Advertisement

Conservation Genetics Resources

, Volume 5, Issue 2, pp 429–431 | Cite as

New fourteen highly polymorphic STR markers developed and characterized from edible dormouse (Glis glis)

  • Miroslawa Dabert
  • Urszula Sobczyńska
  • Dariusz Abramowski
  • Dean Konjević
  • Josip Margaletić
  • Miroslaw Jurczyszyn
Open Access
Technical Note

Abstract

Fourteen new polymorphic di- and di-tetra complex microsatellite loci were isolated and characterized from the edible dormouse (Glis glis). The markers were tested on 427 individuals representing populations from Croatia and Poland. All loci were polymorphic, with the number of alleles per locus ranged from 4 to 31, with a mean of 10. Observed and expected heterozygosities ranged from 0.208–0.957 to 0.228–0.907, respectively. No evidence of linkage disequilibrium between loci has been found. These highly polymorphic markers could provide a powerful tool for detailed genetic studies of this endangered species.

Keywords

Microsatellites Polymorphic loci Endangered species Multiplex PCR Edible dormice 

The edible dormouse (Glis glis) (Rodentia: Gliridae) is largely widespread in western, central, and southeastern Europe and western Asia (Storch 1978). This hibernating arboreal rodent is especially influenced by habitat fragmentation and human activities. In Poland, where edible dormouse is endangered and protected by law (Pucek and Jurczyszyn 2001), some efforts have been made to develop management plans for Glis glis that include monitoring, protection, and reintroduction of this species. All these activities could be monitored and helped by the use of polymorphic DNA markers. Despite the efforts that were done to develop microsatellite markers for this species (Hürner et al. 2009; Dabert et al. 2009; Segelbacher et al. 2010), still there was a need of new markers due to a relatively low level of polymorphism of the published loci, which displayed no more than 7 alleles per locus. Here we present new fourteen polymorphic microsatellite markers for dormice, including four loci exhibiting from 10 to 31 alleles per locus.

Total genomic DNA for this study was extracted from a liver tissue of the edible dormouse specimen died during hibernation in the Zoological Garden in Poznan, 1997. After digestion with HaeIII and AluI (NEB, New England Biolabs, USA) DNA was treated with MBN nuclease (NEB) and FastAP alkaline phosphatase (Fermentas, Lithuania). Then, column-purified DNA fragments were ligated to the double-stranded SNX linkers as described by Hamilton et al. (1999). Ligation success was monitored by PCR with SNX forward primer. Ligation mixture was denatured at 95 °C for 5 min and hybridized to 5′-biotinylated (CA)12 and (CT)12 oligonucleotides at 60 °C for 1 min, and then incubated in rotation at 60 °C for 15 min with streptavidin-coated paramagnetic beads (Dynabeads, Life Technologies, USA). Repeat-enriched fragments were PCR amplified using SNX forward primer and cloned into pCR4-TOPO vector using TOPO TA Cloning Kit (Life Technologies). After screening, 96 positive clones were sequenced on an ABI 3130XL DNA analyzer (Applied Biosystems). After excluding clones with <15 repeats, we found 27 non-redundant microsatellite sequences flanked by regions sufficient to design primers. However, among primer sets developed for these loci, only 14 gave specific PCR products and/or were polymorphic in 15 tested specimens representing Croatian and Polish populations (Table 1).
Table 1

Characterization and amplification conditions of 14 STR markers developed for edible dormice

Locus name/GenBank Acc.

5′-Label

F/R

Primer sequence (5′–3′)

Repeat motif

Size range (bp)

Ta (°C)

