Identification of two plant viruses using partial purification and mass spectrometry

  • Paul L. Guy
  • Richard Easingwood
  • Diana L. Carne
  • Torsten Kleffmann
Article

Abstract

Serological and PCR techniques failed to detect Tomato spotted wilt virus (TSWV) infecting stunted tomato plants exhibiting leaf curling, purpling and crumpling. In contrast, Mass Spectrometry rapidly identified peptides generated from a ~28kD protein cut from PAGE gels as TSWV N-protein within 5 days. The results indicate that the incidence of TSWV may be underestimated in the field. Cocksfoot mild mosaic virus (CMMV) was identified infecting Bromus diandrus using serological techniques. Peptides from a ~25kD protein failed to identify with any protein on GenBank until a CMMV sequence was published. The use of Mass Spectrometry as an adjunct for virus detection and identification is briefly discussed.

Keywords

Virus identification Mass spectrometry Cocksfoot mild mosaic virus Tomato spotted Wilt virus 

Virus detection and identification have evolved steadily over the last 100 years. Early techniques, including mechanical and insect transmission tests, do not rely on prior knowledge of the virus concerned (Kado and Agrawal 1972; Wilson 2014). Electron microscopy does not rely on prior knowledge of the virus and generally provides information on the size, shape and some surface features of virus particles (Hull 2002; Wilson 2014). In contrast serology and PCR based techniques rely on prior knowledge of which viruses are likely to be present in a sample and may require many rounds of diagnosis before a successful identification (Cooper et al. 2003; Zheng et al. 2011). More recently Next Generation Sequencing has revolutionised the identification of viruses and other organisms (Wilson 2014). Another technique which does not rely on prior knowledge is Mass Spectrometry (MS). Increasing numbers of viruses have been identified and interactions with host proteomes have been characterised (Zheng et al. 2011). MS has been used to study a few plant viruses (Cooper et al. 2003; Seifers et al. 2005; Luo et al. 2010) but this technique is under-utilised (Blouin et al. 2010). In this paper we examine the utility of using MS to identify two plant viruses.

Tomato plants (cv Sub Arctic Plenty) showing leaf curling, crumpling, purpling and stunting (but not yellowing) and a wild grass (Bromus diandrus) showing mosaic symptoms were collected from a farm at Waitati, East Otago NZ. The lack of virus particles in leaf dip preparations suggested that a low titre virus was present in the tomato samples. The presence of isometric particles without distinct subunit structure suggested the presence of a bromo-, sobemo- or tombus-virus in the grass samples.

Tomato samples were tested for 15 viruses (Table 1) by ELISA, using kits (Agdia, Adgen, Loewe) in accordance with the manufacturers’ instructions. The tomato samples tested negative for all these viruses. Two isolates of Tomato spotted wilt virus (TSWV) from dahlia were used as positive controls. The Alfonso (Dahlia cultivar) isolate caused chlorotic ringspot and oakleaf patterns in infected leaves. The Pam Howden (Dahlia cultivar) isolate caused a diffuse chlorotic mottle. Both dahlia isolates tested positive in TSWV ELISA tests.
Table 1

Tomato sample ELISA

Antisera

Source (Catalog no.)

Viruses detected according to the manufacturer

Results: all negative for the tomato sample

 Alfalfa mosaic virus

Agdia (SRA 87601)

AMV

 

 Arabis mosaic virus

Agdia (SRA 23201)

ArMV

 

 Begomoviruses

Adgen (1073)

Tomato and others

 

 Cucumber mosaic virus

Agdia (SRA 44501)

CMV

 

 Potyviruses

Agdia (SRA 27200)

many

 

 Strawberry latent ringspot virus

Agdia (SRA 14000)

SLRV

 

 Tobacco ringspot virus

Agdia (SRA 64000)

TRSV

 

 Tomato bushy stunt virus

Agdia (SRA 454000)

TBSV

 

 Tomato ringspot virus

Agdia (SRA 22000)

ToRSV

 

Tospoviruses

   

 Tomato spotted wilt &Impatiens necrotic spot viruses

Agdia (SRA 30400)

TSWV & INSV

 

 Tospo Broad Range

Loewe (07507)

TSWV, TCSV, GRSV, INSV

 

