Advertisement

Neurotherapeutics

, Volume 15, Issue 2, pp 459–469 | Cite as

Cannabinoid CB1 and CB2 Receptors, and Monoacylglycerol Lipase Gene Expression Alterations in the Basal Ganglia of Patients with Parkinson’s Disease

  • Francisco Navarrete
  • M. Salud García-Gutiérrez
  • Auxiliadora Aracil-Fernández
  • José L. Lanciego
  • Jorge ManzanaresEmail author
Original Article

Abstract

Previous studies suggest that the endocannabinoid system plays an important role in the neuropathological basis of Parkinson’s disease (PD). This study was designed to detect potential alterations in the cannabinoid receptors CB1 (CB1r) and CB2 (A isoform, CB2Ar), and in monoacylglycerol lipase (MAGL) gene expression in the substantia nigra (SN) and putamen (PUT) of patients with PD. Immunohistochemical studies were performed to identify precise CB2r cellular localization in the SN of control and PD patients. To ensure the validity and reliability of gene expression data, the RNA integrity number (RIN) was calculated. CB1r, CB2Ar, and MAGL gene expressions were evaluated by real-time polymerase chain reaction (real-time PCR) using Taqman assays. Immunohistochemical experiments with in situ proximity ligation assay (PLA) were used to detect the precise cellular localization of CB2r in neurons, astrocytes, and/or microglia. All RIN values from control and PD postmortem brain samples were > 6. CB1r gene expression was unchanged in the SN but significantly higher in the PUT of patients with PD. CB2Ar gene expression was significantly increased (4-fold) in the SN but decreased in the PUT, whereas MAGL gene expression was decreased in the SN and increased in the PUT. Immunohistochemical analyses revealed that CB2r co-localize with astrocytes but not with neurons or microglial cells in the SN. The results of the present study suggest that CB1r, CB2r, and MAGL are closely related to the neuropathological processes of PD. Therefore, the pharmacological modulation of these targets could represent a new potential therapeutic tool for the management of PD.

Keywords

Parkinson’s disease CB1 and CB2 receptor MAGL Gene expression Immunohistochemistry Basal ganglia 

Introduction

The search for new biomarkers to further understand the neurobiological basis of Parkinson’s disease (PD) and to achieve an early diagnosis and better treatment are important challenges [1, 2]. In this respect, there is an increasing amount of data relating to the endocannabinoid system with regard to the pathophysiology of PD [3, 4]. Indeed, changes in cannabinoid CB1 receptor (CB1r) gene expression were found in PD animal models [5] and human postmortem brain tissue [6]. Furthermore, regional alterations of CB1in vivo availability have been described in patients with PD [7]. These results strongly support the idea that this receptor may play an important role in the treatment of PD [8, 9, 10, 11, 12].

Since the identification of the cannabinoid CB2 receptor (CB2r) in the brain under non-pathological conditions [13], several studies suggest its participation in the regulation of different neurobiological processes. Interestingly, some authors reported the anti-inflammatory and neuroprotective potential of CB2r [14, 15], suggesting a role of this receptor in neurodegenerative diseases such as PD. In addition, CB2r gene expression was decreased in the cerebellum and hippocampus of patients with PD compared with healthy controls [16]. Furthermore, the overexpression of CB2r in mice markedly reduced the dopaminergic lesion induced by the 6-hydroxydopamine (6-OHDA) dopaminergic toxin, decreasing the motor impairment, the dopaminergic neuronal loss, and the recruitment of astrocytes and microglia by the lesioned regions [17]. Moreover, special attention has been paid to the role of the most abundant endocannabinoid ligand, 2-arachidonylglycerol (2-AG), which presents with high affinity to CB2r activation [18], owing to its modulatory and neuroprotective effect [19, 20]. Indeed, the inhibition of the 2-AG metabolizing enzyme monoacylglycerol lipase (MAGL) with the antagonist URB602 induced significant neuroprotective effects [21]. In addition, a recent study showed that MAGL inhibition produces a neuroprotective effect in an animal model of PD through restorative astroglia and microglia activation and the release of neuroprotective and anti-inflammatory molecules [22].

Several studies have shown that glial cells play a crucial role in the neuropathogenesis of PD. In the first stages of the disease it has been suggested that astrocytes take up altered α-synuclein from axon terminals [23], leading to neurodegenerative processes through different proposed mechanisms such as the production of proinflammatory cytokines and chemokines [24] and microglial activation [25]. Next, activated phagocytic microglia gain an important role in the midbrain dopaminergic neuronal loss during the progression of the disorder [26, 27]. Interestingly, there is evidence for the presence of CB2r in reactive microglia and activated astrocytes [28], suggesting a relevant modulatory role in the neuroinflammatory and neurodegenerative processes. Indeed, it has been determined that CB2r activation decreases the in vitro production of pro-inflammatory molecules in different neural cell types, such as rat microglial cells [29, 30], primary mouse astrocytes [31, 32], human microglial cells [33], and human astrocytes [34]. Furthermore, Price et al. [9] showed an up-regulation of CB2r in microglia recruited to 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)-lesioned brain regions. A recent study also reveals a significant increase of CB2r gene expression after the intra-striatum injection of 6-OHDA or bacterial lipopolysaccharide (LPS). This effect was also accompanied by an increase of microglial activation, suggesting that targeting CB2r could be a useful tool with which to modify neuroinflammation in PD [35].

Despite the available literature about the pivotal role of the endocannabinoid system in the neuropathological processes of PD and the potential therapeutic usefulness of its pharmacological modulation, additional studies are needed to clarify precisely how it participates in the nigrostriatal neurodegenerative process. Thus, the aim of this study was to evaluate further the potential involvement of the endocannabinoid system in PD through the identification of CB1r, CB2r brain-specific A-isoform (CB2Ar) [36], and MAGL gene expression alterations in the substantia nigra (SN) and putamen (PUT) of patients with PD. In addition, immunohistochemical analyses were performed to determine the precise co-localization of CB2r with tyrosine hydroxylase (TH)-positive neurons, astrocytes, and/or microglia in the SN of healthy controls and patients with PD.