7pilch

6FAM

F

CACCTGTAGTCCCCATACTTAG

(CA)22

244–252

60

JX976185

R

TACTTCTGAGCTATACCCCTAGC

20pilch

VIC

F

CAACAGATGAATGGATAAAG

(TC)11AT(CA)18

109–124

55

JX976186

R

TCTTCTTTATGGGTGTGTAG

23pilch

NED

F

CGAAGAGGAGAGTTTATCAA

(CA)20

185–193

60

JX976187

R

CTGGCAACCCTAGTAATCAT

24pilch

VIC

F

TAACATAACCCACATACGGC

(CA)19

255–261

60

JX976188

R

CAAGCAAGGCAGTAGAACAT

26pilch

NED

F

TCACGCAGCACTACTCACAAT

(CA)20

141–151

55

JX976189

R

TAGTATTTCTTTGTGTGTGTGT

28pilch

NED

F

CCAGGAGAGGTAGAATGCC

(CA)22

94–108

60

JX976190

R

GCTACTGCCAGAATGACACA

30pilch

6FAM

F

AGAGAAGAAGGGCAGACACA

(CA)23

97–115

60

JX976191

R

TAGGTATTGGGTCTCTGGTG

31pilch

VIC

F

ATGGTTCCCTGGTTCTCTCT

(CT)18TT(CT)5

288–298

50

JX976192

R

AGTATTTGTCCTTCTGTGCC

36pilch

PET

F

AACTTTCACCACCCTGCTCA

(CT)5TT(CT)19

182–206

60

JX976193

R

CAACTTGGAGATAGAATGTC

37pilch

PET

F

CTAGAGAGACCCTGTTTCAA

(CA)10GA(CA)3GA(CA)3GA(CA)15

206–230

55

JX976194

R

ACTTTCCTTTCTCTTCAGCA

47pilch

PET

F

AGTCACTCCTACACAAACAT

(GC)5ACAC(GC)4(CA)15

132–142

50

JX976195

R

GGATCATTTAACTAACAGCG

48pilch

M13tail-VIC

F

GTCTTTCTCTCTCTCCATTTATTTCC

(CTTT)12(CT)22

233–289

60

JX976196

R

AGAGACAAAGAGAAGGAGGGA

49pilch

M13tail-PET

F

CGCCTGATTCATTCAGACTGGA

(CTTT)15(N)95(CTTT)11(CT)13

248–320

55

JX976197

R

AAAAAGAAGAAAGAAAGAGAGAG

50pilch

M13tail-6FAM

F

AGCATGGTTATAGGAATTAG

(CT)14

87–93

55

JX976198

R

ACAGAGAAACAGAGAGGGAC

Locus name and GenBank Accession nos, 5′-labeling of PCR primer, forward (F), reverse (R), primer sequences, repeat motif, size range of observed allelic variation, optimal annealing temperature (Ta)

The microsatellites were tested for polymorphism on 427 individuals representing one population from Croatia (48) and several populations from Poland (329). PCR amplifications with fluorescently labeled primers were carried out in 6 μl reactions containing Type-it Microsatellite Kit (Qiagen, Germany), 0.2 μM each of primers, and 10–100 ng of template DNA using program as follows: 95 °C for 5 min, 30 cycles of 95 °C for 30 s, annealing temperature (see Table 1) for 90 s, 72 °C for 30 s, and final extension at 65 °C for 45 min. M13-tailed loci (Oetting et al. 1995) were amplified at the same conditions, except the concentration of primers, which was 0.15 μM for forward primer, 0.25 μM for fluorescently labeled M13 primer, and 0.4 μM for reverse primer. We found that four loci (23pilch, 24pilch, 30pilch, and 36pilch) could be amplified in a multiplex PCR under the conditions as described above. The amplified alleles were separated on an ABI PRISM 3130XL with Genescan 600LIZ size standard and scored in GeneMapper 4 (Applied Biosystems).

Hardy–Weinberg equilibrium (HWE) and genotypic disequilibrium between pairs of loci were tested using GENEPOP 4.0 (Rousset 2008). Number of alleles, and expected and observed heterozygosities were estimated in GENALEX 6 (Peakall and Smouse 2006). Each locus was tested for null allele frequencies using Micro-Checker (van Oosterhout et al. 2004). The number of alleles per locus in all analyzed specimens ranged from 4 to 31 (Table 2), with a mean of 10. This relatively high level of polymorphism was found in both Polish and Croatian populations (a mean of 8 and 7 alleles per locus, respectively). The remaining statistical parameters were tested on the Croatian population only, because it showed a more equilibrated structure than strongly isolated populations from Poland. We found no evidence of linkage disequilibrium between loci. In two loci, 37pilch and 47pilch, significant evidences for null alleles were found with 95 % confidence interval. Only one locus (26pilch) demonstrated significant deviations from HWE in the sampled population (P value = 0.005), and exhibited deficit in heterozygotes. This deviation from expectations could be a result of insufficient sample size of the tested Croatian population.
Table 2

Statistical parameters of 14 STR markers in dormouse populations

Population

Total

Poland

Croatia

Locus name

N

Na

N

Na

N

Na

Ho/He

P-values (HWE)

NAF

7pilch

423

5

376

5

47

4

0.596/0.576

0.982

0.0819

20pilch

425

10

377

9

48

5

0.771/0.673

0.899

0.0000

23pilch

425

5

377

5

48

5

0.479/0.493

0.763

0.0090

24pilch

424

4

376

4

48

4

0.208/0.228

0.813

0.0157

26pilch

422

6

374

6

48

5

0.375/0.342

0.005*

0.0000

28pilch

415

8

375

6

40

4

0.250/0.305

0.365

0.3816

30pilch

425

6

377

5

48

5

0.375/0.389

0.427

0.0100

31pilch

411

6

370

4

41

5

0.268/0.265

0.474

0.3385

36pilch

425

12

377

12

48

9

0.938/0.819

0.883

0.0000

37pilch

425

9

378

9

47

5

0.426/0.574

0.833

0.1552**

47pilch

423

6

376

6

47

6

0.404/0.535

0.790

0.1507**

48pilch

426

26

378

22

48

12

0.896/0.878

0.242

0.0000

49pilch

424

31

377

19

47

20

0.957/0.907

0.227

0.0324

50pilch

361

4

313

3

48

2

0.354/0.489

0.056

0.0908

N, sample sizes; Na, number of alleles; Ho/He, observed/expected heterozygosities; P, probability values for exact tests of HWE; NAF, null allele frequencies

* significant deviations from HWE with confidence interval 95 %

** significant evidence of null allele with 95 % confidence interval

These new highly polymorphic microsatellite loci in combination with previously published markers (Hürner et al. 2009; Dabert et al. 2009; Segelbacher et al. 2010) could provide a powerful tool for detailed genetic studies of this endangered species.

