Advertisement

Expressions of autophagy-associated ATG genes in response to fusarium wilt infection in banana

  • Pavitra Kotari
  • Ajitha Rekha
  • Kundapura V. RavishankarEmail author
Article
  • 420 Downloads

Abstract

Host and pathogens have to cope with different types of environmental stresses during their developmental processes. Autophagy regulates programmed cell death as a response to pathogen infection and is emerging as key a defense module in host-pathogen interactions. The current study focuses on the differential pattern of expression of autophagy (ATG) genes in two contrasting banana genotypes, upon infection with fungal pathogen Fusarium Oxysporum f.sp. cubense (Foc1). The expression analyses of twelve ATG genes responding to biotic stress were investigated in the contrasting genotypes “Calcutta-4” (tolerant) and “Kadali” (susceptible). All the 12 ATG genes were upregulated in both contrasting genotypes, upon disease progression. After Foc1 infection, it was observed that the susceptible genotype “Kadali” showed an enhanced expression at 3dpi, in comparison to the tolerant genotype. An increased and sustained expression of ATG genes in tolerant genotype “Calcutta-4” at 10dpi was also observed suggesting accelerated defense response, under Foc1 infection, indicating an important role of autophagy in disease tolerance to regulate programmed cell death which is a key component of plant immunity response. The present survey suggests that both increased and sustained higher expression of ATG genes during disease progression, imparts tolerance to Foc1 in banana.

Keywords

Defense response. Host-pathogen interaction Musa Necrotrophic pathogen Pathogen triggered immunity 

Plants, upon exposure to stress conditions, bring about degradation of cytoplasmic macromolecules inside the vacuole (Bassham 2007) and thus utilise the mechanism of recycling, when the nutrient supplies are limited by a process known as autophagy (Doelling et al. 2002).

Multiple roles have been identified and reported for autophagy-related proteins (ATGs) that participate in host defense responses (Klionsky et al. 2003; Zhou et al. 2014a). Various functions of macroautophagy in several plant species have been reported in response to stress conditions (Moriyasu and Ohsumi 1996; Doelling et al. 2002; Bassham 2007). Certain phenotypic analysis of ATG mutants indicates that autophagy plays a role in growth, development, and stress responses (Chetan et al. 2012). An overall schematic representation of autophagy pathway is shown in Fig. 1.
Fig. 1

Pathway of autophagy and role of different autophagy genes and their involvement during the process. In the figure, we can find the role of ATG9 during the formation of autophagosome formation and ATG5 and ATG8 involved during the core process of autophagy

Although the role of ATGs and autophagy is well-known in model plants such as Arabidopsis (Su et al. 2006), Rice (Chung et al. 2009), Tobacco (Xia et al. 2011) and Maize (Li et al. 2015), the possible role of signalling pathways triggering the induction of plant autophagy upon fungal infection in banana, remains unknown (Wei et al. 2017). It is also important to understand the role of autophagy genes (ATGs) under biotic stress, as these genes are shown to regulate some Pathogen Triggered Immunity (PTI) responses, such as Reactive Oxygen Species (ROS) accumulation, programmed Cell Death (PCD), defense related gene expression and callose deposition.

The roles of autophagy genes in plants have been reported based on comparative phenotypic analysis of wild type and ATG-knockout or overexpressing plants, such as 25 AtATGs in Arabidopsis (Hanaoka et al. 2002), 33 OsATGs in Oryza sativa (Xia et al. 2011), 24 SlATGs in Solanum lycopersicum (Wang et al. 2015). However, in banana recently, 32 MaATGs in response to fungal pathogen Fusarium oxysporum f. sp. cubense race 1 (Foc1) have been reported, of which, seven ATG genes (ATG1, ATG2, ATG5, ATG6, ATG7, ATG9 and ATG12) contained only one member, whereas, ATG8 had a maximum of 10 members (Wei et al. 2017).

Banana is severely affected by Foc (Ploetz et al. 2015). To analyse the role of autophagy genes in banana upon fungal infection, we chose to focus on banana ATG5, ATG8 and ATG9 as potential targets for the study, as their products are required for the core process of autophagy and also for the regulation of autophagosomes (Yoshimoto et al. 2009, Lai et al. 2011). Aiming to understand the pattern of expression of ATG genes upon infection with Foc1 in contrasting genotypes, the present study was performed. This would help in understanding their role in Foc1 tolerance in banana.