Materials and Methods

Subjects

Frozen brain samples from patients with PD and their respective controls were obtained from Fundación CIEN Brain Bank (Madrid, Spain), Fundación Alcorcón University Hospital Brain Bank (Madrid, Spain), London Neurodegenerative Diseases Brain Bank (London, UK), and Parkinson’s UK Brain Bank (London, UK). Fixed brain samples were taken from the Navarrabiomed Brain Bank (Pamplona, Spain). A declaration of intent regarding the responsible use of supplied postmortem tissue and clinical information from brain donors was approved by all the brain banks. All patients with PD fulfilled the diagnostic criteria for advanced disease (stages 4–5) [37] and were matched with control subjects without neuropathological disease. The neuropathological data provided by the brain banks and the immunohistochemical analysis of brain samples clearly showed a notable neurodegeneration of dopaminergic neurons in the SN of patients with PD. Demographic and postmortem data of all the subjects included in the study are shown in Table 1. SN and PUT were dissected from controls (n = 16 and n = 24, respectively) and patients with PD (n = 25 and n = 28, respectively). The cases included in the present study were male and female and were matched as closely as possible for age (controls: 70.8 ± 14.2 years; patients with PD: 75.8 ± 7.8 years) and postmortem interval (controls: 20.2 ± 13.9 h; patients with PD: 19.7 ± 19.9 h). Other factors such as additional diseases, cause of death, or medication were analyzed for the brain tissue selection to avoid interference with the studied parameters. The collection and analysis of postmortem brain tissue was approved by the ethics committees of Miguel Hernandez University and University of Navarra.
Table 1

Data from patients with Parkinson’s disease (PD) and healthy controls (C)

Subject ID

Age

Gender

PMI (hours)

Classification

Biobank

C1

68

M

8

C

CIEN-BB

C2

56

M

8

C

CIEN-BB

C3

68

M

17

C

CIEN-BB

C4

58

F

6

C

CIEN-BB

C5

80

M

8

C

HUFA-BB

C6

80

F

7

C

HUFA-BB

C7

81

M

18

C

MRC-BB

C8

79

M

47

C

MRC-BB

C9

79

M

24

C

MRC-BB

C10

71

M

5

C

MRC-BB

C11

86

M

6

C

MRC-BB

C12

85

M

42

C

MRC-BB

C13

60

M

35

C

MRC-BB

C14

59

M

50

C

MRC-BB

C15

57

M

26

C

MRC-BB

C16

92

M

13

C

PUK-BB

C17

90

F

15

C

PUK-BB

C18

35

M

22

C

PUK-BB

C19

88

M

22

C

PUK-BB

C20

68

M

30

C

PUK-BB

C21

65

M

12

C

PUK-BB

C22

78

F

23

C

PUK-BB

C23

80

F

23

C

PUK-BB

C24

82

M

48

C

PUK-BB

C25

77

M

4

C

NBM-BB

C26

53

M

7

C

NBM-BB

C27

63

M

29

C

NBM-BB

C28

46

M

11

C

NBM-BB

PD1

69

F

13

PD

CIEN-BB

PD2

67

M

5

PD

CIEN-BB

PD3

55

M

6

PD

CIEN-BB

PD4

75

M

8

PD

CIEN-BB

PD5

85

F

3

PD

CIEN-BB

PD6

66

F

6

PD

CIEN-BB

PD7

75

M

40

PD

MRC-BB

PD8

70

M

49

PD

MRC-BB

PD9

84

M

34

PD

MRC-BB

PD10

74

M

10

PD

MRC-BB

PD11

59

M

23

PD

MRC-BB

PD12

79

M

89

PD

MRC-BB

PD13

72

M

29

PD

MRC-BB

PD14

76

M

66

PD

MRC-BB

PD15

73

M

40

PD

MRC-BB

PD16

78

M

22

PD

PUK-BB

PD17

79

M

21

PD

PUK-BB

PD18

75

M

22

PD

PUK-BB

PD19

89

M

16

PD

PUK-BB

PD20

77

M

6

PD

PUK-BB

PD21

80

M

16

PD

PUK-BB

PD22

86

M

3

PD

PUK-BB

PD23

70

M

13

PD

PUK-BB

PD24

82

M

10

PD

PUK-BB

PD25

75

M

15

PD

PUK-BB

PD26

75

M

3

PD

PUK-BB

PD27

72

M

9

PD

PUK-BB

PD28

79

M

22

PD

PUK-BB

PD29

88

F

1.5

PD

NBM-BB

PD30

87

M

7

PD

NBM-BB

PD31

79

F

2

PD

NBM-BB

Brain samples were obtained from Fundación CIEN Brain Bank, Spain (CIEN-BB); Fundación Alcorcón University Hospital Brain Bank, Spain (HUFA-BB); London Neurodegenerative Diseases Brain Bank, United Kingdom (MRC-BB); Parkinson’s UK Brain Bank, United Kingdom (PUK-BB); and Navarrabiomed Brain Bank, Spain (NBM-BB).

PMI = postmortem interval; M = male; F = female

RNA Integrity Number Evaluation

Total RNA was isolated from SN and PUT snap-frozen tissue. Integrity of the RNA samples was analyzed by the 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA) detecting RNA ribosomal bands (18S and 28S). Depending on the ratio 28S/18S, a value (1–10), named the RNA integrity number (RIN), was calculated, suggesting the degree of RNA degradation (1 = completely degraded; 10 = intact sample). All RNA samples (SN and PUT) from controls and patients with PD presented a mean RIN value > 6 [controls: 6.2 ± 0.7 (range 5.0–7.1); patients with PD: 6.4 ± 0.7 (range 5.3–7.7)], suggesting an appropriated RNA quality to perform gene expression analyses.

Gene Expression Analyses: Real-time Polymerase Chain Reaction (real-time PCR)

Relative gene expression analyses of CB1r, CB2Ar, and MAGL in the SN and PUT were carried out between controls and patients with PD. Total RNA was obtained from brain sections and reverse transcription to cDNA was carried out. Taqman Gene Expression Assays (Life Technologies, Carlsbad, CA, USA) were used to measure CB1r (Hs00275634_m1), CB2Ar (forward primer GGAAGAAAGAGAATATTGTTCAGTTGATT, reverse primer GCTGGCCTTGGAGAGTGACA, and Taqman probe CCAGATGCAGCCGC), and MAGL (Hs000200752_m1) relative gene expression on the StepOne© Sequence Detector System (Life Technologies). All reagents were obtained from Applied Biosystems (Life Technologies) and the manufacturer protocols were followed. All primer–probe combinations were optimized and validated for relative quantification of gene expression. In this study, 2 housekeeping genes, cyclophilin (PPIA, Hs99999904_m1) and synaptophysin (SYP, Hs00300531_m1), were used to ensure the validity and reproducibility of results. Data for each target gene were normalized with the endogenous reference genes, and the fold change in target gene abundance was determined using the 2–ΔΔCt method [38]. Briefly, samples were run in duplicate for both the target and the housekeeping genes, in different 96-well plates (a maximum of 8 samples per group —C or PD— in each plate), and the result was expressed as the mean value for both endogenous housekeeping genes (PPIA and SYP). Thus, sample values were considered when standard deviation (SD) between duplicates was less than ± 0.3 in order to avoid inhomogeneous pipetting.