 Iris yellow spot virus

Loewe (07508)

IYSV

 
The brome grass samples were tested for 8 viruses by ELISA and 20 viruses using Ouchterlony double diffusion tests done in sodium acetate (50 mM sodium acetate, 0.15 M sodium chloride, 0.2 % sodium azide, 0.75 % agarose; pH6) gels using antisera diluted 1/10 to viruses known to infect the Poaceae and to a selection of sobemoviruses (Table 2). The grass samples tested positive for Cocksfoot mild mosaic virus (CMMV), CMMV-Phleum mottle and Panicum mosaic virus (PMV).
Table 2

Brome grass serology

Antisera

Source (Catalog no.)

Viruses detecteda

Resultb

Agropyron mosaic virus

R. Plumb, UK

AgMV

 

Brome mosaic virus

Agdia (SRA 29300)

BMV

 

BMV-Julius

R. Sward, Australia

BMV

 

BMV-Rhdolf

R. Sward, Australia

BMV

 

Brome streak mosaic virus

Loewe ((07123)

BStMV

 

Cocksfoot streak virus

L Torrance, Scotland

CSV

 

Cocksfoot mild mosaic virus

W. Huth, Germany

CMMV

++

CMMV-Phleum mottle

W. Huth, Germany

CMMV

++

Cocksfoot mottle virus

W. Huth, Germany

CoMV

 

Foxtail mosaic virus

B. Falk, USA

FMV

 

Ginger chlorotic fleck virus

J. Thomas, Australia

GCFV

 

Lucerne transient streak virus

R. Forster, NZ

LTSV, CoMV

 

Maize chlorotic mottle virus

B. Falk, USA

MCMV

 

Maize stripe virus

Agdia (SRA 17300)

MSpV

 

Maize white line virus

B. Falk, USA

MWLV

 

Panicum mosaic virus

B. Falk, USA

PMV, CMMV

+

Potyviruses

Agdia (SRA 27200)

many

 

Rice yellow mottle virus

American Type Culture Collection (ATTC 516)

RYMV

 

Rice necrosis mosaic virus

R. Plumb, UK

RNMV

 

Ryegrass mosaic virus

D. Webster, NZ

RGMV

 

Solanum nodiflorum mottle virus

R. Greber, Australia

SNMV

 

Soilborne wheat mosaic virus

Agdia (SRA 42001)

SBWMV

 

Southern bean mosaic virus

American Type Culture Collection (ATTC 298, 300)

SBMV

 

Sugarcane bacciliform virus

Agdia (SRA 72200)

SCBV

 

Subclover mottle virus

R. Jones, Australia

SCMV

 

Velvet tobacco mottle virus

J. Randles, Australia

VTMoV

 

Wheat dwarf virus

Loewe (07082)

WDV

 

Wheat streak mosaic virus

Agdia (SRA 47001)

WSMV

 

aaccording to the source, bblank cells represent no reaction to brome grass extracts: ++ distinct precipitin line in double diffusion tests, + less distinct line in double diffusion tests

RNA was purified from tomato and dahlia leaf tissue. Samples (ca. 3–20 mg) of leaves were homogenized with 200 μl STE buffer (0.1 M NaCl, 10 mM Tris, pH 8.0, 1 mM ETDA, pH 8.0) with 500 μl of Trizol (Sigma) in a Beadbeater™. After 5 min incubation at room temperature, 100 μL of chloroform was added to the homogenates and, after vigorous shaking, the homogenates were centrifuged at 14,000 g for 10 min. A half volume (ca. 250 μL) of isopropanol was added to the aqueous phase to precipitate RNA from the supernatant. Samples were incubated at room temperature for 10 min. After centrifuging at 14,000 g for 8 min the supernatants were discarded and the pellets were washed twice in 75 % ethanol. Air dried pellets were resuspended in DEPC-treated water. Each sample was processed separately; sterilized barrier pipette tips, freshly autoclaved solutions and DEPC treated water (negative controls) were used for each procedure. Total RNA (1-5uL) was used to produce cDNA and amplified via PCR using the Superscript III One-Step RT-PCR System (Invitrogen) (50 °C for 30 min, 94 °C for 2 min then 35 cycles: 94 °C 30 s, 54 °C 35 s, 72 °C 1 min; 72 °C 2 min). A two-step RT-PCR was also used. Reverse transcription was done using AMV and RNAsin (Promega) and reverse primer (Table 3) for 55 min in a thermal cycler at 42 °C. Following the RT reaction PCR was done using Platinum Taq (94 °C for 1 min then 30 cycles: 94 °C 1 min, 55 °C 1 min, 72 °C 1 min; 72 °C 10 min). The PCR was then repeated using the same cDNA and primers (Table 3) at a lower annealing temperature (94 °C for 5 min then 35 cycles: 94 °C 30 s, 48 °C 40 s, 72 °C 40 s; 72 °C 5 min). Freeze-dried tomato leaf material was also sent to Agdia Inc USA for RT-PCR analyses.
Table 3

