Advertisement

Fungal Diversity

, Volume 52, Issue 1, pp 197–207 | Cite as

Phylogeny of the industrial relevant, thermophilic genera Myceliophthora and Corynascus

  • Joost van den Brink
  • Robert A. Samson
  • Ferry Hagen
  • Teun Boekhout
  • Ronald P. de VriesEmail author
Open Access
Article

Abstract

Species of the genus Myceliophthora and its teleomorph Corynascus have attracted increasing interest due to their potential to produce thermostable enzymes. This study re-assessed the phylogenetic relationship of 49 isolates of nine species belonging to Myceliophthora and Corynascus. One species, M. vellerea, was shown not to belong to the genus Myceliophthora and should be placed in the genus Ctenomyces. The other species belonged to two phylogenetic clusters: mesophilic fungi with the type species M. lutea and C. sepedonium, and thermophilic fungi with M. thermophila, M. hinnulea and C. thermophilus. The phylogenetic data provides no clear separation of the two genera Corynascus and Myceliophthora. To avoid confusion in future taxonomic studies, it is proposed that all existing Corynascus species be renamed to Myceliophthora, which is the old name and the one more frequently used. Furthermore, this study identified two groups within the isolates listed as M. thermophila and assigned one group (five isolates) to M. heterothallica based on AFLP analysis and mating behavior. This study provides new insights into the genetic differences within the genus Myceliophthora and will therefore be essential for the interpretation of future genomic and physiological studies of these species.

Keywords

Myceliophthora Corynascus Thermophiles M. heterothallica M. thermophila Thermophilic fungi Multigene phylogeny AFLP analysis Mating behavior 

Introduction

Species of genus Myceliophthora and its teleomorph Corynascus have attracted increasing interest due to their potential to produce thermostable enzymes. For instance, laccases of M. thermophila (basionym: Sporotrichum thermophilum) were shown to be thermostable with high activity after expression in different expression hosts (Berka et al. 1997; Bulter et al. 2003; Babot et al. 2011). Due to the potential of Myceliophthora to degrade lignocellulolytic plant material, many (hemi-)cellulolytic enzymes of M. thermophila are characterized and patented (Bhat and Maheshwari 1987; Roy et al. 1990; Sadhukhan et al. 1992; Badhan et al. 2007; Beeson et al. 2011). The importance of this fungal group has recently been underlined by the sequencing of the genome of M. thermophila isolate ATCC42464 (genome.jgi-psf.org/Spoth1).

The first Myceliophthora species, M. lutea, was described by Constantin and Matruchot in 1894 as a pathogen causing the ‘vert de gris’ mat disease of cultured mushrooms (Costantin 1892). This species was classified before as a member of the genus Chrysosporium (Carmichael 1962), but there after von Arx re-introduced the genus Myceliophthora and its type species M. lutea (von Arx 1973). Initially, three species were assigned to this genus: M. fergusii, M. lutea, and M. thermophila (van Oorschot 1980). Another species, M. vellerea, was most likely wrongly described as a Myceliophthora species based on morphological differences (Sigler et al. 1998). A fourth species, M. hinnulea, was assigned to the genus Myceliophthora by Awao and Udagawa (1983). The type species of the ascomycete genus Corynascus, C. sepedonium, was described by Emmons (1932). This species was originally part of the genus Thielavia before von Arx introduced the genus Corynascus. This genus can be distinguished from Thielavia by the presence of ascospores with two germ pores, one at each end (von Arx 1973). At that time, the genus Corynascus contained the species C. sepedonium and C. novoguineensis (von Arx 1973 ). Currently, seven Corynascus species are described: C. heterothallicus, C. novoguineensis, C. sepedonium, C. sexualis, C. similis, C. thermophilus and C. verrucosus (von Klopotek 1974; Stchigel et al. 2000).

Of all the species of these two genera, M. thermophila is most commonly used for applied research (Roy et al. 1990; Berka et al. 1997; Rosgaard et al. 2006; Badhan et al. 2007; Beeson et al. 2011). Several isolates of M. thermophila can grow at temperatures up to 50°C on cellulose-rich material and can decompose complex substrates such as birch chips, wood pulp and wheat straw (Bhat and Maheshwari 1987). M. thermophila was initially classified in the genus Sporotrichum (Fergus and Sinden 1969) before it was assigned to the genus Chrysosporium as C. thermophilum in 1974 (von Klopotek). Two years later Klopotek described Thielavia heterothallica as the teleomorph of C. thermophilum (von Klopotek 1976). The current names of these teleomorphs and anamorphs are Corynascus heterothallica and Myceliophthora thermophila, respectively (van Oorschot 1977; von Arx et al. 1984). A similar re-designation occurred for C. thermophilus and M. fergusii (Sigler et al. 1998). While the other species of Myceliophthora and Corynascus were not matched for their teleomorphic or anamorphic counterparts.