Immunohistochemistry

For immunohistochemical analyses, fixed brain samples were taken from 4 patients with PD (stages 4–5) [37] and 3 age-matched controls (Navarrabiomed Brain Bank, Pamplona, Spain). The postmortem interval was between 1.5 and 9 h in all cases. Briefly, 4-mm-thick coronal blocks through the mesencephalon comprising the entire SN were fixed for 24 h in a buffered solution of 4% paraformaldehyde at 4oC under gentle shaking. Next, blocks were cryoprotected in a solution of 2% dimethyl sulfoxide and 20% glycerin in 0.1 M phosphate buffer pH 7.4 for 48 h. Frozen coronal sections (40 μm-thick) were obtained in a sliding microtome and collected in 0.1 M phosphate buffer (pH 7.4). Free-floating sections were incubated in a blocking solution containing 5% of normal donkey serum (Jackson Immunoresearch Laboratories, West Grove, PA, USA) for 1 h. Next, sections were incubated in a cocktail solution of primary antisera comprising 1:1000 rabbit anti-glial fibrillary acidic protein (GFAP) or 1:500 rabbit anti-ionized calcium-binding adapter molecule (Iba1), and 1:1000 goat anti-tyrosine hydroxylase (TH) for 60 h at 4oC. Subsequently, sections were incubated for 2 h in a cocktail solution made of 1:500 Alexa488 donkey anti-rabbit IgG (Invitrogen, Carlsbad, CA, USA) and 1:500 Alexa633 donkey anti-goat IgG (Invitrogen). Once these immunofluorescent stains were completed, then the in situ proximity ligation assay (PLA) was started by incubation for 1 h at 37o C with the blocking solution (Duolink® In Situ Probemaker PLUS; Sigma, St. Louis, MO, USA) in a preheated humidity chamber, followed by overnight incubation with a rabbit anti-CB2r primary antibody (1:200; Cayman, Ann Arbor, MI, USA). This primary antibody was diluted in the antibody diluent provided by Sigma within the PLA kit described below. Sections were then incubated with the secondary antibodies known as PLA probes (Duolink® In Situ PLA Probe anti-rabbit MINUS and Duolink® In Situ PLA Probe anti-rabbit PLUS; both Sigma) diluted 1:5 in the antibody diluent provided by the manufacturer of the PLA kit. The presence of CB2r in these samples was detected using the Duolink II in situ PLA detection kit (Duolink® In Situ Detection Reagents Red; Sigma). Following the detection protocol as described by the supplier, the sections were washed with buffer A at room temperature and incubated with the ligation solution for 1 h at 37o C, in a humidity chamber. After washing with buffer A, samples were incubated with the amplification solution for 100 min at 37oC and then washed with buffer B (Sigma), and finally mounted using an aqueous mounting medium.

Stained samples were inspected under a Zeiss 510 Meta confocal laser-scanning microscope. To ensure appropriate visualization of the labeled elements and to avoid false-positive results, the emission from the argon laser at 488 nm (GFAP- or Iba1-immunostained structures) was filtered through a band pass filter of 505 to 530 nm and color-coded in green. The emission following excitation with the helium laser at 543 nm (CB2r) was filtered through a band pass filter of 560 to 615 nm and color-coded in blue. Finally, a long-pass filter of 650 nm was used to visualize the emission from the helium laser at 633 nm (TH+ neurons) and color-coded in red.

Statistical Analyses

Statistical analyses of gene expression in results were performed using the Student’s t test when control and PD groups were compared. Differences were considered significant when the probability of error was < 5%. SigmaPlot v11.0 (Systat Software, San Jose, CA, USA) was employed.

Results

Evaluation of Total RNA Integrity in Frozen Tissue from SN and PUT of Controls and Patients with PD

The results showed that the mean RIN value was > 6 [SN: controls 6.2 ± 0.2, PD 6.2 ± 0.1; PUT: controls 6.1 ± 0.3, PD 6.6 ± 0.1 (Fig. 1)], which was considered a sufficiently good RNA quality level [39]. No significant difference was observed between controls and patients with PD in any of the brain regions studied (PUT: t = –1.503, p = 0.014, 49 df; SN: t = 0.404, p = 0.689, 36 df ).
Fig. 1

Total RNA integrity number (RIN) evaluation in the substantia nigra (SN) and putamen (PUT) of healthy controls (n = 16 and n = 23, respectively) and patients with Parkinson’s disease (n = 25 and n = 28, respectively). (A, B) Representative electropherogram images of mean RIN values from SN and PUT brain regions, respectively. (C) RIN values summary table; gray boxes contain global mean values

CB1r, CB2Ar, and MAGL Gene Expression Changes in the SN and PUT Between Controls and Patients with PD

CB1r gene expression in the SN of controls and patients with PD was not significantly different (t = –1.140, p = 0.265, 36 df; Fig. 2A), whereas a significant increase in CB1r mRNA levels was evident in the PUT of patients with PD compared with controls (205%; t = –4.418, p < 0.001, 49 df; Fig. 2B). CB2Ar gene expression significantly increased in the SN (395%; t = –5.762, p < 0.001, 36 df; Fig. 2C) and decreased in the PUT (–42%; t = 5.429, p < 0.001, 49 df; Fig. 2D) of patients with PD compared with controls. In contrast, patients with PD presented a significant reduction in MAGL gene expression in the SN (–28%; t = 2.978, p = 0.005, 36 df; Fig. 2E) and a significant increase in the PUT (222%; t = –3.295, p = 0.002, 49 df; Fig. 2F) compared with controls.
Fig. 2

