gels a, b, and c (24 isolates in each gel): In each block, the upper gel was amplified using MAT1 primers and lower gel with MAT2 primers

Fig. 2

Mating-type distribution of 72 Magnaporthe oryzae isolates isolated from different districts of Karnataka, India (X-axis, districts; Y-axis, number of isolates)

Rep-PCR amplification of Pot2-TIR and analysis

Twenty-seven polymorphic bands were observed for Pot2 rep-PCR with bands ranging in size from 0.65 to 4.0 kb and an average of 10 to 14 bands per isolate was amplified as shown in (Fig. 3). In the UPGMA dendrogram 72 M. oryzae genotypes were grouped into two major (4 and 5), two minor (2 and 3) clusters, and one outlier (isolate DDNS64 and DDMU65) (Fig. 4). Four and 5 were further divided into three sub-clusters. Out of three sub-clusters of fifth cluster, six isolates fall in a single group, 16 isolates form another group, and the rest 10 isolates form different group including one outlier to the fifth cluster which is shared by the isolates belonging to two adjoining districts, namely Chamarajnagar and Mandya. In the fourth cluster, 5 isolates form one group and the remaining 18 isolates are further divided in two groups of 12 and 6 isolates. Cluster 4 is shared by the isolates of the neighboring two districts, namely Kodagu and Mysuru. In cluster 3, there are nine isolates including one outlier (SBGN70). The isolates of clusters 1 and 2 form separate group due to their geographical distance and variability. Clusters 3, 4, and 5 are interlinked with one another as these places are close to one another and share common geographical parameters and boundaries.
Fig. 3

DNA fingerprinting pattern of 72 Magnaporthe oryzae isolates from different districts of Karnataka, India in gel a, b and c (24 isolates in each gel) with Pot2-TIR primers

Fig. 4

Dendrogram of 72 isolates of Magnaporthe oryzae isolated from rice in different districts of Karnataka, India. Numbers 1, 2, 3, 4, and 5 indicate different clusters

Discussion

During current investigation, predominant expression of single mating type was observed which is evident by the categorization of 44 and 28 isolates to MAT1- and MAT2-type alleles, respectively. In a given geographical location, only one mating type was identified. Many researchers have also reported the predominance of single mating type from a given geographical location (Zeigler 1998; Yaegashi and Nishihara, 1976). The 227 isolates collected from different states of India showed presence of predominant MAT1 compared to MAT2 mating type (Dayakar et al. 2000). Mating-type distribution of rice blast pathogen in North-East and Eastern India was analyzed and the results showed the predominant distribution of MAT2 type (35 isolates), 16 isolates belonged to MAT1 (Imam et al., 2015). Similar type of work was carried in south India where 97 isolates were tested for mating type, out of which 46 isolates showed mating-type allele MAT1, 42 showed mating-type MAT2 and 7 isolates showed hermaphrodite (Fathy and Prashanthi 2016). Mating-type distribution of rice blast pathogen in Argentina showed single predominant MAT1, indicating a predominant asexual reproduction. Similar studies were conducted in Europe, Asia, Northern South America, and Central African countries by testing 467 rice blast pathogen populations using mating-type markers and the results showed the higher number of MAT1 isolates (Notteghem and Silue 1992). Distribution of different mating-type alleles in these regions where in majority of the locations showed only one mating type suggests that there is a less possibility of occurrence of sexual recombination in these locations resulting in asexual reproduction (Kolmer et al. 1988; Kumar and Zeiglerb, 1995).

One of the studies reported on genetic variability of Magnaporthe species in rice and finger millet from southern India using multi marker system including repetitive DNA-based markers, namely Pot2, grasshopper, and mating locus was carried out to understand the dynamic gene flow between these two crops. Results revealed that there was a high genetic diversity and clustering formed based on geographical location and distribution of isolates and host species. In rice, MAT1 occurrence was found to be 83.95% showing its predominance and MAT2 was 12.5%. In ragi, MAT1 was 48.72% and MAT2 was 51.28% (Mahesh et al. 2016).

In the above work, they have selected four geographical regions in southern India, namely Kodagu (Rice), Hyderabad (Rice), Mandya (Rice-Finger millet), and Bengaluru (Finger millet) representing three crop ecosystems. In our investigation, genetic diversity of a pathogen infecting single crop was carried out in detail. M. oryzae isolates collected from different agro climatic zones, namely North Eastern Dry Zone, Northern Dry Zone, Central Dry Zone, Eastern Dry Zone, South transition Zone, Southern Dry Zone, North Transition Zone, and Hilly Zone covering 11 districts of Karnataka were obtained from 32 different susceptible varieties (Table 1). Results of current study showed the extent of variation in the pathogen isolated from different varieties of single host species (rice) grown in varied agro climatic zones.

