Conservation Genetics Resources

, Volume 5, Issue 4, pp 993–995 | Cite as

Development and characterization of 22 microsatellite loci for the ringed salamander (Ambystoma annulatum) using paired-end Illumina shotgun sequencing

  • William E. Peterman
  • Luke R. Pauley
  • Emily R. Brocato
  • Elsa C. Stuart
  • Raymond D. Semlitsch
  • Lori S. Eggert
Technical Note

Abstract

We isolated and screened 150 microsatellite loci from the ringed salamander, Ambystoma annulatum, an ambystomatid salamander endemic to the Interior Highlands. Twenty-two polymorphic loci were identified and pooled into two multiplex reactions. These loci will be valuable tools for assessing population genetic structure and connectivity across the landscape, and informing management of this species.

Keywords

Ambystoma Population genetics Landscape genetics Multiplex PCR PAL_Finder 

Pond breeding amphibians such as ambystomatid salamanders are generally philopatric to breeding ponds, and have limited dispersal ability (Gamble et al. 2007). Further, ambystomatid salamanders are often sensitive to land use (Semlitsch et al. 2009), which can increase population isolation and genetic differentiation (Greenwald et al. 2009). The ringed salamander, Ambystoma annulatum, is a species endemic to the Interior Highlands of Missouri, Arkansas, and Oklahoma, USA, and is a poorly studied species (Petranka 1998). The ability to disperse through and persist in fragmented landscapes can have a great impact on genetic diversity among populations (Greenwald et al. 2009), and an understanding of gene flow across the landscape is critical to forming sound conservation and management decisions for this species.

Tissue samples for A. annulatum were collected from a breeding pond at Fort Leonard Wood, Missouri, USA (37.92°N, 92.17°W). A single developing embryo was carefully removed from a clutch of eggs (n = 43) and stored in 95 % EtOH at −20 °C prior to DNA extraction. DNA was extracted using DNeasy tissue kits (QIAGEN) according to the manufacturer’s protocols. An Illumina paired-end shotgun library was prepared as described by Nunziata et al. (2013). Resulting reads were analyzed with the program PAL_FINDER_v0.02.03 (Castoe et al. 2012) to extract reads containing di-, tri-, tetra-, penta-, and hexanucleotide microsatellites. Positive reads were then analyzed with Primer3 (Rozen and Skaletsky 2000) for primer design. Only primer sequences occurring a single time among the reads were considered. One hundred fifty tetra- and pentanucleotide loci from 749 loci meeting our selection criteria were screened for amplification and polymorphism. Primers were initially screened using seven samples of total genomic DNA. PCR conditions were standardized to 15 μL containing 1× PCR Gold buffer, 2.0 mM MgCl2, 2.0 mM dNTP, 0.5 units AmpliTaq Gold DNA polymerase (Applied Biosystems, Foster City, CA), 0.8× bovine serum albumin (BSA), 0.4 μM of forward and reverse unlabeled primer, and 1.0 μL (50 ng) genomic DNA. The PCR profile included an initial denaturing step at 95 °C for 10 min, followed by 35 cycles of 95 °C denaturing for 45 s, 58 °C annealing for 45 s, extension at 72 °C for 45 s; and a final 5-min extension at 72 °C. PCR products were separated in a 4 % agarose gel with Gel Star (Lonza, Allendale, NJ) and 100 bp ladder. A total of 35 polymorphic loci were identified. Twenty-two of these primers were divided into two multiplexes using Multiplex Manager (Holleley and Geerts 2009), and forward primers were fluorescently labeled (Table 1). Primers were screened in 43 A. annulatum samples from a single breeding pond. Multiplex PCR reactions were performed using Platinum Multiplex PCR Master Mix (Applied Biosystems, Foster City, CA) following the manufacturer protocols, but in 8 μL volume reactions with GC enhancer solution added to a final concentration of 10 %. PCR cycling conditions consisted of: initial denaturing at 95 °C for 2 min, followed by 30 cycles of 95 °C denaturing for 30 s, annealing at 58 °C for 90 s, and 72 °C extension for 60 s; and a 30-min extension at 60 °C. Amplification products were sized on an ABI 3730 DNA Analyzer (Applied Biosystems) using Liz 600 size standard at the University of Missouri DNA Core Facility, and results were scored using GENEMARKER version 1.97 (Softgenetics, State College, PA). We calculated expected and observed heterozygosities using GENODIVE version 2.0b23 (Meirmans and Van Tienderen 2004) and tested for linkage disequilibrium using GENEPOP version 4.0.10 (Rousset 2008).
Table 1

Primer sequences, repeat motif, fluorescent label, multiplex pool, amplicon size, and summary statistics for 22 microsatellite loci for Ambystoma annulatum