Cannabinoid CB1 receptor (CB1r), cannabinoid CB2 receptor A isoform (CB2Ar), and monoacylglycerol lipase (MAGL) gene expression analyses by real-time polymerase chain reaction (real-time PCR). Gene expression in patients with Parkinson’s disease (PD) is expressed relative to healthy controls. Data are expressed as mean ± SEM of 2–ΔΔCt. CB1r, CB2Ar, and MAGL gene expression in the substantia nigra (SN) (A, C, and E, respectively) and PUT (B, D, and F, respectively). *Significantly different (p < 0.05) from controls

Immunohistochemical Localization of CB2r in the SN Pars Compacta of Controls and Patients with PD

Dopaminergic neurons throughout the SN pars compacta were clearly identified by their immunoreactivity for TH (TH+ neurons), as well as for the frequent presence of intracytoplasmic-pigmented neuromelanin. As expected, PD brain samples exhibited a smaller number of TH+ neurons than those samples obtained from control specimens. TH+ neurons were surrounded by astrocytes in all cases, although the astroglial reaction was by large much more intense in PD brain samples (Fig. 3). CB2r expression was clearly observed in astroglial processes instead of in dopaminergic neurons. Compared with expression levels in control cases, there was a higher immunoreactivity for CB2r in the astrocytes from patients with PD (Fig. 3). Moreover, CB2r were never observed within microglial cells as observed with immunohistochemical stains for Iba1 (Fig. 4).
Fig. 3

Localization of cannabinoid CB2 receptor (CB2r) in the substantia nigra (SN) pars compacta. Dopaminergic neurons were identified by tyrosine hydroxylase (TH) immunostain and color-coded in blue. Astrocytes were evidenced following glial fibrillary acidic protein (GFAP) immunostain and are shown in green. The observed glial reaction was far more intense in brains from patients with Parkinson’s disease (PD) than in the corresponding control samples. Furthermore, the presence of CB2r (as assessed with the proximity ligation assay (PLA) stain, illustrated in red) was mostly seen in pericellular astrocytical processes surrounding TH+ neuronal somata. It seems clear that the intensity of CB2r immunostaining was always higher in samples coming from PD brains. The presence of self-fluorescent neuromelanin pigment was often observed in the cytoplasm of TH+ neurons. Scale bar is 10 μm in all panels

Fig. 4

Localization of the cannabinoid CB2 receptor (CB2r) in the substantia nigra (SN) pars compacta. Dopaminergic neurons were identified by tyrosine hydroxylase (TH) immunostain and color-coded in blue. Microglial cells were evidenced following ionized calcium-binding adapter molecule 1 (Iba1) immunostain and color-coded in green (arrows), whereas the proximity ligation assay (PLA) stain was done to elucidate the presence of CB2r (red channel). CB2r was abundantly found in extracellular locations other than dopaminergic and microglial cells. Scale bar is 10 μm in all panels. LB = Lewy body

Discussion

The results of the present study provide further evidence of the role of the endocannabinoid system, specifically CB1r, CB2r, and MAGL targets, in the nigrostriatal dopaminergic neurodegenerative process of PD. This assumption is based on the following results: 1) CB1r gene expression was significantly increased in the PUT of patients with PD, whereas no changes were present in the SN; 2) CB2Ar gene expression was significantly upregulated in the SN (4-fold) and downregulated in the PUT of patients with PD; 3) MAGL gene expression was reduced in the SN of patients with PD, and increased in the PUT of patients with PD; and 4) only astrocytes, but not TH+ or microglial cells, expressed CB2r in the SN of patients with PD.

Little information has been provided about the regulation of CB2r in the brains of patients with PD. Only two previous studies have analyzed CB2r protein expression and its cellular localization through immunostaining experiments in a reduced number of postmortem brain samples from controls (n = 5) and patients with PD (n = 5). García et al. [40] showed that CB2r was present in TH-immunopositive neurons in the SN of patients with PD and controls, accompanied by a highly significant reduction in CB2r protein expression in patients with PD compared with controls. This result is intriguing considering the previous literature supporting the association between neurodegeneration and CB2r upregulation, and especially the results from animal models of PD. However, in the same year another study was published by Gómez-Gálvez et al. [41], in which CB2r was evaluated by immunohistochemical analyses in the same set of brain samples. In this study, CB2r protein expression was significantly upregulated in the SN of patients with PD. In addition, CB2r was present in the microglia (cells immunopositive for Iba-1) and possibly in macrophages and astrocytes. In the present study, the gene expression of a brain-specific isoform (A) of CB2r was evaluated in a large sample of postmortem brain tissue from controls (n = 24) and patients with PD (n = 28). In accordance with the results of Gómez-Gálvez et al. [41], in the current study CB2ar gene expression was markedly upregulated (4-fold) and immunohistochemical analyses clearly demonstrated an increase of CB2r-immunopositive cells (see Figs 3 and 4, red coded) in the SN of the analyzed patients with PD.

The activation of astrocytes and microgial cells under neuroinflammatory and neurodegenerative conditions leads to an up-regulation of CB2r. This phenomenon has been replicated under different experimental conditions in animal models of pain [42], inflammation [43], ischemia-induced hypoxia [44], Huntington’s disease [45], and PD. Previous evidence has shown that in mice treated intraperitoneally with the neurotoxin MPTP there was significant up-regulation of CB2r gene expression in the SN [9]. In addition, Concannon et al. [35, 46] studied different neurotoxic and neuroinflammatory animal models of PD, demonstrating that the expression of CB2r is significantly increased, although this effect was more pronounced in those inflammation-driven animal models. Interestingly, studies in postmortem brain tissue from patients with a neurodegenerative disorder confirmed this result by also finding an up-regulation of CB2r [47, 48, 49]. It has been suggested that this up-regulatory response in the microglia is aimed at controlling the production of neurotoxic factors such as nitric oxide, pro-inflammatory cytokines, and reactive oxygen species. In the case of astrocytes it is thought that the increase of CB2r contributes to the neuroprotective process by generating pro-survival factors or metabolic substrates for neurons, although there is a lack of information about the precise function of CB2r in these effects [50].