Our study revealed that rep-PCR based on terminal inverted repeat Pot2 is highly effective and reproducible, easier to perform with minimum equipment, low cost, and easy to analyze. The inverted repeat Pot2 markers are neither dominant nor co-dominant, but they are considered to be neutral markers for analysis of population structure and are found to be efficient to study the extent of genetic diversity of M. oryzae. In the Philippines, rapid population analysis of M. grisea revealed the utility of Pot2 inverted repeats to differentiate rice and non-rice-infecting isolates during cluster analysis of data from Pot2 PCR fingerprinting (George et al. 1998). In the current investigation the populations of M. oryzae distributed in five clusters showed two major clusters, namely 4 and 5, two minor clusters 2 and 3, and one outlier. Furthermore, the cluster analysis indicated that there was an overlapping lineage among the isolates belonging to different districts. This is because they share common geographical parameters and boundaries. Similar type of work was carried out in two Brazilian upland rice cultivars Maravilha and Primavera, using rep-PCR analysis where results showed two distinct clusters with low genetic diversity.

Analysis of Magnaporthe oryzae population using DNA polymorphism of transposable elements helped us to understand the genetic variation which is important for the pathogen to evolve virulence and to adapt to change in environment. Results revealed the presence of abundant transposable elements which are the major contributors to genome rearrangements resulting in genetic variations. Genome rearrangements can occur by delections, duplications, inversions, reciprocal translocations. Such variations are observed in Fusarium oxysporum where the role of transposable element in the reorganization of the genome, correlation between chromosomal polymorphism and concentration of transposable elements were studied (Davie’re et al. 2001).

Present study revealed there was no evidence of sexual recombination in the population of M. oryzae isolates from 11 districts of Karnataka, India. Asexual reproduction observed in all the isolates was supported by the outcome of MAT1 and MAT2 locus identification. Hence, genetic variation observed in the pathogen may be mainly because of high copy number of transposons.

Use of Pot2 has several advantages as this molecular marker is found to be with high copy number distributed all over the genome (George et al. 1998). Our study revealed the presence of variable length fragments for different isolates based on Pot2 marker which helped us to pinpoint the extent of genetic diversity of the pathogen isolates. The technique is found to be reliable, reproducible, and highly discriminatory for assessment of genetic diversity. This is the first report of mating types of M. oryzae population infecting rice in different agro climatic zones of Karnataka.

Conclusions

In this study, we identified mating-type distribution and extent of genetic diversity among the isolates isolated from different geographical regions of Karnataka, India. Pathogen showed variations even though in a geographical location only one mating type was identified. DNA polymorphism of transposable elements helped us to understand the genetic variation which is important for the pathogen to evolve virulence and to adapt to changing environment. Pot2 is a good molecular marker to study the large population diversity. Overall, our data provided the status of the mating-type distribution and fertility status of the M.oryzae in the state of Karnataka, India and genetic diversity existing among them. This knowledge will help breeding for disease resistance of rice cultivars.

Notes

Acknowledgements

Authors are grateful to the Department of Plant Pathology, GKVK, UAS, Bangalore for providing the instrumentation facility to carry out molecular work. We are also thankful to Yuvaraja’s College, University of Mysore, Mysuru for providing the facilities for carrying out this research work.

Author contributions

DJ conducted the experiment, analyzed the data, and drafted the manuscript.

DJ, MKP, and NSD performed the phenotypic evaluation which helped to do data analysis.

MKP participated in the design of the study.

NSD designed and coordinated this study and revised the manuscript.

All authors have read and approved the final manuscript.

Funding information

We thank the University Grants Commission, New Delhi for the financial support by sanctioning Major Research Project (F.No. 41-408/2012 (SR) dated July 2012) to carry out this Investigation

Compliance with ethical standards

This article does not contain any studies with human or animal subjects.

Competing interests

The authors declare that they have no competing interests.

