Advertisement

Conservation Genetics Resources

, Volume 11, Issue 3, pp 365–368 | Cite as

Microsatellite records for volume 11, issue 3

  • Pengfei Hu
  • Hao-Xiang Liu
  • Ying Pan
  • Yan-Fu Qu
  • Xueqi Tian
  • Ke-Xin Wang
  • Yu-Heng Wei
  • Xue-Ping Wu
  • Xiumei Xing
  • Zhengyi Zhang
  • Pei Zhao
  • Yu-Tian Zhao
  • Yu-Chen Zheng
  • Jin Zhou
Microsatellite Records
  • 7 Downloads

Species

Locus

Primer sequence (5′–3′)

Repeat motif

Size range (bp)

Sample size (N)

Number of alleles (NA)

Ho (He)

Cervus nippon

1a

F:GCCTAAAACCTGTGCTCTGC

R:AGGATTCTTGCTTTGCCTGA

(AAAT)5

247–272

384

10

0.456 (0.664)

Cervus nippon

2a

F:CAGTGAAAAGAATACCCTGAAATG

R:AAGGGTTGAGGGACATAGGG

(AAAT)5

248–276

384

8

0.429 (0.656)

Cervus nippon

6a

F:TCTTGCTTCCTTTCTTCCCA

R:GAGGGAGGAAAGACCTCACC

(TTTG)5

223–237

384

8

0.391 (0.566)

Cervus nippon

8a

F:TTTGCCTCAGTGTCTTCCCT

R:AGCTGTGGTTGTGGTAGCAG

(AAAC)5

217–230

384

12

0.432* (0.806)

Cervus nippon

11a

F:AAACAACCATATGCAAGCCC

R:CTGCTGAGAAAGCGTGTCCT

(AAAT)5

240–271

384

25

0.348 (0.576)

Cervus nippon

18a

F:AGTCCATCCCTCTGAAGCCT

R:CTCTGCACAGGCAATCACAT

(CAAA)6

168–181

384

33

0.467* (0.888)

Cervus nippon

19a

F:TGCTTCCTGAGCAGTCAAAA

R:GGATGCGTGAAGAGTCACAA

(AAAT)7

220–292

384

24

0.347* (0.811)

Cervus nippon

22a

F:AAGTTCAGTTGGTGGCTTGG

R:AGAATGCAAGGGAAGTGGTG

(AAAC)6

254–272

384

17

0.765 (0.833)

Cervus nippon

23a

F:CCTTTGCTCCATCAGAGCTT

R:GGCAGGCAAATGGGTTACTA

(TCTT)6

250–281...

Notes

Supplementary material

12686_2019_1108_MOESM1_ESM.zip (33 kb)
Supplementary material 1 (ZIP 33 kb)
12686_2019_1108_MOESM2_ESM.zip (30 kb)
Supplementary material 2 (ZIP 30 kb)
12686_2019_1108_MOESM3_ESM.zip (20 kb)
Supplementary material 3 (ZIP 21 kb)

Copyright information

© Springer Nature B.V. 2019

Authors and Affiliations

  • Pengfei Hu
  • Hao-Xiang Liu
  • Ying Pan
  • Yan-Fu Qu
  • Xueqi Tian
  • Ke-Xin Wang
  • Yu-Heng Wei
  • Xue-Ping Wu
  • Xiumei Xing
  • Zhengyi Zhang
  • Pei Zhao
  • Yu-Tian Zhao
  • Yu-Chen Zheng
  • Jin Zhou

There are no affiliations available

Personalised recommendations