The presence of CB2r was recently documented in hippocampal neuronal populations [51] and dopaminergic neurons located in the ventral tegmental area (VTA) [52] in mice, as well as in basal ganglia output neurons in macaques [53]. Moreover, the presence of CB2r immunoreactivity was also recently found in the dopaminergic neurons of the SN in postmortem human brains from controls and patients with PD, as previously mentioned [40]. Here, we failed to observe CB2r immunoreactivity in TH+ nigral neurons, neither in controls brains nor in those of patients with PD. Immunohistochemical expression of CB2r was only found in astrocytes, with a total lack of CB2r staining in dopaminergic and microglial cells. Indeed, a clear increase in CB2r staining intensity was observed within astrocytes in brain samples from patients with PD, which is in agreement with CB2ar gene expression results (see Fig. 2). These apparent discrepancies between both studies might be explained by the different methods applied during tissue processing. The procedure followed by García et al. [40] included a deparaffination step, followed by a microwave antigen-retrieval procedure. None of these procedures was done here, as in our experience the use of paraformaldehyde fixation followed by the preparation of frozen sections minimizes the presence of false positive results and enhances antibody penetration. Indeed, it is worth noting that by taking advantage of the PLA technique, a 1000-fold amplification of the signal is obtained, an important procedure when detecting antigens expressed at very low concentrations such is the case for CB2r. Consequently, if a lack of CB2r stain is found in dopaminergic and microglial cells, it is highly probable that CB2r is not expressed within any of those cellular populations. Therefore, these data suggest that the CB2r-mediated regulation of astrocytes function in the SN could play a pivotal role in the neuropathogenesis of PD. This assumption is partially supported by previous reports that shed light about the role of CB2r in astrocytes. These studies suggested that CB2r participates in the modulation of the production of different inflammatory mediators [34, 54], and its activation presents a neuroprotective effect [55]. Furthermore, it is relevant to note that in the study performed by Gómez-Gálvez et al. in the SN brain tissue of controls and patients with PD, the authors stated that CB2r immunofluorescence was also present in cells that were not labeled with Iba-1, probably astrocytes [41].

Therefore, taking into consideration that the presence of CB2r was previously described in neurons from rodents and macaques, but in this study there was no signal in the SN of patients with PD employing a highly sensitive immunohistochemical technique, it might be hypothesized that these differences could be related to several factors, such as 1) the prominent neurodegenerative state of this brain region in aged patients with PD; or 2) species differences between animals and humans. However, additional analyses are warranted to shed light on this question.

In the PUT of patients with PD, CB2ar gene expression is significantly lower compared with controls. This result, in comparison with the notable increase detected in the SN, could be attributed, at least in part, to the different regional regulation of the endocannabinoid system that has been proposed to depend on the dopaminergic activity [56]. A previous study evaluating CB1r availability by positron emission tomography (PET) and magnetic resonance imaging (MRI) showed a significant decrease in CB1r availability in the SN of patients with PD, whereas an increase was found in nigrostriatal dopaminergic projection areas, such as PUT [7]. Indeed, in the present study CB1r gene expression also showed a significant increase in the PUT of patients with PD, although there were no noticeable changes in the SN. Therefore, it can be hypothesized that the differences in the neuropathological state and the regulatory projections of both regions in PD might account for the CB2ar gene expression data [57], although additional studies are necessary to elucidate the underlying neurobiological mechanisms involved.

MAGL gene expression changes were also evaluated in the SN and PUT of controls and patients with PD to obtain an indirect measure of the 2-AG-mediated endocannabinoid tone in the nigrostriatal pathway. Evidence suggests that the release of 2-AG during neuronal injury could be closely associated with a neuroprotective reaction in different experimental animal models [19, 58, 59, 60, 61]. In addition, previous studies have shown a relevant role of 2-AG in animal models of PD. Indeed a 7-fold increase of 2-AG was found in the globus pallidus of reserpine-treated rats [62], and an elevation of 2-AG in the striatum of monkeys lesioned with MPTP [63]. Interestingly, in a recent study employing MPTP-lesioned mice the inhibition of MAGL reduced degradation of 2-AG, improved MPTP-induced motor impairment and induced the release of neuroprotective and anti-inflammatory molecules [22]. Another study evaluated the mechanisms involved in the neuroprotective effect induced by the MAGL inhibitor JZL184. The results revealed that CB2r plays a relevant role as the selective CB2r antagonist AM630 fully blocked the JZL184-mediated effects, JWH133 administration mimicked them, and the CB1r antagonist rimonabant was without effect [64].

In accordance with the previous reports, it is possible to hypothesize that a significant and sustained elevation of 2-AG levels may be found in the PUT of patients with PD accounting for the compensatory reduction of CB2Ar and the elevation of MAGL gene expression (see Fig. 2). However, the marked neuronal loss occurring in the SN of patients with PD, and a different functional regulation of the endocannabinoid system, may entail a different scenario, probably with a lesser release of 2-AG. This decrease of 2-AG would be related to the remarkable increase of CB2ar gene expression and the significant reduction of MAGL gene expression as compensatory mechanisms. This hypothetical assumption is based mainly on preclinical data and does not coincide with a recent study measuring 2-AG levels by mass spectrometry in mice following subchronic MPTP treatment. The results showed an increase in 2-AG levels in the ventral midbrain and a reduction in the striatum [65]. Therefore, additional studies are required to find out the precise regulatory mechanisms of the endocannabinoid system that could explain better these contrasting results between nigral dopaminergic body cells and its striatal terminals.

In conclusion, the results of the present study suggest that CB1r, CB2r, and MAGL play a relevant role in PD. This premise is based on the gene expression alterations that were found in the SN and PUT of patients with PD, and on the exclusive and higher presence of CB2r in the astrocytes located in the SN pars compacta of patients with PD in comparison with controls. These data provide important clues for the development of mechanism-based therapeutics through the functional modulation of the endocannabinoid system, highlighting CB1r, CB2r, and MAGL as potential pharmacological targets that need further consideration for the treatment of PD.

Notes

Acknowledgements

We thank Fundación CIEN Brain Bank (Madrid, Spain), Fundación Alcorcón University Hospital Brain Bank (Madrid, Spain), London Neurodegenerative Diseases Brain Bank (London, UK), Parkinson’s UK Brain Bank (London, UK), and Navarrabiomed Brain Bank (Pamplona, Spain) for the supply of postmortem brain tissue. This work was supported by “DISTEC professorship for the study of Parkinson’s disease” to J. Manzanares, and by a grant from the Spanish Ministry of Economy (BFU2012-37907) to J.L. Lanciego.

Required Author Forms

Disclosure forms provided by the authors are available with the online version of this article.

