Conservation Genetics Resources

, Volume 4, Issue 4, pp 889–891 | Cite as

Isolation of microsatellite loci in the Amazon sailfin catfish Pterygoplichlhys pardalis (Castelneau, 1855) (Teleostei: Loricariidae)

  • Rosalina P. Pereira
  • Carlos Henrique dos A. dos Santos
  • Priscila Roberta M. Nascimento
  • Gisele T. Clímaco
  • Adna Cristina B. Sousa
  • Tatiana Campos
  • Alexandre Manoel K. Vergueiro-Júnior
  • Maria N. Paula-Silva
  • Vera Maria F. Almeida-Val
Technical Note

Abstract

Pterygoplichlhys pardalis is an important freshwater ornamental fish in the Amazon Basin. Studies involving populations of P. pardalis are of great importance for the conservation and management of this species. We developed nine microsatellite loci and applied them to investigate the genetic variation of 20 wild individuals from floodplain lakes of the Solimões river. The number of alleles per locus ranged from 2 to 12, with an average of 6.6. The observed and expected heterozygosity values ranged from 0.400 to 0.923 (average 0.706) and from 0.358 to 0.895 (average 0.692), respectively. The value of f ranged from −0.532 to 0.467 (average 0.032). One locus (Pp07) significantly deviated from Hardy–Weinberg equilibrium after Bonferroni correction (P: (5 %) < 0.006). No significant linkage disequilibrium was detected. These microsatellite loci will contribute towards studies of genetic diversity and conservation of P. pardalis.

Keywords

Pterygoplichlhys pardalis Genetic diversity Wildlife conservation Microsatellite markers 

More than 700 species of the Amazon sailfin catfish (Siluriformes; Loricariidae) occur in Central and South America (Wakida-Kusunoki et al. 2007; Ferraris 2007). The members of the Pterygoplichthys genus occur in the Orinoco and Amazon river basins (Weber 1992), and are popular among aquarists due to their algivorous habits and ornamental features (Levin et al. 2008). The P. pardalis is a species widely consumed and commercially exploited by fisherman of the Amazon basin. Expansion of exploitation of loricariid catfishes all over the world began in the mid-twentieth century owing to the development of an excessive pet fish trade (Hoover et al. 2004). Species of Pterygoplichthys are known as widespread invaders since they occur in many areas outside their native range, and the presumed mechanism of introduction is aquarium release or escape from aquaculture farms (Page and Robins 2006). We isolated and characterized microsatellite loci for the Amazon sailfin catfish to contribute to the management, conservation and control of this species.

Microsatellite loci were developed from a genomic enriched library following the protocol described by Billotte et al. (1999). The protocol used for total genomic DNA extraction was described by Sambrook et al. (1989). The purified total DNA was digested with RsaI and enriched for (CT)8 and (GT)8 repeats. Enriched fragments were amplified by polymerase chain reaction (PCR), ligated into a pGem-T Easy vector (Promega) and then transformed into competent XL1-Blue Escherichia coli cells. The positive clones were selected using the β-galactosidade gene and grown overnight in an HM/FM medium with ampicillin. Plasmid DNA was purified and 96 positive clones were sequenced using T7 and SP6 primers as well as the v3.1 Big Dye terminator kit (PerkinElmer Applied Biosystems) with an ABI 377 automated DNA sequencer (Applied Biosystems). A total of 12 primer pairs were designed using the program Oligo Explorer v1.2 (Gene Link, Inc.) and a M13 sequence tail was added in the 5′ end of each forward primer in order to permit the fluorescent labeling protocol suggested by Schuelke (2000).

These loci were characterized in 20 individuals of P. pardalis collected in lakes along Solimões River between the cities of Coari and Manaus (PIATAM Project). The microsatellite fragments were amplified by PCR in 10 μl containing 60 ng of genomic DNA template, each forward and M13 Label primer (FAM) at 0.4 μM, reverse primer at 0.8 μM, PCR Master Mix (2×) (Fermentas)—0.05 U/μl Taq DNA Polymerase in reaction buffer (10 mM Tris–HCl, pH 8.5 and 50 mM KCl), 4 mM MgCl2, 0.4 mM dATP, 0.4 mM dCTP, 0.4 mM dGTP and 0.4 mM dTTP. PCR was carried out with two steps: denaturation (94 °C, 1 min) followed by 25 cycles of 20 s at 94 °C, 20 s at 56 °C (specific annealing temperature, Table 1), and 30 s at 68 °C; the second step consisted of 20 cycles with the following time and temperature profile: 20 s at 94 °C, 20 s at 53 °C, 30 s at 68 °C, and a final extension at 72 °C for 3 min. Amplifying products were checked by electrophoresis on 1 % agarose gels containing 0.1 mg ethidium bromide/ml in 1× TBE buffer (pH 8.0). The products from each PCR (1.0 μl) were analyzed on an ABI 3130xl Sequencer and sized using the GeneScan-500 LIZ internal size standard and scored using GeneMapper version 4.0 (Applied Biosystems) software.
Table 1