Primers used for tomato sample RT-PCR

Target virus

Primers (Reverse primer)

Expected size

Reference

Tomato spotted wilt virus

TCTGGTAGCATTCAACTTCAA

628 bp

Roberts et al. 2000

 

(GTTTCACTGTAATGTTCCATAG)

 

TGTAITGITCCATIGCA

871 bp

Mumford et al. 1996

 

(AGAGCAATIGTGTCA)

 

GTGTCATACTTCTTTGGGTC

709 bp

Kuwabara et al. 2010

 

(GGGAGAGCAATYGWGKYR)

None of the tomato samples tested positive for any of the viruses in house or at the Agdia testing service. The dahlia isolates were used as positive controls in house and an unspecified isolate was used as a positive control at the Agdia testing service.

Leaf material ground in liquid nitrogen was combined with 0.1 M potassium phosphate containing 1 % 2-mercaptoethanol and 0.75 % sodium sulfite (w/v) (tomato) or 0.5 M acetate buffer (Brome grass) and emulsified with 1/10 volume of chloroform. The aqueous phase was made to 0.2 M sodium chloride and polyethylene glycol 6000 was added (6 % w/v). The precipitate was collected by low speed centrifugation (5,000 g) after stirring for 3 h at 4 °C. Pellets were resuspended in buffer and after low speed centrifugation (5,000 g) were re-pelleted in a Sorvall Ultracentrifuge (100,000 g) for 2 h. The final high speed pellets (and other fractions) were resuspended in distilled water and Laemli loading buffer and analysed using BioRad minigel polyacrylamide gel electrophoresis (PAGE) on 10–20 % polyacrylamide gradient gels. Bands were cut from Coomassie R250 stained/destained gels for analysis by mass spectrometry (MS) at the University of Otago, Centre for Protein Research.

A prominent ~28kD band (tomato) and a ~25kD band (brome grass: only band on gel) were cut from gels for analysis by mass spectrometry (MS). Samples of high speed pellets resuspended in distilled water were mixed with phosphotungstate and examined in a Philips transmission electron microscope. The tomato samples contained damaged membrane bound particles ~75 nm in diameter associated with nucleoprotein resembling tospovirus particle preparations (Fig. 1) and the grass samples contained numerous ~30 nm particles (Fig. 2) mentioned above.
Fig. 1

TEM image of purified tomato extract: arrows indicate Tomato spotted wilt virus particles

Fig. 2

TEM image of purified brome grass extract: arrows indicate Cocksfoot mild mosaic virus particles

The proteins of interest were digested in-gel using protease (Table 4) and the resulting peptides were subjected to MALDI tandem Time-of-Flight (TOF/TOF) MS. Fragment ion spectra were searched against the NCBI nr database using the Mascot search engine (www.matrixscience.com). For the grass sample, which was not identified by Mascot, a de novo sequencing mass spectrometry approach (Chen et al. 2004) was applied. Following tandem mass spectrometry peptide ions were fragmented sequentially using laser desorption and each individual amino acid was identified by its mass to charge ratio. These data were interpreted manually and assembled into peptide sequences (Table 4). The assembled peptides were searched against the NCBI database.
Table 4

Summary of peptide sequences detected by mass spectrometry

Virus targeted

Digest

Peptides identified

Published seq. length

Coverage

TSWV

gi 535099

(and 17 other TSWV N-protein sequences)