Supplementary material

13311_2018_603_MOESM1_ESM.pdf (523 kb)
ESM 1 (PDF 523 kb)

References

  1. 1.
    Miller DB, O'Callaghan JP. Biomarkers of Parkinson's disease: present and future. Metabolism. 2015;64(3 Suppl. 1):S40-S46.CrossRefPubMedGoogle Scholar
  2. 2.
    Sharma S, Moon CS, Khogali A, et al. Biomarkers in Parkinson's disease (recent update). Neurochem Int. 2013;63(3):201-229.CrossRefPubMedGoogle Scholar
  3. 3.
    Garcia-Arencibia M, Garcia C, Fernandez-Ruiz J. Cannabinoids and Parkinson's disease. CNS Neurol Disord Drug Targets. 2009;8(6):432-439.CrossRefPubMedGoogle Scholar
  4. 4.
    Pisani V, Madeo G, Tassone A, et al. Homeostatic changes of the endocannabinoid system in Parkinson's disease. Mov Disord. 2010;26(2):216-222.CrossRefPubMedGoogle Scholar
  5. 5.
    Walsh S, Mnich K, Mackie K, et al. Loss of cannabinoid CB1 receptor expression in the 6-hydroxydopamine-induced nigrostriatal terminal lesion model of Parkinson's disease in the rat. Brain Res Bull 2010;81(6):543-548.CrossRefPubMedPubMedCentralGoogle Scholar
  6. 6.
    Hurley MJ, Mash DC, Jenner P. Expression of cannabinoid CB1 receptor mRNA in basal ganglia of normal and parkinsonian human brain. J Neural Transm. 2003;110(11):1279-1288.CrossRefPubMedGoogle Scholar
  7. 7.
    Van Laere K, Casteels C, Lunskens S, et al. Regional changes in type 1 cannabinoid receptor availability in Parkinson's disease in vivo. Neurobiol Aging. 2012;33(3):620 e621-e628.Google Scholar
  8. 8.
    Cao X, Liang L, Hadcock JR, et al. Blockade of cannabinoid type 1 receptors augments the antiparkinsonian action of levodopa without affecting dyskinesias in 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine-treated rhesus monkeys. J Pharmacol Exp Ther. 2007;323(1):318-326.CrossRefPubMedGoogle Scholar
  9. 9.
    Price DA, Martinez AA, Seillier A, et al. WIN55,212-2, a cannabinoid receptor agonist, protects against nigrostriatal cell loss in the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine mouse model of Parkinson's disease. Eur J Neurosci. 2009;29(11):2177-2186.CrossRefPubMedPubMedCentralGoogle Scholar
  10. 10.
    Cerri S, Levandis G, Ambrosi G, et al. Neuroprotective potential of adenosine A2A and cannabinoid CB1 receptor antagonists in an animal model of Parkinson disease. J Neuropathol Exp Neurol. 2014;73(5):414-424.CrossRefPubMedGoogle Scholar
  11. 11.
    Zeng BY, Dass B, Owen A, et al. Chronic L-DOPA treatment increases striatal cannabinoid CB1 receptor mRNA expression in 6-hydroxydopamine-lesioned rats. Neurosci Lett. 1999;276(2):71-74.CrossRefPubMedGoogle Scholar
  12. 12.
    Silverdale MA, McGuire S, McInnes A, Crossman AR, Brotchie JM. Striatal cannabinoid CB1 receptor mRNA expression is decreased in the reserpine-treated rat model of Parkinson's disease. Exp Neurol. 2001;169(2):400-406.CrossRefPubMedGoogle Scholar
  13. 13.
    Van Sickle MD, Duncan M, Kingsley PJ, et al. Identification and functional characterization of brainstem cannabinoid CB2 receptors. Science. 2005;310(5746):329-332.CrossRefPubMedGoogle Scholar
  14. 14.
    Palazuelos J, Aguado T, Pazos MR, et al. Microglial CB2 cannabinoid receptors are neuroprotective in Huntington's disease excitotoxicity. Brain. 2009;132(Pt 11):3152-3164.CrossRefPubMedGoogle Scholar
  15. 15.
    Ashton JC, Glass M. The cannabinoid CB2 receptor as a target for inflammation-dependent neurodegeneration. Curr Neuropharmacol. 2007;5(2):73-80.CrossRefPubMedPubMedCentralGoogle Scholar
  16. 16.
    Grunblatt E, Zander N, Bartl J, et al. Comparison analysis of gene expression patterns between sporadic Alzheimer's and Parkinson's disease. J Alzheimers Dis. 2007;12(4):291-311.CrossRefPubMedGoogle Scholar
  17. 17.
    Ternianov A, Perez-Ortiz JM, Solesio ME, et al. Overexpression of CB2 cannabinoid receptors results in neuroprotection against behavioral and neurochemical alterations induced by intracaudate administration of 6-hydroxydopamine. Neurobiol Aging. 2012;33(2):421 e421-e416.CrossRefGoogle Scholar
  18. 18.
    Gonsiorek W, Lunn C, Fan X, et al. Endocannabinoid 2-arachidonyl glycerol is a full agonist through human type 2 cannabinoid receptor: antagonism by anandamide. Mol Pharmacol. 2000;57(5):1045-1050.PubMedGoogle Scholar
  19. 19.
    Zhang J, Chen C. Endocannabinoid 2-arachidonoylglycerol protects neurons by limiting COX-2 elevation. J Biol Chem. 2008;283(33):22601-22611.CrossRefPubMedPubMedCentralGoogle Scholar
  20. 20.
    Kreutz S, Koch M, Bottger C, et al. 2-Arachidonoylglycerol elicits neuroprotective effects on excitotoxically lesioned dentate gyrus granule cells via abnormal-cannabidiol-sensitive receptors on microglial cells. Glia. 2009;57(3):286-294.CrossRefPubMedGoogle Scholar
  21. 21.
    Carloni S, Alonso-Alconada D, Girelli S, et al. Pretreatment with the monoacylglycerol lipase inhibitor URB602 protects from the long-term consequences of neonatal hypoxic-ischemic brain injury in rats. Pediatr Res. 2012;72(4):400-406.CrossRefPubMedGoogle Scholar
  22. 22.
    Fernandez-Suarez D, Celorrio M, Riezu-Boj JI, et al. The monoacylglycerol lipase inhibitor JZL184 is neuroprotective and alters glial cell phenotype in the chronic MPTP mouse model. Neurobiol Aging. 2014;35(11):2603-2616.CrossRefPubMedGoogle Scholar