Although species within Myceliophthora and Corynascus are morphologically well described, a study comprising their genetic differences has not yet been performed. Understanding the genetic diversity of these genera is essential for upcoming genomic and applied studies based on the availability of the M. thermophila genome sequence. Our study describes the phylogenetic relationships of 49 isolates belonging to the genera Myceliophthora and Corynascus and investigates in detail the genetic diversity of 11 M. thermophila isolates.

Materials and methods

Strains

All strains used in this study are listed in Table 1, and are available from the CBS-KNAW Fungal Biodiversity Centre, Utrecht, the Netherlands (www.cbs.knaw.nl).
Table 1

Myceliophthora and Corynascus isolates examined in this study. Type isolates are indicated with T

Original species name

Proposed species name

Accession no.

Source and remarks

GenBank no. ITS1

GenBank no. EF1A

GenBank no. RPB2

M. thermophila

M. thermophila

CBS 117.65T

Dry pasture soil, UK

HQ871764

HQ871705

HQ871803

CBS 173.70

Wheat straw compost, UK

HQ871765

HQ871706

HQ871804

CBS 381.97

Man, HIV pos. patient, unknown location

HQ871766

HQ871707

HQ871805

CBS 669.85

Unknown source; mutant of CBS 866.85

HQ871767

HQ871704

HQ871806

CBS 866.85

Unknown source

HQ871768

HQ871708

HQ871807

ATCC 42464

Unknown source

HQ871769

HQ871703

HQ871802

M. thermophila

M. heterothallica

CBS 131.65

Birch chips, Sweden

HQ871770

HQ871709

CBS 202.75

Garden soil, Germany; authentic strain of T. heterothallica

HQ871771

HQ871710

HQ871798

CBS 203.75

Soil, Indiana, USA; authentic strain of T.heterothallica

HQ871772

HQ871711

HQ871800

CBS 375.69

Woodpulp, New Brunswick, Canada

HQ871773

HQ871712

HQ871799

CBS 663.74

Soil under a baobab (Adansonia digitata), Senegal

HQ871774

HQ871713

HQ871801

M. lutea

M. lutea

CBS 145.77 T

Hay, UK

HQ871775

HQ871722

HQ871816

CBS 146.50

Mushroom bed, Delaware, USA

HQ871776

HQ871724

HQ871818

CBS 146.77

Barley (Hordeum vulgare), Ireland

HQ871777

HQ871725

HQ871819

CBS 147.50

Mushroom bed, Pennsylvania, USA

HQ871778

HQ871726

HQ871820

CBS 147.77

Dust in stable, UK

HQ871779

HQ871728

HQ871821

CBS 157.51

Mushroom bed, Netherlands

HQ871780

HQ871730

HQ871817

CBS 157.59

Air in pigsty, Netherlands

HQ871781

HQ871729

HQ871822

CBS 227.67

Mushroom bed, Netherlands

HQ871782

HQ871721

HQ871823

CBS 243.75A

Air, Uttar Pradesh, India

HQ871783

HQ871723

HQ871824

CBS 243.75B

Air, Uttar Pradesh, India

HQ871784

HQ871720

HQ871826

CBS 379.76

Usar soil, Uttar Pradesh, India

HQ871785

HQ871727

HQ871825

M. hinnulea

M. hinnulea

CBS 539.82

Soil from cultivated garden, New Zealand

HQ871786

HQ871714

HQ871808

CBS 540.82

Soil under Monterey Pine (Pinus radiata), New Zealand

HQ871787

HQ871716

HQ871809

CBS 541.82

Sun-exposed garden soil, New Zealand

HQ871788

HQ871715

HQ871810

CBS 542.82

Sun-exposed garden soil, New Zealand

HQ871789

HQ871717

HQ871811

CBS 544.82

Soil, New Zealand

HQ871790

HQ871718

HQ871812

CBS 597.83 T

Cultivated soil, Japan

HQ871791

HQ871719

HQ871813

M. vellerea

Ctenomyces vellerea

CBS 478.76

Unknown source, Egypt

HQ871796

HQ871748

CBS 479.76

Unknown source, Egypt

HQ871797

HQ871749

HQ871840

CBS 715.84

Soil, Alberta, Canada; ex-type of C. asperatum

HQ871795

HQ871747

HQ871841

C. thermophilus

M. fergusii

CBS 174.70

Wheat straw compost, UK

HQ871792

CBS 405.69

Mushroom compost, Pennsylvania, USA; MT +

HQ871793

HQ871731

HQ871814

CBS 406.69 T

Mushroom compost, Pennsylvania, USA; MT −

HQ871794

HQ871732

HQ871815

C. sepedonium

M. sepedonium