The fungus pathogen Foc1 (Foc1- VCG group 0125; deposited in the Queensland Department of Primary Industries South Johnstone Australia; Pegg et al. 1993) used in this study, was isolated from infected banana corm and were characterised using translation elongation factor primers, and subsequently sequenced (GenBank MH746761, Divakara et al. 2014). Two consequently contrasting diploid Musa genotypes “Calcutta-4” (C4-tolerant; AA; IC-395097) and “Kadali” (K-susceptible; AA; IC- 250622) were used (Ravishankar et al. 2011). For inoculations, wounds were made in the newly emerged roots of the plantlets with sterilised needles (2 months old plantlets in pots containing autoclaved sterilised cocopeat) and infected with 50 ml conidial suspension poured over the injured roots (Foc1; 1 × 104 spores ml-l). Three plantlets for each treatment were inoculated, while three uninfected plantlets served as controls. Root samples were harvested before inoculation (0) and at 3 and 10 days post inoculation (dpi). These samples were immediately frozen using liquid nitrogen and kept at −80 °C until further use (Swarupa et al. 2013).

In the present study, we selected 12 ATGs (ATG5a, ATG5b, ATG9a, ATG9b, ATG8ca, ATG8cb, ATG8fa, ATG8fb, ATG8ga, ATG8gab, ATG8ia, ATG8ib; (Wei et al. 2017) to explore their role and expression pattern during disease development in contrasting genotypes. We analysed their expression at two different time points of disease progression using qPCR.

Total RNA was extracted by the modified pine tree method (Chang et al. 1993). Extracted RNA was later subjected to RNase-free DNase treatment using TURBO DNA-free kit (Ambion, Cat#AM1907) followed by cDNA synthesis using RevertAid First-Strand cDNA Synthesis kit (Thermo Scientific; Cat no. K1622). Quantitative RT-PCR was performed in 20 μL reaction volume with DyNAmo Flash SYBR green qPCR kit (Thermo Scientific, Catalog No.F-416 L). PCR reactions were performed on a fast Real-Time PCR System Quant Studio 7 Flex (No. 278871032 Applied Biosystems). Primers used for qPCR analysis are listed in Table 1. To compare untreated and treated expression levels, the function ΔΔCT was determined and the induction ratio of treatment/control was calculated using the eq. 2 − ΔΔ CT.
Table 1

ATG specific primer sequences used for qPCR analysis

Gene

Forward (5′ to 3′)

Reverse (5′ to 3′)

ATG5a

CGGACTAAGGAGTAGCGAAATC

CACCACAAGTCGAGTAGCATAG

ATG5b

GTCGGTCGCCTTCCTATTATT

TGAGAGACAGTGAGAGAGAGAG

ATG8ca

CGCCACAGAGAAACGTAAGA

CACCTAACGCAACGAGGATAG

ATG8cb

CACATTAGGACGAAGGGTAGAG

GAACCCTCAACCTCAGAATAG

ATG8fa

CGGCCTTTCCTTGTTTGATTC

TGCTCTGACTCCTCGACATA

ATG8fb

GTGTGTTCTTGATGCGTGATG

GGAAACCTGCCAGGGTATTTA

ATG8ga

GCCTTAGTGGTTCTGTCACTT

TGGCCTTTCATCTCCTTCATC

ATG8gb

GAAAGATGAAGATGGGTTCCTTTAC

GAACTGTGTTGGTGGCATAATC

ATG8ia

GACGAATCTCGCCCTTCTTATTA

TCCAACCGCGGATGAATAAA

ATG8ib

TGGCAAGAAGTCGCGTATAAT

CGGAAGATCACTCCTTGAGAAC

ATG9a

AGGACATCATGGCAGTTTCTT

GCTACAGCAGCTCGACTTATAG

ATG9b

TGTTGATTGGCCTGCTCTC

AAGGTACAAGTGGGTGCTTATT

Rbp12

AGGGTTCATAGCCACACCAC

CCGAACTGAGAAGCCCCTAC

The gene expression data for ATG genes was represented as mean values with standard error (mean ± SE) and the significant differences between treatments were compared statistically by one way ANOVA using MS-Excel software as described by Yamada et al. (2007).