  23. 23.
    Braak H, Sastre M, Del Tredici K. Development of alpha-synuclein immunoreactive astrocytes in the forebrain parallels stages of intraneuronal pathology in sporadic Parkinson's disease. Acta Neuropathol. 2007;114(3):231-241.CrossRefPubMedGoogle Scholar
  24. 24.
    Lee HJ, Suk JE, Patrick C, et al. Direct transfer of alpha-synuclein from neuron to astroglia causes inflammatory responses in synucleinopathies. J Biol Chem. 2010;285(12):9262-9272.CrossRefPubMedPubMedCentralGoogle Scholar
  25. 25.
    Gu XL, Long CX, Sun L, et al. Astrocytic expression of Parkinson's disease-related A53T alpha-synuclein causes neurodegeneration in mice. Mol Brain. 2010;3:12.CrossRefPubMedPubMedCentralGoogle Scholar
  26. 26.
    Long-Smith CM, Sullivan AM, Nolan YM. The influence of microglia on the pathogenesis of Parkinson's disease. Prog Neurobiol. 2009;89(3):277-287.CrossRefPubMedGoogle Scholar
  27. 27.
    Croisier E, Moran LB, Dexter DT, Pearce RK, Graeber MB. Microglial inflammation in the parkinsonian substantia nigra: relationship to alpha-synuclein deposition. J Neuroinflammation. 2005;2:14.CrossRefPubMedPubMedCentralGoogle Scholar
  28. 28.
    Fernandez-Ruiz J, Garcia C, Sagredo O, Gomez-Ruiz M, de Lago E. The endocannabinoid system as a target for the treatment of neuronal damage. Expert Opin Ther Targets. 2010;14(4):387-404.CrossRefPubMedGoogle Scholar
  29. 29.
    Puffenbarger RA, Boothe AC, Cabral GA. Cannabinoids inhibit LPS-inducible cytokine mRNA expression in rat microglial cells. Glia. 2000;29(1):58-69.CrossRefPubMedGoogle Scholar
  30. 30.
    Facchinetti F, Del Giudice E, Furegato S, Passarotto M, Leon A. Cannabinoids ablate release of TNFalpha in rat microglial cells stimulated with lypopolysaccharide. Glia. 2003;41(2):161-168.CrossRefPubMedGoogle Scholar
  31. 31.
    Molina-Holgado F, Lledo A, Guaza C. Anandamide suppresses nitric oxide and TNF-alpha responses to Theiler's virus or endotoxin in astrocytes. Neuroreport. 1997;8(8):1929-1933.CrossRefPubMedGoogle Scholar
  32. 32.
    Molina-Holgado F, Molina-Holgado E, Guaza C, Rothwell NJ. Role of CB1 and CB2 receptors in the inhibitory effects of cannabinoids on lipopolysaccharide-induced nitric oxide release in astrocyte cultures. J Neurosci Res 2002;67(6):829-836.Google Scholar
  33. 33.
    Klegeris A, Bissonnette CJ, McGeer PL. Reduction of human monocytic cell neurotoxicity and cytokine secretion by ligands of the cannabinoid-type CB2 receptor. Br J Pharmacol. 2003;139(4):775-786.CrossRefPubMedPubMedCentralGoogle Scholar
  34. 34.
    Sheng WS, Hu S, Min X, et al. Synthetic cannabinoid WIN55,212-2 inhibits generation of inflammatory mediators by IL-1beta-stimulated human astrocytes. Glia. 2005;49(2):211-219.CrossRefPubMedGoogle Scholar
  35. 35.
    Concannon RM, Okine BN, Finn DP, Dowd E. Differential upregulation of the cannabinoid CB2 receptor in neurotoxic and inflammation-driven rat models of Parkinson's disease. Exp Neurol. 2015;269:133-141.CrossRefPubMedGoogle Scholar
  36. 36.
    Liu QR, Pan CH, Hishimoto A, et al. Species differences in cannabinoid receptor 2 (CNR2 gene): identification of novel human and rodent CB2 isoforms, differential tissue expression and regulation by cannabinoid receptor ligands. Genes Brain Behav. 2009;8(5):519-530.CrossRefPubMedPubMedCentralGoogle Scholar
  37. 37.
    Hoehn MM, Yahr MD. Parkinsonism: onset, progression and mortality. Neurology. 1967;17(5):427-442.CrossRefPubMedGoogle Scholar
  38. 38.
    Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001;25(4):402-408.CrossRefPubMedGoogle Scholar
  39. 39.
    Kap M, Oomen M, Arshad S, de Jong B, Riegman P. Fit for purpose frozen tissue collections by RNA integrity number-based quality control assurance at the Erasmus MC tissue bank. Biopreserv Biobank. 2014;12(2):81-90.CrossRefPubMedGoogle Scholar
  40. 40.
    Garcia MC, Cinquina V, Palomo-Garo C, Rabano A, Fernandez-Ruiz J. Identification of CB2 receptors in human nigral neurons that degenerate in Parkinson's disease. Neurosci Lett. 2015;587:1-4.CrossRefPubMedGoogle Scholar
  41. 41.
    Gomez-Galvez Y, Palomo-Garo C, Fernandez-Ruiz J, Garcia C. Potential of the cannabinoid CB(2) receptor as a pharmacological target against inflammation in Parkinson's disease. Prog Neuropsychopharmacol Biol Psychiatry. 2016;64:200-208.CrossRefPubMedGoogle Scholar
  42. 42.
    Beltramo M, Bernardini N, Bertorelli R, et al. CB2 receptor-mediated antihyperalgesia: possible direct involvement of neural mechanisms. Eur J Neurosci. 2006;23(6):1530-1538.CrossRefPubMedGoogle Scholar
  43. 43.
    Mukhopadhyay S, Das S, Williams EA, et al. Lipopolysaccharide and cyclic AMP regulation of CB(2) cannabinoid receptor levels in rat brain and mouse RAW 264.7 macrophages. J Neuroimmunol. 2006;181(1-2):82-92.CrossRefPubMedGoogle Scholar
  44. 44.
    Ashton JC, Rahman RM, Nair SM, et al. Cerebral hypoxia-ischemia and middle cerebral artery occlusion induce expression of the cannabinoid CB2 receptor in the brain. Neurosci Lett. 2007;412(2):114-117.CrossRefPubMedGoogle Scholar
  45. 45.
    Sagredo O, Gonzalez S, Aroyo I, et al. Cannabinoid CB2 receptor agonists protect the striatum against malonate toxicity: relevance for Huntington's disease. Glia. 2009;57(11):1154-1167.CrossRefPubMedPubMedCentralGoogle Scholar