CBS 111.69 T

Soil, Uttar Pradesh, India; ex-type of T. sepedonium

HQ871751

HQ871734

HQ871827

CBS 213.74

Sandy soil, Senegal

HQ871752

HQ871736

HQ871828

CBS 223.81

Desert soil, Kuwait

HQ871753

HQ871737

HQ871831

CBS 294.56

Buried cable in soil, Netherlands

HQ871754

HQ871738

HQ871832

CBS 340.33

Unknown source

HQ871755

HQ871739

HQ871829

CBS 412.52

Soil, Argentina

HQ871740

HQ871833

CBS 415.48

Cotton rope, Uttar Pradesh, India

HQ871756

HQ871741

HQ871834

CBS 434.96

Soil, Delhi, India

HQ871760

CBS 435.96

Soil, Singapore

HQ871761

HQ871745

CBS 438.96

Soil, Uttar Pradesh, India

HQ871757

HQ871742

HQ871835

CBS 440.51

Soil, UK

HQ871758

HQ871743

HQ871836

CBS 632.67

Unknown source, Russia; ex-type of Thielavia lutescens

HQ871759

HQ871744

HQ871830

CBS 114383

Barley (Hordeum vulgare), Iran

HQ871750

HQ871735

HQ871837

C. novoguineensis

M. novoguineensis

CBS 359.72

Soil, Papua New Guinea

HQ871762

HQ871733

HQ871838

Corynascella inaequalis

CBS 284.82

Soil, Tarragona, Spain

HQ871763

HQ871746

HQ871839

DNA extraction, sequencing analysis, and AFLP

Fungal genomic DNA was isolated using the FastDNA® Kit (Bio 101, Carlsbad, USA) according to the manufacturer’s instructions. Amplification and sequencing of the ITS region (including internal transcribed spacer regions 1 and 2, and the 5.8S rRNA regions of the nuclear ribosomal RNA gene cluster), and parts of the elongation factor EF1A and the subunit of RNA polymerase II RPB2 genes were performed as described by Houbraken et al. (2007). Fragments containing the ITS region were amplified using primers V9G (TTACGTCCCTGCCCTTTGTA) and RLR3R (GGTCCGTGTTTCAAGAC). Fragments containing the EF1A region were amplified using forward primer GCCCCCGGCCATCGTGACTTCAT and reverse primer ATGACACCGACAGCGACGGTCTG. Fragments containing the RPB2 region were amplified using forward primer GACGACCGTGATCACTTTGG and reverse primer CCCATGGCCTGTTTGCCCAT. Contigs were assembled from the forward and reverse sequences using SeqMan from the Lasergene package (DNASTAR Inc., Madison, WI). The alignments of the sequence datasets using Clustal W and phylogenetic analysis were performed in MEGA version 4 (Tamura et al. 2007). Maximum parsimony analysis was performed for all datasets using the heuristic search option. The robustness of the most parsimonious trees was evaluated with 1000 bootstrap replications (Hillis and Bull 1993). Sequences of Saccharomyces cerevisiae S228C were used as outgroup in the analyses of all used loci. Newly generated sequences were deposited in GenBank with accession numbers HQ871703–HQ871841 (Table 1). The generated alignments and the most parsimonious trees were deposited in TreeBase under accession number 11154 (http://purl.org/phylo/treebase/phylows/study/TB2:S11154).

The genotype of each isolate listed as M. thermophila was determined using AFLP fingerprint analysis, as described previously by Boekhout et al. (2001).

Mating experiment

The mating experiment was performed on two media: Malt Extract Agar (MEA) and Oatmeal Agar (OA) medium (Samson et al. 2010). A small agar plug containing mycelium (1 mm diameter) from the edge of a vigorously growing 1-day-old colony on MEA medium was transferred to the Petri dishes with OA or MEA media. The initial combination of isolates CBS202.75 and CBS203.75 with one of the nine other M. thermophila isolates were incubated in the dark at 35°C (von Klopotek 1974). The combination of isolates CBS117.65, CBS173.70, CBS381.97, CBS669.85, CBS866.85 and ATCC42464 were incubated in the dark at 30°C, 35°C, 40°C or 45°C. The mating experiment was conducted twice for each combination of isolates.