Characteristics of the nine P. pardalis microsatellite loci: locus name, Genbank accession number, primer sequences (F: forward primer, R: reverse primer), repeat motif from a sequenced clone, annealing temperature (Ta), number of individuals (N), number of alleles (A), product size range in base pairs, expected (HE) and observed heterozygosity (HO), fixation index (f), polymorphism information content (PIC), P values for the HWE test, significance threshold adjusted using Bonferroni correction (P-HWE): (P: 5 % ≤ 0.006), NS not significant and * significant

SSR

locus

GenBank

accession no.

Primer sequences

(5′–3′)

Repeat motif

Ta (°C)

N

A

Allele size (pb)

HE

HO

f

PIC

P value*

HWE

Pp01

JN255187

F: FAMACCACCTGCTGCTGCTTG

R: CTACATGGTCCCAAACCACT

(GT)15

47

15

3

216–244

0.640

0.400

0.467

0.563

0.108NS

Pp02

JN255188

F: FAMGCGTGGAAAACGAGGAGC

R: GGTGAAGACTTACAGGAAACG

(GT)5GA(GT)18

55

19

5

171–179

0.684

0.800

−0.135

0.628

0.009NS

Pp03

JN255189

F: FAMGTGATTCTCTTGCTTACGC

R: ACCTTCCCATACAGATCC

(AC)19

49

19

2

185–223

0.358

0.467

−0.273

0.294

0.537NS

Pp04

JN255190

F: FAMGAATTTCAGCAGGTCGTC

R: CATCGGCTTTCTCAGGTG

(GA)26

47

20

9

200–242

0.804

0.800

0.040

0.785

0.086NS

Pp06

JN255191

F: FAMGGCACACACAAGGTTACAT

R: CGAGGGGTTCTAATCTGG

(AC)21

55

18

3

153–159

0.592

0.923

−0.532

0.519

0.034NS

Pp07

JN255192

F: FAMCCAAGACATCAGTATGAC

R: CTCCTTCTTTGCATATCC

(AG)26

49

20

12

200–276

0.879

0.583

0.374

0.867

0.000*

Pp09

JN255193

F: FAMGGCAAGATTCCAAAGGGC

R: GCCTCCATGAATGAACGG

(GT)9

55

18

4

133–151

0.589

0.733

−0.213

0.503

0.254NS

Pp10

JN255194

F: FAMGTTGATTCTCTTGCTTACGC

R: CCGATGCCATGCTTGATG

(AC)18

55

20

12

143–243

0.895

0.857

0.059

0.880

0.053NS

Pp13

JN255195

F: FAMCTCATCTCACTATTTACAGG

R: TGGACTAGCACAAGTGTG

(TG)24

53

19

7

234–256

0.796

0.778

0.082

0.768

0.028NS

Out of 12 microsatellite loci developed for P. pardalis, nine were polymorphic (Table 1) and three monomorphic. The number of alleles, the observed (HO) and expected (HE) heterozygosity and fixation index (f) were calculated using Genetix v4.05.2 (Belkhir et al. 2004). The test for conformity to the Hardy–Weinberg expectation (HWE) and linkage disequilibrium (LD) between all pairs of loci were calculated using GDA v1.1 (Lewis and Zaykin 2000). The polymorphism information content (PIC) was calculated using Cervus v3.0.3 (Kalinowski et al. 2007). Significance levels were adjusted to the number of simultaneous tests using sequential Bonferroni correction (Rice 1989). The number of alleles per locus ranged from 2 to 12, with an average of 6.6 alleles per locus (Table 1). Polymorphism information content (PIC) ranged from 0.294 to 0.880. Observed heterozygosity (HO) and expected heterozygosity (HE) ranged from 0.400 to 0.923 (average 0.706) and 0.358 to 0.895 (average 0.692), respectively. Values of f ranged from −0.532 to 0.467 with average of 0.032. Only one loci (Pp07) showed significant deviation from the Hardy–Weinberg equilibrium (HWE) after Bonferroni correction (P: (5 %) < 0.006), and probably this deviation occurred due to the presence of null alleles as suggested by the program Micro-Checker (van Oosterhout et al. 2004). Other possible reasons for the deviation from HWE might be the Wahlund effect or the small sample size. No significant linkage disequilibrium (LD) was detected among all pairs of loci. These nine polymorphic microsatellite loci are potential tools for genetic studies of wild populations of P. pardalis.