References

  1. Couch BC, Kohn LM (2002) A multilocus gene genealogy concordant with host preference indicates segregation of a new species, Magnaporthe oryzae, from M. grisea. Mycologia 94:683–693CrossRefPubMedGoogle Scholar
  2. Davie’re JM, Langin T, Daboussi MJ (2001) Potential role of transposable elements in the rapid reorganization of the Fusarium oxysporum genome. Fungal Genet Biol 34:177–192CrossRefGoogle Scholar
  3. Dayakar BV, Narayanan NN, Gnanamanickam SS (2000) Cross-compatibility and distribution of mating type alleles of the rice blast fungus Magnaporthe grisea in India. Plant Dis 84:700–704CrossRefGoogle Scholar
  4. Fathy K, Prashanthi SK (2016) Distribution of mating type alleles and fertility of Magnaporthe oryzae isolates in South India. Int J Adv Res 4: 1146–1158.CrossRefGoogle Scholar
  5. George MLC, Nelson RJ, Zeigler RS, Leung H (1998) Rapid population analysis of Magnaporthe grisea by using rep-PCR and endogenous repetitive DNA sequences. Phytopathology 88:223–229CrossRefPubMedGoogle Scholar
  6. Hebert TT (1971) The perfect stage of Pyricularia grisea. Phytopathology 61:83–87CrossRefGoogle Scholar
  7. Imam J, Alam S, Mandal NP, Maiti D, Variar M, Shukla P (2015) Molecular diversity and mating type distribution of the rice blast pathogen Magnaporthe oryzae in North-east and Eastern India. Indian J Microbiol 55:108–113CrossRefGoogle Scholar
  8. IRRI (1996) Standard evaluation system for rice. 4th (eds.), international rice research institute (IRRI), Los Banos, Philippines.pp52Google Scholar
  9. Kachroo P, Leong SA, Chattoo BB (1994) Pot2, an inverted repeat transposon from the rice blast fungus Magnaporthe grisea. Mol Gen Genet 245:339–348CrossRefPubMedGoogle Scholar
  10. Kang S, Chumley FG, Valent B (1994) Isolation of the mating-type genes of the phytopathogenic fungus Magnaporthe grisea using genomic subtraction. Genetics 138:289–296PubMedPubMedCentralGoogle Scholar
  11. Kolmer JA, Ellingboe AH (1988) Genetic relationships between fertility and pathogenicity and virulence to rice in Magnaporthe grisea. Can J Bot 66:891–897CrossRefGoogle Scholar
  12. Kotasthane AS, Kumar J, Singh US, Zeigler RS (2004) Genetics of fertility and mating type in Magnaporthe grisea. In: Kawasaki S (ed) Rice blast: interaction with rice and control. Springer, Dordrecht, pp 261–270CrossRefGoogle Scholar
  13. Kumar J, Zeiglerb RS (1995) Mating behavior of Magnaporthe grisea from central himalayas of India. Phytopathology 85:1201Google Scholar
  14. Mahesh HB, Meghana S, Shailaja H, Prasannakumar MK, Mahadevu P, Channabyregowda MV, Malali G (2016) Acquisition of the grasshopper retro transposon by rice Magnaporthe isolates indicates a dynamic gene flow between rice and non-rice Magnaporthe population. J Pathol & Microbiol 1:1011–1022Google Scholar
  15. McDonald BA, McDermott JM, Goodwin SB, Allard RW (1989) The population biology of host-pathogen interactions. Annu Rev Phytopathol 27:77–94CrossRefGoogle Scholar
  16. Notteghem JL, Silue D (1992) Distribution of mating type alleles in Magnaporthe grisea populations pathogenic on rice. Phytopathology 82:421–424CrossRefGoogle Scholar
  17. Ou SH, Ayad MR (1968) Pathogenic races of Pyricularia oryzae originating from single lesions and monoconidial cultures. Phytopathology 58:179–182Google Scholar
  18. Rohlf FJ (1998) NTSYSpc Numerical Taxonomy and Multivariate Analysis System Version 2.0 User Guide. Applied Biostatistics Inc., Setauket, New York .pp 37Google Scholar
  19. Tredway LP, Stevenson KL, Burpee LL (2003) Mating type distribution and fertility status in Magnaporthe grisea populations from turf grasses in Georgia. Plant Dis 87:435–441CrossRefGoogle Scholar
  20. Viji G, Gnanamanickam SS, Levy M (2000) DNA polymorphisms of isolates of Magnaporthe grisea from India that are pathogenic to finger millet and rice. Mycol Res 104:161–167CrossRefGoogle Scholar
  21. White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ (eds) PCR protocols. A guide to methods and applications. Academic Press, San Diego, pp 315–322Google Scholar
  22. Yaegashi H, Nishihara N (1976) Production of the perfect stage in Pyricularia from cereals and grasses. Ann Phytopathol Soc Jpn 42:511–515CrossRefGoogle Scholar
  23. Zeigler RS (1998) Recombination in Magnaporthe grisea. Annu Rev Phytopathol 36:249–275CrossRefPubMedGoogle Scholar
  24. Zeigler RS, Tohme J, Nelson R, Levy M and Correa-Victoria FJ (1994) Lineage exclusion: A proposal for linking blast population analysis to resistance breeding, In: Zeigler RS, Leong SA and Teng PS (eds.), Rice blast disease, CAB International, Wallingford, Oxon, UK and International Rice Research Institute, Manila, pp.267–292Google Scholar

Copyright information

© Institute of Plant Genetics, Polish Academy of Sciences, Poznan 2018

Authors and Affiliations

  1. 1.Department of Molecular Biology, Yuvaraja’s CollegeUniversity of MysoreMysuruIndia
  2. 2.Department of Plant Pathology, GKVKUniversity of Agricultural ScienceBangaloreIndia

Personalised recommendations