Results

Phylogeny of genera Corynascus and Myceliophthora

Forty-nine isolates of the genera Myceliophthora and Corynascus were phylogenetically investigated by comparison of sequences (Table 1) of five genomic loci, namely the internal transcribed spacer 1 (ITS1), part of elongation factor EF1A, part of the RNA polymerase subunit RBP2, the D1/D2 locus of large ribosomal subunit and part of ß-tubulin (TUBB). Unfortunately, the sequences of the D1/D2 locus did not have enough variation to perform a phylogenetic analysis. In addition, part of the ß-tubulin locus of M. lutea was duplicated on the genome resulting in unclear sequences. Therefore, these two loci were eliminated from the comparison. The constructed phylogenetic trees of the remaining three loci were the results of a bootstrap consensus by maximum parsimony.

The phylogenies obtained from the three loci, ITS1, EF1A and RBP2, gave a clear clustering of the isolates of each species (Figs. 1, 2 and 3). Except for M. vellerea, the isolates of Corynascus and Myceliophthora clustered together and showed a close relation to other isolates of the family Chaetomiaceae (e.g. Chaetomium globosum, Corynascella inaequalis and Thielavia terrestris). Based on the large differences of the ITS1, EF1A and RPB2 sequences of M. vellerea when compared to those of the Corynascus and other Myceliophthora species, it is clear that M. vellerea has been wrongly placed within the genus Myceliophthora. The ITS1 region of M. vellerea was highly similar to Ctenomyces serratus (661 of 678 nucleotides identical), suggesting that this species should be placed in the genus Ctenomyces.
Fig. 1

Parsimonious consensus tree of the analysed ITS1 region of Myceliophthora sp. and Corynascus sp. (134 of the 389 nucleotides were parsimony informative). The percentage of replicate trees, in which the associated taxa clustered together in the bootstrap test (1000 replicates), are shown next to the branches. All positions containing gaps and missing data were eliminated from the dataset

Fig. 2

Parsimonious consensus tree of the analysed elongation factor EF1A gene sequences of Myceliophthora sp. and Corynascus sp. (136 of the 654 nucleotides were parsimony informative). The percentage of replicate trees, in which the associated taxa clustered together in the bootstrap test (1000 replicates), are shown next to the branches. All positions containing gaps and missing data were eliminated from the dataset

Fig. 3

Parsimonious consensus tree of the analysed partial RPB2 gene sequences of Myceliophthora sp. and Corynascus sp. (257 of the 611 nucleotides were parsimony informative). The percentage of replicate trees, in which the associated taxa clustered together in the bootstrap test (1000 replicates), are shown next to the branches. All positions containing gaps and missing data were eliminated from the dataset

The C. sepedonium isolates and related Corynascus species clustered together in all phylogenies. Only 1 of 456 nucleotides of the ITS1 sequences within this Corynascus cluster was found to be parsimony informative. The phylogenies of all three loci showed that M. lutea was the closest related species to C. sepedonium and related Corynascus species. Their close relation was represented by the ITS1 sequences of C. sepedonium and M. lutea, where only three nucleotides were parsimony informative.

The isolates of the thermophilic species M. hinnulea and M. thermophila were closely related in all phylogenies. The ITS1 sequences of M. hinnulea and M. thermophila had 12 of 456 parsimony informative nucleotides. Both species clustered with the thermophilic species C. thermophilus in the trees of ITS1 and RPB2. Thirty-two of 456 nucleotides of the ITS1 sequences within this cluster of the three thermophilic fungi were found to be parsimony informative. However, in the EF1A tree, C. thermophilus clustered separately from all other Corynascus and Myceliophthora isolates.

Genetic diversity within the thermophilic Myceliophthora thermophila

The 11 isolates listed as M. thermophila consistently clustered in two groups at all phylogenies (Figs. 1, 2 and 3). This variation between the isolates is also reflected by the relatively high amount of informative sites at the three loci (e.g. 12 informative sites of 456 nucleotides of the ITS1 loci; 2.6%). In comparison, this variation was similar to the sequence variation between the species M. hinnulea and M. thermophila. The group of 11 isolates of M. thermophila clustered into two main groups with the exception of M. thermophila CBS663.74. This latter isolate was placed between the two groups of M. thermophila in the ITS1 and EF1A trees, but grouped with CBS131.65, CBS202.75, CBS203.75 and CBS375.69 in the RPB2 tree.