Notes

Acknowledgments

The authors are grateful to the PIATAM Project for providing the samples collected from a wild population in lakes along Solimões river between the cities of Coari and Manaus. The authors would like to thank Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES), Fundação de Amparo à Pesquisa do Amazonas (FAPEAM) and Conselho Nacional de Pesquisa (CNPq) for financial support. CHAS is the recipient of a Post-Doctoral fellowship from CNPq. The Program for Academic Cooperation PROCAD between INPA/UNICAMP/UFRGS was supported by CAPES (no.023/2006/CAPES). VMFAV is the recipient of a research fellowship from CNPq. This work is part of INCT ADAPTA, coordinated by Adalberto Luis Val.

References

  1. Belkhir KP, Borsa P, Chikhi L, Raufaste N, Bonhomme F (2004) GENETIX 4.05, logiciel sous Windows TM pour la génétique des populations. Laboratoire du Génome et Populations, Interactions, CNRS UMR 5171, Université de Montpellier II, Montpellier, FranceGoogle Scholar
  2. Billotte N, Lagoda PJR, Risterucci AM, Baurens FC (1999) Microsatellite-enriched libraries: applied methodology for the development of SSR markers in tropical crops. Fruits 54:277–288Google Scholar
  3. Ferraris CJ (2007) Checklist of catfishes, recent and fossil (Osteichthys: Siluriformes), and catalogue of siluriform primary types. Zootaxa 1418:1–628Google Scholar
  4. Hoover J, Killgore J, Cofrancesco A (2004) Suckermouth catfishes: threats to aquatic ecosystems of the United States? In: Aquatic Nuisance Species Research Bulletin 4–1. U.S. Army Corp of Engineers Research and Development Center, Vicksburg, MississippiGoogle Scholar
  5. Kalinowski ST, Taper ML, Marshall TC (2007) Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Mol Ecol 16:1099–1106PubMedCrossRefGoogle Scholar
  6. Levin BA, Phuong PH, Pavlov DS (2008) Discovery of the Amazon sailfin catfish Pterygoplichthys pardalis (Castelnau, 1855) (Teleostei: Loricariidae) in Vietnam. J Appl Ichthyol 24:715–717CrossRefGoogle Scholar
  7. Lewis PO, Zaykin D (2000) Genetic data analysis: computer program for the analysis of allelic Data, Version 11 (d15). University of Connecticut, Storrs, CTGoogle Scholar
  8. Page LM, Robins RH (2006) Identification of sailfin catfishes (Teleostei: Loricariidae) in Southeastern Asia. Raffles Bull Zool 54:455–457Google Scholar
  9. Rice WR (1989) Analyzing tables of statistical tests. Evolution 43:223–225CrossRefGoogle Scholar
  10. Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a laboratory manual, 2nd edn. Cold Spring Harbor Laboratory, New YorkGoogle Scholar
  11. Schuelke M (2000) An economic method for the fluorescent labeling of PCR fragments. Nat Biotech 18:233–234CrossRefGoogle Scholar
  12. van Oosterhout C, Hutchinson WF, Wills DP, Shipley P (2004) Microchecker: software for identifying and correcting genotyping errors in microsatellite data. Mol Ecol Notes 4:535–538CrossRefGoogle Scholar
  13. Wakida-Kusunoki AT, Ruiz-Carus R, Amador-Del-Angel E (2007) Amazon sailfin catfish, Pterygoplichthys pardalis (Castelnau, 1855) (Locariidae), another exotic species established in southeastern Mexico. Southwest Nat 52:141–144CrossRefGoogle Scholar
  14. Weber C (1992) Révision du genre Pterygoplichthys sensu latu (Pisces, Siluriformes, Loricariidae). Revue Francaise du Aquariologie 19:1–36Google Scholar

Copyright information

© Springer Science+Business Media B.V. 2012

Authors and Affiliations

  • Rosalina P. Pereira
    • 1
  • Carlos Henrique dos A. dos Santos
    • 1
  • Priscila Roberta M. Nascimento
    • 1
  • Gisele T. Clímaco
    • 1
  • Adna Cristina B. Sousa
    • 2
  • Tatiana Campos
    • 3
  • Alexandre Manoel K. Vergueiro-Júnior
    • 1
  • Maria N. Paula-Silva
    • 1
  • Vera Maria F. Almeida-Val
    • 1
  1. 1.Laboratório de Ecofisiologia e Evolução Molecular (LEEM)Instituto Nacional de Pesquisas da Amazônia (INPA)ManausBrazil
  2. 2.Universidade do Estado da BahiaPaulo AfonsoBrazil
  3. 3.Empresa Brasileira de Pesquisa AgropecuáriaRio BrancoBrazil

Personalised recommendations