Trypsin

ESIVALLTQGK

DLEFEEDQNLVAFNFK

TFCLENLDQIKK

MSVISCLTFLK

IGATDMTFR

LVEETGNSENLNTIK

IASHPLIQAY GLPLDDAK

AFEMNEDQVKK

GSIAMEHYSETLNKFYEMFGVK

258

48 %

CMMV

NC 011108

Papain + Trypsin

Trypsin

RPLAYgQaVGP

TQPEIILR

LHSQHeWR

VVLKFFPNYR

LEDLMDtSsLTfSPYEkHT

245

20 %

(lower case letter codes were mismatches with the published amino acid sequence)

Partial purification followed by PAGE and MS rapidly identified a ~28kD band as the Mr = 28.8kD N-protein of TSWV. The nine identified peptides (Table 1) covered 48 % of the N-protein target sequence. Many contaminating peptides from photosynthetic proteins, mostly Rubisco, were also identified (data not shown). The successful detection and identification of TSWV and other tospoviruses is often time consuming and involves multiple techniques (Mumford et al. 1996; Dietzgen et al. 2005). This current study shows that MS is a useful tool for detecting and identifying TSWV.

Initial MS data on a ~25kD band from the grass sample PAGE produced no matches with the NCBI nr databases and sequence tags derived from de novo sequencing. Following the publication of the CMMV sequence (Ziegler et al. 2009) the ~25kD band was identified as the 26.5kD coat protein of CMMV. The five identified peptides (Table 1) covered 20 % of the target sequence. Seven of the 56 amino acids in the 5 peptides were mismatched with the target sequence indicating variation between the Scottish and NZ isolates of CMMV.

Considerable time and effort is required to identify plant viruses using serological and PCR techniques (Wilson 2014). Each candidate virus has to be tested individually by buying in antibodies and primers and ordering more antibodies and primers when other possible diagnoses become apparent. Extensive testing of the tomato samples failed to detect TSWV. It is uncertain which of the TSWV structural proteins react with the antibodies in the Agdia and Loewe kits. The RT-PCRs were designed to amplify segments on the N-protein gene but the in-house assays and the Agdia testing service failed to detect the tomato isolate of TSWV but succeeded in detecting two Dahlia isolates in-house and an unknown isolate at Agdia Inc. PCR assays vary in their robustness (Wilson 2014) and unexpected sequence variation is a major limitation for PCR based techniques (Zheng et al. 2011). For example, Osman et al. (2007) found using multiple isolates of six Grapevine leafroll associated viruses that individual primer pairs detected 54–89 % of their collected isolates. Osman et al. (2007) used nine pairs of primers in their RT-PCR study. The relatively simple partial purification, PAGE electrophoresis followed by MS identified TSWV within 5 days. A similar effort was mounted to test the grass samples serologically. CMMV was more readily purified than TSWV however, initially, the identified peptides did not match any sequence on GenBank. After the publication of a CMMV sequence, the peptides were identified as part of the CMMV coat protein. The speed and utility of using MS to identify plant viruses is limited by the number of virus species’ sequences lodged with databases. As modern shotgun sequencing techniques become more accessable and cheaper these databases become more comprehensive and MS will become an increasingly useful adjunct in virus identification. Mass Spectrometry analysis has the advantage that it analyses proteins, rather than nucleic acids, and therefore does not rely on the analysis of both DNA and RNA to be complete.

The tomato plants did not display the bronzing pattern on leaves typically associated with TSWV infection. Chamberlain (1954) noted that occasionally TSWV infected tomatoes show the symptoms outlined for the Waitati samples. The fact that the tomato isolate remained undetected by ELISA and RT-PCR indicates that the incidence of this virus may be under estimated in the field.

Notes

Acknowledgments

Thanks to the University of Otago and the Brenda Shore Trust for financial support and to an anonymous referee for constructive criticism.

Compliance with ethical standards

The authors have no conflict of interest to declare.