Locus

Primer sequence 5′–3′

Motif

Label

Multiplex

Size (bp)

N

NA

HO

HE

Aa_31

F:

GGTTGGACCCAGAAATGAAGG

ATCT

FAM

1

173–201

43

7

0.744

0.804

 

R:

TTTCAATGTGCTGTTATGGGC

        

Aa_311

F:

TTGTTTGATGGAATGCCTGG

AAAG

FAM

1

261–319

43

11

0.907

0.813

 

R:

CGGTGGATGTCTCTGCTCC

        

Aa_36a

F:

CTGAACGGTCACTTTGCAGG

AAAG

VIC

1

262–310

43

10

0.512

0.803

 

R:

CCTCCTCTTTGCGTACCTCC

        

Aa_19

F:

TAACTTGTGGGCCAGATTTCC

ATCT

VIC

1

387–455

43

17

0.953

0.908

 

R:

CCCTTTGCACGGAGTAGG

        

Aa_21

F:

TTCCACCTCCATAGAAATGAATTGG

TTCC

NED

1

112–153

43

9

0.767

0.793

 

R:

AATAGGTGCTTACGTATGGAAGGAAGG

        

Aa_27

F:

GATGCCTTCGGGTCTTTGC

ATAC

NED

1

198–218

43

3

0.535

0.561

 

R:

CCTAATCACCATAGCATTCGGC

        

Aa_28

F:

TGCTGAATGTATTGTGCAGGG

ATCT

NED

1

267–279

43

5

0.465

0.522

 

R:

GCTGTTGTCTCTTCAACATGCG

        

Aa_86

F:

TTCTTGCAACTGGTAGATGCG

AGTG

NED

1

320–332

43

3

0.465

0.421

 

R:

ATGAGTCTCGGTGTCCCTGG

        

Aa_153

F:

TTTGGCATATGTCACACCCG

TCTG

NED

1

375–399

43

4

0.512

0.574

 

R:

CGTGCCTCCTTAACGTATTGG

        

Aa_84

F:

GGAGTTGGTTGGTTGCTTGC

ATGG

PET

1

116–140

43

3

0.674

0.659

 

R:

TCTCTCTGACCTCATGCATTCC

        

Aa_314

F:

CCTCAAGCTCATTAATTGTTCTCC

AAAG

PET

1

256–272

43

4

0.628

0.537

 

R:

GAACAGCACTGCATCAAGGG

        

Aa_37

F:

CCGCAGTAAACAAGTGACACC

ATCT

FAM

2

232–242

40

6

0.675

0.648

 

R:

CTTCTCAGGAGGCCTGTGG

        

Aa_20

F:

AAATGAAGCAACACGGAGG

AAAG

FAM

2

144–160

43

5

0.442

0.572

 

R:

CTTCGTCCAAACCAAACAGC

        

Aa_50

F:

TGAACACATACAAGTTTGATGCC

ATCT

FAM

2

258–286

43

8

0.791

0.825

 

R:

TTGGTATTGATGCAAAGCTTCC

        

Aa_25

F:

TCCTTACTGGCTGCTATTGCC

ATAC

VIC

2

209–247

43

8

0.907

0.843

 

R:

AAGCTCTGCGACTGCATGG

        

Aa_258

F:

CGCACACACTATCTCATTCCC

AATG

VIC

2

275–299

43

5

0.558

0.595

 

R:

TGTGCACAGGCTCATTTAGG

        

Aa_85

F:

GAGAACAAGACAATTAGTGGGATGG

ATCT

NED

2

131–151

43

6

0.744

0.794

 

R:

TCTGTCTGCTTATCCATTGATCC

        

Aa_46a

F:

GAAACAGGGAAACATCATGCC

AAAG

NED

2

162–190

42

6

0.571

0.833

 

R:

TTGTTTGTTGGTGGAGAGGC

        

Aa_44

F:

TTTGTCCGATATGCGTGTGC

AAAT

NED

2

98–120

35

6

0.629

0.608

 

R:

TCTTCATATTTCGCCTTTGCC

        

Aa_39

F:

TTCACCACCACAAGAGCAGG

ATGG

NED

2

475–511

43

4

0.744

0.664

 

R:

AATTCCAGGATCCAAGATAGGG

        

Aa_40

F:

AAGATAAGAGTGAACTCCATGAGGG

AAGAG

PET

2

154–188

43

8

0.860

0.881

 

R:

GGTTGTTGCTCTAGCTTTCACC

        

Aa_312

F:

TGTGACAACCTGGAACTCGG

AGTG

PET

2

248–308

43

7

0.628

0.708

 