The genetic variation within M. thermophila was further investigated by Amplified Fragment Length Polymorphism (AFLP). The banding patterns of the 11 M. thermophila isolates confirmed the clustering in two groups (Fig. 4). The sequence data and AFLP analysis placed CBS117.65, CBS173.70, CBS381.97, CBS669.85, CBS866.85 and ATCC42464 in one group, while CBS131.65, CBS202.75, CBS203.75 and CBS375.69 were placed in a second group. The AFLP banding pattern of CBS663.74 did not fit with either of the groups, thus confirming the results of the phylogenies of ITS1 and EF1A (Figs. 1 and 2) in which CBS663.74 occurred outside both groups of M. thermophila.
Fig. 4

Clustering of AFLP banding patterns of Myceliophthora thermophila isolates. Similarity of the banding patterns is given in percentage

Mating types of Myceliophthora thermophila isolates

The mating behavior of each M. thermophila isolate was studied by crossing the two mating types CBS202.75 and CBS203.75 with each of the nine other M. thermophila isolates. After 3 weeks, all plates had ascomata containing dark brown ascospores at the contact zone between CBS202.75 and CBS203.75 (Fig. 5e–g). The dark colored ascomata were produced in the agar media and were only visible at the reverse of plates (Fig. 5a–d). The mating experiment showed that CBS202.75 and CBS663.74 had the same mating type, while CBS203.75, CBS131.65, and CBS375.69 had the opposite mating type (Table 2). These isolates all belong to one of the M. thermophila groups based on the phylogenies described above. The remaining six M. thermophila isolates, belonged to the other phylogenetic group, and did not produce fruiting bodies at the contact zone with CBS202.75 or CBS203.75. Moreover, when combined with each other on oatmeal agar plates, isolates CBS117.65, CBS173.70, CBS381.97, CBS669.85, CBS866.85 and ATCC42464 were not able to produce fruiting bodies after 4 weeks at 30°C, 35°C, 40°C or 45°C.
Fig. 5

Plates with different Myceliophthora thermophila isolates and microscope pictures of the formed ascoma. Figure a and b are, respectively, the reverse and obverse of a plate depicting the mating between M. thermophila CBS375.69 & CBS202.75 and CBS202.75 & CBS203.75. Figure c and d are, respectively, the reverse and obverse of a plate depicting the mating between M. thermophila CBS663.74 & CBS203.75, and CBS202.75 & CBS203.75. Formed ascoma in figure a and c are indicated with an arrow. Figure e, f and g are microscope pictures of the produced ascoma and ascospores, respectively, ×100, ×400 and × 1000

Table 2

Mating types of Myceliophthora thermophila

Accession no.

Mating type (+, −, absent)

CBS202.75

MT +

CBS663.74

MT +

CBS131.65

MT −

CBS203.75

MT −

CBS375.69

MT −

CBS117.65

absent

CBS173.70

absent

CBS381.97

absent

CBS669.85

absent

CBS866.85

absent

ATCC42464

absent

Discussion

Myceliophthora: a single name for species hitherto classified in Corynascus and Myceliophthora

The molecular phylogeny of Myceliophthora and Corynascus gave new insights into the taxonomic relationships between these two genera. Firstly, the ITS1 sequences of CBS478.76, CBS479.76 and CBS715.84 confirmed that M. vellerea does not belong to Myceliophthora and should be classified as Ctenomyces serratus. This was already suggested based on morphological characteristics (Guarro et al. 1985).

Another observation was the sequence similarity of many Corynascus species. Although morphological differences have been observed, the ITS1 sequence of C. sepedonium, C. sexualis, C. similis, C. novoguineensis and C. verrucosus were more than 99.5% similar. This contrast between morphology and ITS1 phylogeny for Corynascus species has already been reported before (Stchigel et al. 2000). The EF1A and RPB2 sequences of C. sepedonium and C. novoguineensis showed more diversity and might justify the current classification within Corynascus. This shows that analysis of multiple loci (Samson et al. 2007) is useful, especially in the phylogenetic characterization of Corynascus species.

The isolates of C. sepedonium and M. lutea are closely related based on all generated phylogenies. Another common feature of C. sepedonium and M. lutea is their optimal growth temperature. The isolates of these species prefer to grow below 40°C, while the thermophilic Corynascus and Myceliophthora species have an optimal growth around 45°C (tested on malt extract agar plates, Supplemental data 1). These results show that fungi within the genera Corynascus and Myceliophthora can be split into two clusters: i.e., a mesophilic and a thermophilic cluster.

