Advertisement

Conservation Genetics Resources

, Volume 7, Issue 4, pp 917–944 | Cite as

Microsatellite records for volume 7, issue 4

  • Benoit Goossens
Microsatellite Records

Species

Locus

Primer sequence (5′–3′)

Repeat motif

Size range (bp)

Sample size (N)

Number of alleles (NA)

Ho (He)

Hemifusus tuba (Gmelin)

HT001a

F: CTGGACATTGCTGAGGAA

R: GCGGGTATGAATCGAGAT

(CAAT)8(TC)27

342–360

60

2

0.0667 (0.0655)

 

HT002a

F: ATTGGACTTCTTCGGCATAGCG

R: AATGAGACGACGGCAGACTTTG

(GA)32

345–400

62

3

0.2333 (0.2164)

 

HT005a

F: CCCAGCACAACAAACGACAGA

R: TTCACCGTCACATCAACTTCCCT

(GT)19(TG)16(TG)10(TC)7(TC)9(TC)9(TC)16

144–260

58

8

0.7500 (0.7883)

 

HT007a

F: TTCCTGTATTTCTGCCTCT

R: TGTCTTCTTACTGCCATTTC

(AG)43(TG)4(TG)4

224–240

54

4

0.1852 (0.5304)

 

HT009a

F: GGGTACATAAGGCTCGTTCA

R: TTCTCGGACTTCGGTTTCTT

(AG)62(AG)4 (AG)7(GA)4(GA)8(GA)14(AG)7

194–220

58

6

0.3571 (0.5552)

 

HT012a

F: CAACTTCTGTAGCCTGTAATG

R: GGGGAAAACCTAACCACT

(CT)5(TC)20(TC)29

246–260

62

2

0.0667 (0.1831)

 

HT015a

F: CGTGCATGTCGTGATAAGTCGG

R: CTCAATCTCCAAGCAGAGTTGTCG

(TC)12(CT)17(TC)28

288–308

56

7

0.4483 (0.6999)

 

HT016a

F: CGTATTCGGCGGCAATCA

R: GCCAGGGTTTTCCCAGTCA

(GA)6(AG)8(AG)29

284–300

52

5

1.0000 (0.6101)

 

Supplementary material

12686_2015_493_MOESM1_ESM.docx (19 kb)
Supplementary material 1 (DOCX 19 kb)
12686_2015_493_MOESM2_ESM.docx (24 kb)
Supplementary material 2 (DOCX 24 kb)
12686_2015_493_MOESM3_ESM.docx (20 kb)
Supplementary material 3 (DOCX 19 kb)
12686_2015_493_MOESM4_ESM.docx (22 kb)
Supplementary material 4 (DOCX 21 kb)
12686_2015_493_MOESM5_ESM.docx (23 kb)
Supplementary material 5 (DOCX 22 kb)
12686_2015_493_MOESM6_ESM.docx (18 kb)
Supplementary material 6 (DOCX 18 kb)
12686_2015_493_MOESM7_ESM.docx (20 kb)
Supplementary material 7 (DOCX 20 kb)
12686_2015_493_MOESM8_ESM.docx (21 kb)
Supplementary material 8 (DOCX 21 kb)
12686_2015_493_MOESM9_ESM.docx (19 kb)
Supplementary material 9 (DOCX 18 kb)
12686_2015_493_MOESM10_ESM.docx (18 kb)
Supplementary material 10 (DOCX 18 kb)
12686_2015_493_MOESM11_ESM.docx (16 kb)
Supplementary material 11 (DOCX 16 kb)
12686_2015_493_MOESM12_ESM.docx (17 kb)
Supplementary material 12 (DOCX 17 kb)
12686_2015_493_MOESM13_ESM.docx (18 kb)
Supplementary material 13 (DOCX 17 kb)
12686_2015_493_MOESM14_ESM.docx (18 kb)
Supplementary material 14 (DOCX 17 kb)
12686_2015_493_MOESM15_ESM.docx (18 kb)
Supplementary material 15 (DOCX 17 kb)
12686_2015_493_MOESM16_ESM.docx (20 kb)
Supplementary material 16 (DOCX 19 kb)

Copyright information

© Springer Science+Business Media Dordrecht 2015

Authors and Affiliations

  • Benoit Goossens

There are no affiliations available

Personalised recommendations