All of the ATG genes showed differential expression profiles in response to the Foc1 treatment at some time intervals of infection. It was observed that the pattern of expression of most of the ATG homologues was altered during the early stages of infection (Fig. 2). In particular, we observed that expression patterns of ATG genes had enhanced in both tolerant and susceptible genotypes at 3dpi in comparison to the control (untreated) samples (Fig. 2). Further, we also observed a sustained and increased expression in tolerant genotype “Calcutta-4”, but in the case of susceptible genotype “Kadali” there was a decrease with disease progression (10dpi; Fig. 2). We also observed that the multiple members of the same subfamilies, for example ATG8ga (Fig. 2g) and ATG8gb (Fig. 2h), had similar patterns of expression, confirming shared similar induction kinetics with an increase in expression levels during disease progression (Fig. 2).
Fig. 2

Expression profile of 12 ATG genes ATG5a(2a), ATG5b(2b), ATG8ca(2c), ATG8cb(2d), ATG8fa(2e), ATG8fb(2f), ATG8ga(2 g), ATG8gb(2 h), ATG9b(2i), ATG8ia(2j), ATG8ib(2 k) and ATG9a(2 l) in response to Fusarium oxysporum f.sp.cubense (Foc1) treatment. Relative expression levels of each ATG gene in banana upon Foc1 were normalised to Rbp12 endogenous reference gene. The expression level of each ATG gene was calculated and compared with uninfected plantlets. *C4- “Calcutta4” (tolerant genotype). *K- “Kadali” (susceptible genotype)

Necrotrophic pathogens cause death of host cells at the early stage of infection and absorb the released nutrients for their survival and multiplication (Glazebrook 2005; van Kan 2006). They make use of virulent factors (toxins, ROS and hydrolytic enzymes) to cause death of the host cells (Glazebrook 2005; van Kan 2006). In turn, plants have evolved inbuilt strategies to respond to particular stress conditions, to enable growth and survival (Ahuja et al. 2010). A study reported by Xiong et al. (2007), describes the role of ATG proteins in plant responses to various environmental stresses. The finding presented here supports the previous studies in confirming the induction of ATG genes, when subjected to fusarium wilt infection in banana plants.

The majority of plant autophagy associated ATG genes are, for instance, expressed preferentially upon challenge with the Foc1 (Fig. 2). In this study, it has been observed that the ATG genes studied here are induced in both tolerant and susceptible genotype at 3dpi (Fig. 2). However, at 10 dpi, tolerant genotype sustained higher expression of ATG genes (Fig. 2). In the case of “Kadali”, there is a drastic reduction in ATG gene expression from 3 dpi to 10dpi (Fig. 2). This suggests that sustained higher expression plays an important role in imparting tolerance to Foc1. The results of our study supports the well-substantiated pathway of plant-defense mechanism that involves the recognition of pathogen associated molecular patterns (PAMPs) and thus brings about plant triggered immunity (PTI) to prevent further infection, spread of disease, hypersensitive response (HR) and pathogen-induced hypersensitive cell death (PCD) (Apel and Hirt 2004; Jones and Dangl 2006; Kwon et al. 2013).

In recent years, there is much evidence that shows the involvement of autophagy in protection of plants against pathogenic infections by three ways, namely, PCD, Salicylic acid (SA) and Jasmonic acid (JA) regulated defense pathways (Zhou et al. 2014b). In our study, the patterns of expression of ATG genes (ATG5, ATG8 and ATG9) along with their sub-families were up-regulated throughout the disease progression (3dpi and 10dpi) in tolerant genotype, indicating the positive role of ATGs in response to Foc1 infection.

A total of 12 putative ATG genes identified in banana were selected to analyse the pattern of expression in two contrasting genotypes, upon Foc1 infection at two time points of disease progression (3 and 10 dpi). The ATGs were induced in both the genotypes at 3 dpi. However, sustained and higher expression was observed in the tolerant genotype. This might be one of the mechanisms involved in imparting tolerance to “Calcutta-4” genotypes. The involvement of autophagy in plant defense against Foc1 is consistent with the induction of autophagy genes in treated samples imparting tolerance to Foc1 infection. This is the first study in banana showing the pattern of autophagy gene expression among contrasting genotypes upon Foc1 infection.