A clear separation of the two genera Corynascus and Myceliophthora is, however, not apparent from the phylogenetic data. Some species of the genus Corynascus have been the associated teleomorph of the anamorphic species classified within Myceliophthora (van Oorschot 1980). However, most species have unknown teleomorphs or anamorphs and the phylogenetic data in our study did not clarify this issue. CBS440.51 for instance has been described as an anamorph of C. sepedonium (van Oorschot 1980). No differences were observed in the sequence data between the anamorphs and teleomorphs of C. sepedonium. The dual name for this single taxon of species belonging to Myceliophthora and Corynascus should be used carefully. The issue of a single scientific name for fungal species has been increasingly raised, especially since genetic studies have become common practice (Rossman and Samuels 2005; Shenoy et al. 2007; Samson and Varga 2009; Hawksworth 2011). Given that the genus name Myceliophthora was described in 1894 and Myceliophthora is a common name in publications, we propose to name all Corynascus species as Myceliophthora. This forms no obstacle for most species of Corynascus as their species name is unique for the genus Myceliophthora. Only Corynascus thermophilus should be renamed under its old anamorph name M. fergusii (van Oorschot 1977). For C. thermophilus, C. novoguineensis, C. sepedonium, C. sexualis, C. similis, and C. verrucosus the formal new combinations are listed at the end of the manuscript.

Genetic diversity and mating behavior set M. heterothallica apart from M. thermophila

The collection of the CBS-KNAW Fungal Biodiversity Centre contains ten isolates listed as M. thermophila (basionym: Sporotrichum thermophilum). The phylogenetic data revealed clear differences between the isolates and divided these isolates in two groups. One group contained the type isolate of M. thermophila and the strain ATCC42464, whose full genomic sequence is available. The other group consisted of five isolates including strains CBS202.75 and CBS203.75, which are authentic isolates of Thielavia heterothallica (von Klopotek 1976). Isolates of this later group can mate with each other and their mating types were identified. In light of the phylogenetic and biological species concept, we suggest that this teleomorph group will be named Myceliophthora heterothallica. For Thielavia heterothallica the formal new combination to the Myceliophthora is listed at the end of the manuscript.

According to the sequence data and AFLP analysis, CBS663.74 was different from the other isolates belonging to the M. thermophila and M. heterothallica group at the genetic level. This strain was also the only one obtained from the African continent, where it was isolated from soil under a baobab tree in Senegal. Nevertheless, the genetic differences did not prevent mating of CBS663.74 with other M. heterothallica isolates, suggesting that this isolate fits within the M. heterothallica group.

Fungi of the genus Myceliophthora, especially M. thermophila, are of industrial interest due to their potential to produce thermophilic enzymes (Bhat and Maheshwari 1987; Roy et al. 1990; Sadhukhan et al. 1992; Badhan et al. 2007; Beeson et al. 2011). This study described the genetic diversity amongst different Myceliophthora isolates and divided M. thermophila isolates in two species M. thermophila and M. heterothallica. From the applied point of view, it will be of interest to investigate the physiological differences between both thermophilic fungi.

Myceliophthora Costantin 1892, in Cr Hebd Séanc Acad Sci Paris 114; 849–851

Myceliophthora lutea Costantin 1892 (MB232833)—Type species
  • Synonym: Scopulariopsis lutea (Costantin) Tubaki 1955 (MB305672)

  • Synonym: Chrysosporium luteum (Costantin) J.W. Carmich. 1962 (MB328210)

  • Synonym: Sporotrichum carthusioviride J.N. Rai & Mukerji 1962 (MB339566)

Myceliophthora hinnulea Awao and Udagawa 1983 (MB109090)

Myceliophthora thermophila (Apinis) Oorschot 1977 (MB317955)
  • Basionym: Sporotrichum thermophilum Apinis 1963 (MB344529)

  • Synonym: Chrysosporium thermophilum (Apinis) Klopotek 1974 (MB311112)

Myceliophthora heterothallica (von Klopotek) van den Brink & Samson, comb. nov. (MB 519538)
  • Basionym: Thielavia heterothallica von Klopotek 1976 (MB324556)

  • Synonym: Corynascus heterothallicus (von Klopotek) von Arx, Dreyfuss & Müller 1984 (MB107879)

Myceliophthora fergusii (Klopotek) van Oorschot 1977 (MB317954)
  • Synonym: Thielavia thermophila Fergus and Sinden 1969 (MB340061)

  • Synonym: Corynascus thermophilus (Fergus & Sinden) Klopotek 1974 (MB312215)

  • Synonym: Chaetomidium thermophilum (Fergus & Sinden) Lodha 1978 (MB310883)

Myceliophthora sepedonium (C.W. Emmons) van den Brink & Samson, comb. nov. (MB561525)
  • Basionym: Thielavia sepedonium C.W. Emmons 1932 (MB277883)

  • Synonym: Corynascus sepedonium (C.W. Emmons) von Arx 1973 (MB312213)