References

  1. Blouin AG, Greenwood DR, Chavan RR, Pearson MN, Clover GRG, MacDiarmid RM, Cohen D (2010) A generic method to identify plant viruses by high-resolution tandem mass spectrometry of their coat proteins. J Virol Methods 163:49–56CrossRefPubMedGoogle Scholar
  2. Chamberlain EE (1954) Plant virus diseases in New Zealand. NZ DSIR Bull 108:88Google Scholar
  3. Chen P, Nie S, Mi W, Wang XC, Liang SP (2004) De novo sequencing of tryptic peptides sulfonated by 4-sulfophenyl isothiocyanate for unambiguous protein identification using post-source decay matrix-assisted laser desorption/ionization mass spectrometry. Rapid Commun Mass Spectrom 18:191–198CrossRefPubMedGoogle Scholar
  4. Cooper B, Eckert D, Andon NL, Yates JR, Haynes PA (2003) Investigative proteomics: identification of an unknown plant virus from infected plants using mass spectrometry. J Am Soc Mass Spectrom 14:736–741CrossRefPubMedGoogle Scholar
  5. Dietzgen RG, Twin J, Talty J, Selladurai S, Carroll ML, Coutts BA, Berryman DI, Jones RAC (2005) Genetic variability of tomato spotted wilt virus in Australia and validation of real time RT-PCR for its detection in single and bulked leaf samples. Ann Appl Biol 146:517–530CrossRefGoogle Scholar
  6. Hull R (2002) Matthews’ plant virology, 4th edn. Academic, London, 1001ppGoogle Scholar
  7. Kado CI, Agrawal HO (1972) Principles and techniques in plant virology. Van Nostrand Reinhold, New York, 688 ppGoogle Scholar
  8. Kuwabara K, Yokoi N, Ohki T, Tsuda S (2010) Improved multiplex reverse transcription-polymerase chain reaction to detect and identify five tospovirus species simultaneously. J Gen Plant Pathol 76:273–277CrossRefGoogle Scholar
  9. Luo H, Wylie SJ, Jones MGK (2010) Identification of plant viruses using one-dimensional gel electrophoresis and peptide mass fingerprints. J Virol Methods 165:297–301CrossRefPubMedGoogle Scholar
  10. Mumford RA, Barker I, Wood KR (1996) An improved method for the detection of Tospoviruses using the polymerase chain reaction. J Virol Methods 57:109–115CrossRefPubMedGoogle Scholar
  11. Osman F, Leutenegger C, Golino D, Rowhani A (2007) Real-time RT-PCR assays for the detection of Grapevine leafroll associated viruses 1–5 and 9. J Virol Methods 141:22–29CrossRefPubMedGoogle Scholar
  12. Roberts CA, Dietzgen RG, Heelan LA, Maclean DJ (2000) Real-time RT-PCR fluorescent detection of tomato spotted wilt virus. J Virol Methods 88:1–8CrossRefPubMedGoogle Scholar
  13. Seifers DL, Harvey TL, Martin TJ, Haber S, She YM, Ens W, Standing KG, Salomon R, Gera A (2005) Association of a virus with wheat displaying yellow head disease symptoms in the great plains. Plant Dis 89:888–895. doi:10.1094/PD-89-0888 CrossRefGoogle Scholar
  14. Wilson CR (2014) Diagnosis and detection methods. Applied Plant Virology. CABI International, Wallingford UK pp 103–128. ISBN 9781845939915Google Scholar
  15. Zheng J, Sugrue RJ, Tang K (2011) Mass spectrometry based proteomic studies on viruses and hosts- a review. Anal Chim Acta 702:149–159CrossRefPubMedGoogle Scholar
  16. Ziegler A, Cowan G, Torrance L (2009) Comparative sequence analysis and serological and infectivity studies indicate that cocksfoot mild mosaic virus is a member of the genus Panicovirus. Arch Virol 154:1545–1549CrossRefPubMedGoogle Scholar

Copyright information

© Australasian Plant Pathology Society Inc. 2015

Authors and Affiliations

  • Paul L. Guy
    • 1
  • Richard Easingwood
    • 2
  • Diana L. Carne
    • 3
  • Torsten Kleffmann
    • 3
  1. 1.Botany DepartmentUniversity of OtagoDunedinNew Zealand
  2. 2.Otago Centre for Electron MicroscopyUniversity of OtagoDunedinNew Zealand
  3. 3.Centre for Protein Research, Biochemistry DepartmentUniversity of OtagoDunedinNew Zealand

Personalised recommendations