Notes

Acknowledgements

Authors thank the Indian Council of Agricultural Research, New Delhi for financial assistance through the ICAR Network Project on Transgenics in Crops: Functional Genomics-Fusarium wilt and drought tolerance in Banana.

References

  1. Ahuja I, de Vos RC, Bones AM, Hall RD (2010) Plant molecular stress responses face climate change. Trends Plant Sci 15:664–674CrossRefGoogle Scholar
  2. Apel K, Hirt H (2004) Reactive oxygen species: metabolism, oxidative stress, and signal transduction. Annu Rev Plant Biol 55:373–399CrossRefGoogle Scholar
  3. Bassham D (2007) Plant autophagy--more than a starvation response. Curr Opin Plant Biol 10:587–593CrossRefGoogle Scholar
  4. Chang S, Puryear J, Cairney J (1993) A simple and efficient method for isolating RNA from pine trees. Plant Mol Biol Report 11(2):113–116CrossRefGoogle Scholar
  5. Chetan JS, Jyothi G, Manu TG, Murali R (2012) Autophagy is the emerging role in plant defense against pathogen attack. Glob J Biol Agric Health Sci 1:33–39Google Scholar
  6. Chung T, Suttangkakul A, Vierstra RD (2009) The ATG autophagic conjugation system in maize: ATG transcripts and abundance of the ATG8-lipid adduct are regulated by development and nutrient availability. Plant Physiol 149:220–234CrossRefGoogle Scholar
  7. Divakara ST, Santosh P, Aiyaz M, Ramana MV, Hariprasad P, Nayaka SC, Niranjana SR (2014) Molecular identification and characterization of fusarium spp. associated with sorghum seeds. J Sci Food Agric 94(6):1132–1139CrossRefGoogle Scholar
  8. Doelling JH, Walker JM, Friedman EM, Thompson AR, Vierstra RD (2002) The APG8/12-activating enzyme APG7 is required for proper nutrient recycling and senescence in Arabidopsis thaliana. J Biol Chem 277:33105–33114CrossRefGoogle Scholar
  9. Glazebrook J (2005) Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens. Annu Rev Phytopathol 43:205–227CrossRefGoogle Scholar
  10. Hanaoka H, Noda T, Shirano Y, Kato T, Hayashi H, Shibata D, Tabata S, Ohsumi Y (2002) Leaf senescence and starvation-induced chlorosis are accelerated by the disruption of an Arabidopsis autophagy gene. Plant Physiol 129:1181–1193CrossRefGoogle Scholar
  11. Jones JD, Dangl JL (2006) The plant immune system. Nature 444:323–329CrossRefGoogle Scholar
  12. Klionsky DJ, Cregg JM, Dunn WA, Emr SD Jr, Sakai Y, Sandoval IV, Sibirny A, Subramani S, Thumm M, Veenhuis M et al (2003) A unified nomenclature for yeast autophagy related genes. Dev Cell 5:539–545CrossRefGoogle Scholar
  13. Kwon SI, Cho HJ, Kim SR, Park OK (2013) The Rab GTPase RabG3b positively regulates autophagy and immunity-associated hypersensitive cell death in Arabidopsis. Plant Physiol 161:1722–1736CrossRefGoogle Scholar
  14. Lai Z, Wang F, Zheng Z, Fan B, Chen Z (2011) A critical role of autophagy in plant resistance to necrotrophic fungal pathogens. Plant J 66:953–968CrossRefGoogle Scholar
  15. Li FQ, Chung T, Pennington JG, Federico ML, Kaeppler HF, Kaeppler SM, Otegui MS, Vierstra RD (2015) Autophagic recycling plays a central role in maize nitrogen remobilization. Plant Cell 27:1389–1408CrossRefGoogle Scholar
  16. Moriyasu Y, Ohsumi Y (1996) Autophagy in tobacco suspension-cultured cells in response to sucrose starvation. Plant Physiol 111:1233–1241CrossRefGoogle Scholar