Notes

Acknowledgments

The studies were supported by The National Fund of Environmental Protection and Water Management No POIS.05.01.00-00-202/09 and were approved by Polish Ministry of the Environment (No. DLOPiK-op/ogiz/IV-20/4455/07/aj).

Open Access

This article is distributed under the terms of the Creative Commons Attribution License which permits any use, distribution, and reproduction in any medium, provided the original author(s) and the source are credited.

References

  1. Dabert M, Jarmolowski A, Jurczyszyn M (2009) New polymorphic microsatellite loci developed and characterized from edible dormouse (Glis glis). Conserv Genet 10:2029–2031. doi: 10.1007/s10592-009-9886-0 CrossRefGoogle Scholar
  2. Hamilton MB, Pincus EL, Di Fiore A, Fleischer RC (1999) Universal linker and ligation procedures for construction of genomic DNA libraries enriched for microsatellites. Biotechniques 27:500–507PubMedGoogle Scholar
  3. Hürner H, Martin JF, Ibas AR, Arrizabalaga A, Michaux JR (2009) Isolation, characterization and PCR multiplexing of polymorphic microsatellite markers in the edible dormouse Glis glis. Mol Ecol Resour 9(3):885–887. doi: 10.1111/j.1755-0998.2008.02365.x PubMedCrossRefGoogle Scholar
  4. Oetting WS, Lee HK, Flanders DJ, Wiesner GL, Sellers TA, King RA (1995) Linkage analysis with multiplexed short tandem repeat polymorphisms using infrared fluorescence and M13 tailed primers. Genomics 30:450–458PubMedCrossRefGoogle Scholar
  5. Peakall R, Smouse PE (2006) GENALEX 6: genetic analysis in Excel. Population genetic software for teaching and research. Mol Ecol Notes 6:288–295. doi: 10.1111/j.1471-8286.2005.01155.x CrossRefGoogle Scholar
  6. Pucek Z, Jurczyszyn M (2001) Glis glis (Linne, 1766) Fat dormouse (edible dormouse). In: Glowaciński Z (ed) Polish red data book of animals. PWRL, Warszawa, pp 79–81Google Scholar
  7. Rousset F (2008) GENEPOP’007: a complete re-implementation of the GENEPOP software for Windows and Linux. Mol Ecol Resour 8:103–106. doi: 10.1111/j.1471-8286.2007.01931.x PubMedCrossRefGoogle Scholar
  8. Segelbacher G, Tomiuk J, Heinz T, Kun JFJ, Weis-Dootz T, Fietz J (2010) Permanent genetic resources added to the molecular ecology resources database 1 February 2010–31 March 2010. Mol Ecol Resour 10(4):751–754. doi: 10.1111/j.1755-0998.2010.02871.x PubMedGoogle Scholar
  9. Storch G (1978) Glis glis (Linnaeus, 1766)—Siebenschläfer. In: Niethammer J, Krapp F (eds) Handbuch der Säugetiere Europas. Akademische Verlagsgeselschaft, Wiesbaden, pp 243–258Google Scholar
  10. van Oosterhout C, Hutchison WF, Wills DPM, Shipley P (2004) Micro-checker: software for identifying and correcting genotyping errors in microsatellite data. Mol Ecol Notes 4:535. doi: 10.1111/j.1471-8286.2004.00684.x CrossRefGoogle Scholar

Copyright information

© The Author(s) 2012

Authors and Affiliations

  • Miroslawa Dabert
    • 1
  • Urszula Sobczyńska
    • 1
  • Dariusz Abramowski
    • 1
    • 2
  • Dean Konjević
    • 3
  • Josip Margaletić
    • 4
  • Miroslaw Jurczyszyn
    • 5
  1. 1.Molecular Biology Techniques Laboratory, Faculty of BiologyAdam Mickiewicz UniversityPoznanPoland
  2. 2.Department of Plant PhysiologyPoznan University of Life SciencesPoznanPoland
  3. 3.Veterinary FacultyUniversity of ZagrebZagrebCroatia
  4. 4.Forestry FacultyUniversity of ZagrebZagrebCroatia
  5. 5.Department of Systematic Zoology, Faculty of Biology, Institute of Environmental BiologyAdam Mickiewicz UniversityPoznanPoland

Personalised recommendations