  • Synonym: Chaetomidium sepedonium (C.W. Emmons) Lodha 1978 (MB310880)

  • Synonym: Thielavia sepedonium var. minor Mehrotra & Bhattacharjee 1966 (MB353893)

Myceliophthora novoguineensis (Udagawa & Y. Horie) van den Brink & Samson, comb. nov. (MB561526)
  • Basionym: Corynascus novoguineensis (Udagawa & Y. Horie) von Arx 1973 (MB312212)

Myceliophthora sexualis (Stchigel, Cano & Guarro) van den Brink & Samson, comb. nov. (MB561527)
  • Basionym: Corynascus sexualis Stchigel, Cano & Guarro 2000 (MB467480)

Myceliophthora similis (Stchigel, Cano & Guarro) van den Brink & Samson, comb. nov. (MB561528)
  • Basionym: Corynascus similis Stchigel, Cano & Guarro 2000 (MB467481)

Myceliophthora verrucosa (Stchigel, Cano & Guarro) van den Brink & Samson, comb. nov. (MB561529)
  • Basionym: Corynascus verrucosus Stchigel, Cano & Guarro 2000 (MB467482)

Notes

Acknowledgements

This work has been supported by the EC 7th Framework program (NEMO, Project Grant agreement 222699).

Open Access

This article is distributed under the terms of the Creative Commons Attribution Noncommercial License which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited.

Supplementary material

13225_2011_107_MOESM1_ESM.pdf (2.9 mb)
ESM 1 (PDF 2966 kb)