  17. Pegg KG, Moore NY, Sorensen S (1993) Fusarium wilt in the asian pacific region. In: Valmayor RV, Hwang SC, Ploetz RC, Lee SW, Roa NV (eds) Proc. Int. Symp. Recent developments in banana cultivation techn. International Network of Banana and Plantain/ASNET, Filipinas, pp 225–269Google Scholar
  18. Ploetz RC, Kema GH, Ma LJ (2015) Impact of diseases on export and smallholder production of banana. Annu Rev Phytopathol 53:269–288CrossRefGoogle Scholar
  19. Ravishankar KV, Rekha A, Swarupa V, Savitha G (2011) Gene expression analysis in roots of Musa acuminata ssp. burmannicoides “Calcutta-4”, a banana genotype tolerant to Fusarium wilt. Acta Hortic 897:363–370CrossRefGoogle Scholar
  20. Su W, Ma HJ, Liu C, Wu JX, Yang JS (2006) Identification and characterization of two rice autophagy associated genes, OsAtg8 and OsAtg4. Mol Biol Rep 33:273–278CrossRefGoogle Scholar
  21. Swarupa V, Ravishankar KV, Rekha A (2013) Characterization of tolerance to Fusarium oxysporum f. sp. cubense infection in banana using suppression subtractive hybridization and gene expression analysis. Physiol Mol Plant Pathol 83:1–7CrossRefGoogle Scholar
  22. Van Kan JA (2006) Licensed to kill: the lifestyle of a necrotrophic plant pathogen. Trends Plant Sci 11:247–253CrossRefGoogle Scholar
  23. Wang Y, Cai S, Yin L et al (2015) Tomato HsfA1a plays a critical role in plant drought tolerance by activating ATG genes and inducing autophagy. Autophagy 11:2033–2047CrossRefGoogle Scholar
  24. Wei Y, Liu W, Hu W, Liu G, Wu C, Liu W, Zeng H, He C, Shi H (2017) Genome-wide analysis of autophagy-related genes in banana highlights MaATG8s in cell death and autophagy in immune response to Fusarium wilt. Plant Cell Rep 36:1237–1250CrossRefGoogle Scholar
  25. Xia K, Liu T, Ouyang J, Wang R, Fan T, Zhang M (2011) Genome wide identification, classification, and expression analysis of autophagy-associated gene homologues in rice (Oryza sativa L.). DNA Res 18:363–377CrossRefGoogle Scholar
  26. Xiong Y, Contento AL, Nguyen PQ, Bassham DC (2007) Degradation of oxidized proteins by autophagy during oxidative stress in Arabidopsis. Plant Physiol 143:291–299CrossRefGoogle Scholar
  27. Yamada Y, Suzuki NN, Hanada T, Ichimura Y, Kumeta H, Fujioka Y, Ohsumi Y, Inagaki F (2007) The crystal structure of Atg3, an autophagy-related ubiquitin carrier protein (E2) enzyme that mediates Atg8 lipidation. J Biol Chem 282(11):8036–8043CrossRefGoogle Scholar
  28. Yoshimoto K, Jikumaru Y, Kamiya Y, Kusano M, Consonni C, Panstruga R, Ohsumi Y, Shirasu K (2009) Autophagy negatively regulates cell death by controlling NPR1-dependent salicylic acid signaling during senescence and the innate immune response in Arabidopsis. Plant Cell 21:2914–2927CrossRefGoogle Scholar
  29. Zhou J, Wang J, Yu JQ, Chen Z (2014a) Role and regulation of autophagy in heat stress responses of tomato plants. Front Plant Sci 5:174PubMedPubMedCentralGoogle Scholar
  30. Zhou J, Yu JQ, Chen Z (2014b) The perplexing role of autophagy in plant innate immune responses. Mol Plant Pathol 15:637–645CrossRefGoogle Scholar

Copyright information

© Australasian Plant Pathology Society Inc. 2018

Authors and Affiliations

  • Pavitra Kotari
    • 1
  • Ajitha Rekha
    • 2
  • Kundapura V. Ravishankar
    • 1
    Email author
  1. 1.Division of BiotechnologyICAR-Indian Institute of Horticultural ResearchBengaluruIndia
  2. 2.Division of Fruit CropsICAR-Indian Institute of Horticultural ResearchBengaluruIndia

Personalised recommendations