R:

ACTGTCAGGAGGGCATTTCC

        

All primers were screened on 43 samples. All annealing temperatures were 58 °C

aLocus deviated significantly from heterozygosity values expected under Hardy–Weinberg equilibrium after Bonferroni correction

Loci were arranged into two multiplex reactions, each containing eleven loci. Alleles per locus ranged from 3 to 17 (mean = 6.59, Table 1) and the observed heterozygosity ranged from 0.442 to 0.953 (mean = 0.669). Loci Aa_36 and Aa_46 deviated significantly from Hardy–Weinberg equilibrium expectations. Locus Aa_44 failed to amplify in 20 % of the samples, suggesting the presence of null alleles. Linkage disequilibrium between loci was not detected. A previous study attempted to cross amplify existing Ambystoma spp. microsatellite loci in A. annulatum with minimal success (Peterman et al. 2012). The loci described in this study will be valuable and powerful tools to assess population structure, dispersal, and connectivity in the poorly studied A. annulatum, facilitating management of this endemic species at biologically relevant scales.

Notes

Acknowledgments

We thank S. Lance (University of Georgia) for Illumina sequencing and processing of reads. This research was funded by the DoD Strategic Environmental Research and Development Program (RC2155).

References

  1. Castoe TA, Poole AW, de Koning APJ, Jones KL, Tomback DF, Oyler-McCance SJ, Fike JA, Lance SL, Streicher JW, Smith EN, Pollock DD (2012) Rapid microsatellite identification from Illumina paired-end genomic sequencing in two birds and a snake. PLoS ONE 7:e30953PubMedCrossRefGoogle Scholar
  2. Gamble LR, McGarigal K, Compton BW (2007) Fidelity and dispersal in the pond-breeding amphibian, Ambystoma opacum: implications for spatio-temporal population dynamics and conservation. Biol Conserv 139:247–257CrossRefGoogle Scholar
  3. Greenwald KR, Purrenhage JL, Savage WK (2009) Landcover predicts isolation in Ambystoma salamanders across region and species. Biol Conserv 142:2493–2500CrossRefGoogle Scholar
  4. Holleley CE, Geerts PG (2009) Multiplex Manager 1.0: a cross-platform computer program that plans and optimizes multiplex PCR. Biotechniques 46:511–517PubMedCrossRefGoogle Scholar
  5. Meirmans PG, Van Tienderen PH (2004) GENOTYPE and GENODIVE: two programs for the analysis of genetic diversity of asexual organisms. Mol Ecol Notes 4:792–794CrossRefGoogle Scholar
  6. Nunziata SO, Lance SL, Jones KL, Nerkowski SA, Metcalf AE (2013) Development and characterization of twenty-three microsatellite markers for the freshwater minnow Santa Ana speckled dace (Rhinichthys osculus spp., Cyprinidae) using paired-end Illumina shotgun sequencing. Conserv Genet Resour 5:145–148CrossRefGoogle Scholar
  7. Peterman WE, Connette GM, Spatola BN, Eggert LS, Semlitsch RD (2012) Identification of polymorphic loci in Ambystoma annulatum and review of cross-species microsatellite use in the genus Ambystoma. Copeia 2012:570–577CrossRefGoogle Scholar
  8. Petranka JW (1998) Salamanders of the United States and Canada. Smithsonian Institution Press, Washington, DCGoogle Scholar
  9. Rousset F (2008) GENEPOP’007: a complete re-implementation of the GENEPOP software for Windows and Linux. Mol Ecol Resour 8:103–106PubMedCrossRefGoogle Scholar
  10. Rozen S, Skaletsky HJ (2000) Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S (eds) Bioinformatics methods and protocols: methods in molecular biology. Humana Press, Totowa, pp 365–386Google Scholar
  11. Semlitsch RD, Todd BD, Blomquist SM, Calhoun AJK, Gibbons JW, Gibbs JP, Graeter GJ, Harper EB, Hocking DJ, Hunter ML, Patrick DA, Rittenhouse TAG, Rothermel BB (2009) Effects of timber harvest on amphibian populations: understanding mechanisms from forest experiments. Bioscience 59:853–862CrossRefGoogle Scholar

Copyright information

© Springer Science+Business Media Dordrecht 2013

Authors and Affiliations

  • William E. Peterman
    • 1
  • Luke R. Pauley
    • 1
  • Emily R. Brocato
    • 1
  • Elsa C. Stuart
    • 1
  • Raymond D. Semlitsch
    • 1
  • Lori S. Eggert
    • 1
  1. 1.Division of Biological SciencesUniversity of Missouri-ColumbiaColumbiaUSA

Personalised recommendations