  46. 46.
    Concannon RM, Okine BN, Finn DP, Dowd E. Upregulation of the cannabinoid CB2 receptor in environmental and viral inflammation-driven rat models of Parkinson's disease. Exp Neurol. 2016;283(Pt A):204-212.CrossRefPubMedGoogle Scholar
  47. 47.
    Benito C, Nunez E, Tolon RM, et al. Cannabinoid CB2 receptors and fatty acid amide hydrolase are selectively overexpressed in neuritic plaque-associated glia in Alzheimer's disease brains. J Neurosci. 2003;23(35):11136-11141.CrossRefPubMedGoogle Scholar
  48. 48.
    Benito C, Romero JP, Tolon RM, et al. Cannabinoid CB1 and CB2 receptors and fatty acid amide hydrolase are specific markers of plaque cell subtypes in human multiple sclerosis. J Neurosci. 2007;27(9):2396-2402.CrossRefPubMedGoogle Scholar
  49. 49.
    Yiangou Y, Facer P, Durrenberger P, et al. COX-2, CB2 and P2X7-immunoreactivities are increased in activated microglial cells/macrophages of multiple sclerosis and amyotrophic lateral sclerosis spinal cord. BMC Neurol. 2006;6:12.CrossRefPubMedPubMedCentralGoogle Scholar
  50. 50.
    Fernández-Ruiz J, González S, Romero J, Ja R. Cannabinoids in neurodegeneration and neuroprotection. R M, editor. Birkhaüser, Switzerland, 2005.Google Scholar
  51. 51.
    Stempel AV, Stumpf A, Zhang HY, et al. Cannabinoid type 2 receptors mediate a cell type-specific plasticity in the hippocampus. Neuron. 2016;90(4):795-809.CrossRefPubMedPubMedCentralGoogle Scholar
  52. 52.
    Zhang HY, Gao M, Liu QR, et al. Cannabinoid CB2 receptors modulate midbrain dopamine neuronal activity and dopamine-related behavior in mice. Proc Natl Acad Sci U S A. 2014;111(46):E5007-E5015.CrossRefPubMedPubMedCentralGoogle Scholar
  53. 53.
    Sierra S, Luquin N, Rico AJ, et al. Detection of cannabinoid receptors CB1 and CB2 within basal ganglia output neurons in macaques: changes following experimental parkinsonism. Brain Struct Funct 2015;220(5):2721-2738.CrossRefPubMedGoogle Scholar
  54. 54.
    Ortega-Gutierrez S, Molina-Holgado E, Arevalo-Martin A, et al. Activation of the endocannabinoid system as therapeutic approach in a murine model of multiple sclerosis. FASEB J. 2005;19(10):1338-1340.CrossRefPubMedGoogle Scholar
  55. 55.
    Docagne F, Muneton V, Clemente D, et al. Excitotoxicity in a chronic model of multiple sclerosis: Neuroprotective effects of cannabinoids through CB1 and CB2 receptor activation. Mol Cell Neurosci. 2007;34(4):551-561.CrossRefPubMedGoogle Scholar
  56. 56.
    Patel S, Rademacher DJ, Hillard CJ. Differential regulation of the endocannabinoids anandamide and 2-arachidonylglycerol within the limbic forebrain by dopamine receptor activity. J Pharmacol Exp Ther. 2003;306(3):880-888.CrossRefPubMedGoogle Scholar
  57. 57.
    Blandini F, Nappi G, Tassorelli C, Martignoni E. Functional changes of the basal ganglia circuitry in Parkinson's disease. Prog Neurobiol. 2000;62(1):63-88.CrossRefPubMedGoogle Scholar
  58. 58.
    Sarne Y, Mechoulam R. Cannabinoids: between neuroprotection and neurotoxicity. Curr Drug Targets CNS Neurol Disord. 2005;4(6):677-684.CrossRefPubMedGoogle Scholar
  59. 59.
    van der Stelt M, Di Marzo V. Cannabinoid receptors and their role in neuroprotection. Neuromol Med. 2005;7(1-2):37-50.CrossRefGoogle Scholar
  60. 60.
    Panikashvili D, Mechoulam R, Beni SM, Alexandrovich A, Shohami E. CB1 cannabinoid receptors are involved in neuroprotection via NF-kappa B inhibition. J Cereb Blood Flow Metab. 2005;25(4):477-484.CrossRefPubMedGoogle Scholar
  61. 61.
    Chen R, Zhang J, Wu Y, et al. Monoacylglycerol lipase is a therapeutic target for Alzheimer's disease. Cell Rep. 2012;2(5):1329-1339.CrossRefPubMedPubMedCentralGoogle Scholar
  62. 62.
    Di Marzo V, Hill MP, Bisogno T, Crossman AR, Brotchie JM. Enhanced levels of endogenous cannabinoids in the globus pallidus are associated with a reduction in movement in an animal model of Parkinson's disease. FASEB J. 2000;14(10):1432-1438.PubMedGoogle Scholar
  63. 63.
    van der Stelt M, Fox SH, Hill M, et al. A role for endocannabinoids in the generation of parkinsonism and levodopa-induced dyskinesia in MPTP-lesioned non-human primate models of Parkinson's disease. FASEB J. 2005;19(9):1140-1142.CrossRefPubMedGoogle Scholar
  64. 64.
    Aymerich MS, Rojo-Bustamante E, Molina C, et al. Neuroprotective effect of JZL184 in MPP(+)-treated SH-SY5Y cells through CB2 receptors. Mol Neurobiol 2016;53(4):2312-2319.CrossRefPubMedGoogle Scholar
  65. 65.
    Mounsey RB, Mustafa S, Robinson L, et al. Increasing levels of the endocannabinoid 2-AG is neuroprotective in the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine mouse model of Parkinson's disease. Exp Neurol. 2015;273:36-44.CrossRefPubMedPubMedCentralGoogle Scholar

Copyright information

© The American Society for Experimental NeuroTherapeutics, Inc. 2018

Authors and Affiliations

  1. 1.Instituto de NeurocienciasMiguel Hernández University-CSICAlicanteSpain
  2. 2.Red de Trastornos Adictivos, Instituto de Salud Carlos IIIMICINN and FEDERMadridSpain
  3. 3.Centro de Investigación Médica Aplicada, División de Neurociencias (CIMA-CIBERNED)Universidad de NavarraPamplonaSpain

Personalised recommendations