References

  1. Awao T, Udagawa SI (1983) A new thermophilic species of Myceliophthora. Mycotaxon 16:436–441Google Scholar
  2. Babot ED, Rico A, Rencoret J, Kalum L, Lund H, Romero J, Del Río JC, Martínez AT, Gutiérrez A (2011) Towards industrially-feasible delignification and pitch removal by treating paper pulp with Myceliophthora thermophila laccase and a phenolic mediator. Bioresour Technol. doi: 10.1016/j.biortech.2011.03.100 [Epub ahead of print]Google Scholar
  3. Badhan AK, Chadha BS, Kaur J, Saini HS, Bhat MK (2007) Production of multiple xylanolytic and cellulolytic enzymes by thermophilic fungus Myceliophthora sp. IMI 387099. Bioresour Technol 98:504–510PubMedCrossRefGoogle Scholar
  4. Beeson WT 4th, Iavarone AT, Hausmann CD, Cate JH, Marletta MA (2011) Extracellular aldonolactonase from Myceliophthora thermophila. Appl Environ Microbiol. doi: 10.1128/AEM.01922-10 [Epub ahead of print]PubMedGoogle Scholar
  5. Berka RM, Schneider P, Golightly EJ, Brown SH, Madden M, Brown KM, Halkier T, Mondorf K, Xu F (1997) Characterization of the gene encoding an extracellular laccase of Myceliophthora thermophila and analysis of the recombinant enzyme expressed in Aspergillus oryzae. Appl Environ Microbiol 63:3151–3157PubMedGoogle Scholar
  6. Bhat KM, Maheshwari R (1987) Sporotrichum thermophile Growth, Cellulose Degradation, and Cellulase Activity. Appl Environ Microbiol 53:2175–2182PubMedGoogle Scholar
  7. Boekhout T, Theelen B, Diaz M, Fell JW, Hop WC, Abeln EC, Dromer F, Meyer W (2001) Hybrid genotypes in the pathogenic yeast Cryptococcus neoformans. Microbiology 147:891–907PubMedGoogle Scholar
  8. Bulter T, Alcalde M, Sieber V, Meinhold P, Schlachtbauer C, Arnold FH (2003) Functional expression of a fungal laccase in Saccharomyces cerevisiae by directed evolution. Appl Environ Microbiol 69:987–995PubMedCrossRefGoogle Scholar
  9. Carmichael JW (1962) Chrysosporium and some other aleurosporic hyphomycetes. Canadian Journal of Botany 40:1137–1175CrossRefGoogle Scholar
  10. Costantin J (1892) Sur quelques maladies du blanc de champignons. Cr Hebd Séanc Acad Sci Paris 114:849–851Google Scholar
  11. Emmons CW (1932) The development of the ascocarp in two species of Thielavia. Bull Torrey Bot Club 59:415–422CrossRefGoogle Scholar
  12. Fergus CL, Sinden JW (1969) A new thermophilic fungus from mushroom compost: Thielavia thermophila spec. nov. Canadian Journal of Botany 47:1635–1637CrossRefGoogle Scholar
  13. Guarro J, Punsola L, Cano J (1985) Myceliophthora vellerea (Chrysosporium asperatum) anamorph of Ctenomyces serratus. Mycotaxon 23:419–427Google Scholar
  14. Hawksworth DL (2011) Naming Aspergillus species: progress towards one name for each species. Med Mycol 49 (Suppl 1): S70–76Google Scholar
  15. Hillis DM, Bull JJ (1993) An empirical test of bootstrapping as a method for assessing confidence in phylogenetic analysis. Systematic Biology 42:182–192Google Scholar
  16. Houbraken J, Due M, Varga J, Meijer M, Frisvad JC, Samson RA (2007) Polyphasic taxonomy of Aspergillus section Usti. Stud Mycol 59:107–128PubMedCrossRefGoogle Scholar
  17. Rosgaard L, Pedersen S, Cherry JR, Harris P, Meyer AS (2006) Efficiency of new fungal cellulase systems in boosting enzymatic degradation of barley straw lignocellulose. Biotechnol Prog 22:493–498PubMedCrossRefGoogle Scholar
  18. Rossman AY, Samuels GJ (2005) Towards a single scientific name for species of fungi. Inoculum 56:3–6Google Scholar
  19. Roy SK, Dey SK, Raha SK, Chakrabarty SL (1990) Purification and properties of an extracellular endoglucanase from Myceliophthora thermophila D-14 (ATCC 48104). J Gen Microbiol 136:1967–1971PubMedGoogle Scholar
  20. Sadhukhan R, Roy SK, Raha SK, Manna S, Chakrabarty SL (1992) Induction and regulation of alpha-amylase synthesis in a cellulolytic thermophilic fungus Myceliophthora thermophila D14 (ATCC 48104). Indian J Exp Biol 30:482–486PubMedGoogle Scholar
  21. Samson RA, Varga J (2009) What is a species in Aspergillus? Med Mycol 47(Suppl 1):S13–S20PubMedCrossRefGoogle Scholar
  22. Samson RA, Varga J, Witiak SM, Geiser DM (2007) The species concept in Aspergillus: recommendations of an international panel. Stud Mycol 59:71–73PubMedCrossRefGoogle Scholar
  23. Samson RA, Houbraken J, Thrane U, Frisvad JC, Andersen B (2010) Food and Indoor Fungi. CBS Fungal Biodiversity Centre, Utrecht, NetherlandsGoogle Scholar
  24. Shenoy BD, Jeewon R, Hyde KD (2007) Impact of DNA sequence-data on the taxonomy of anamorphic fungi. Fungal Diversity 26:1–54Google Scholar
  25. Sigler L, Aneja KR, Kumar R, Maheshwari R, Shukla RV (1998) New records from India and redescription of Corynascus thermophilus and its anamorph Myceliophthora thermophila. Mycotaxon 68:185–192Google Scholar
  26. Stchigel AM, Sagues M, Cano J, Guarro J (2000) Three new thermotolerant species of Corynascus from soil, with a key to the known species. Mycol Res 104:879–887CrossRefGoogle Scholar
  27. Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 24:1596–1599PubMedCrossRefGoogle Scholar
  28. van Oorschot CAN (1977) The genus Myceliophthora. Persoonia 9:404–409Google Scholar
  29. van Oorschot CAN (1980) A revision of Chrysosporium and allied genera. Stud Mycol 20:1–89Google Scholar
  30. von Arx JA (1973) Further observations on Sporotrichum and some similar fungi. Persoonia 7:127–131Google Scholar
  31. von Arx JA, Dreyfuss M, Müller E (1984) A revaluation of Chaetomium and the Chaetomiaceae. Persoonia 12:169–179Google Scholar
  32. von Klopotek A (1974) Revision of thermophilic Sporotrichum species: Chrysosporium thermophilum (Apinis) comb. nov. and Chrysosporium fergusii spec. nov. equal status conidialis of Corynascus thermophilus Fergus and (Sinden) comb. nov. Arch Microbiol 98:365–369CrossRefGoogle Scholar
  33. von Klopotek A (1976) Thielavia heterothallica spec. nov., die perfekte Form von Chrysosporium thermophilum. Arch Microbiol 107:223CrossRefGoogle Scholar

Copyright information

© The Author(s) 2011

Authors and Affiliations

  • Joost van den Brink
    • 1
  • Robert A. Samson
    • 1
  • Ferry Hagen
    • 1
  • Teun Boekhout
    • 1
  • Ronald P. de Vries
    • 1
    Email author
  1. 1.CBS-KNAW Fungal Biodiversity CentreUtrechtThe Netherlands

Personalised recommendations