Conservation Genetics Resources

, Volume 2, Issue 1, pp 167–171

Eighteen microsatellite loci developed from western burrowing owls (Athene cunicularia hypugaea)

  • Brant C. Faircloth
  • Alexandra Title
  • Kevin Tan
  • Justin Welty
  • James R. Belthoff
  • Patricia Adair Gowaty
Open Access
Technical Note

DOI: 10.1007/s12686-010-9214-5

Cite this article as:
Faircloth, B.C., Title, A., Tan, K. et al. Conservation Genet Resour (2010) 2: 167. doi:10.1007/s12686-010-9214-5

Abstract

Western burrowing owls (Athene cunicularia hypugaea) are ground-dwelling owls distributed throughout western North America. Because of population declines, this species is considered endangered in Canada, and burrowing owls are listed as a species of conservation concern in states of the western USA. Korfanta et al. (2002) previously presented primers for seven microsatellite loci in burrowing owls. Parentage and relatedness studies require a larger number of markers for accuracy and precision. Here, we developed and characterized 18 additional microsatellite DNA loci, and we tested these loci in 23 individuals. The number of alleles per locus ranged from 2 to 11; two loci deviated from Hardy–Weinberg equilibrium following Bonferroni correction; we did not detect linkage disequilibrium following Bonferroni correction; and the probability of exclusion for parent pairs using all loci was >0.9999. We envision these loci will facilitate detailed analyses of the genetic mating system of burrowing owls, which is poorly understood.

Keywords

Microsatellites SSRs Burrowing owls Athene cunicularia Strigidae 

Western burrowing owls (Athene cunicularia hypugaea) are small, ground-dwelling owls native to western North America. These owls nest in underground burrows typically dug by mammals and lay clutches of up to 14 eggs. Sparse and low vegetation, such as that in grasslands and steppes, characterizes burrowing owl habitat (Haug et al. 1993), but owls can be abundant in agricultural areas (Conway et al. 2006; Moulton et al. 2006; Restani et al. 2008). Adult owls frequently nest in loose colonies (Lantz et al. 2007), but they also defend the space around their nests from conspecifics (Moulton et al. 2004). Northern burrowing owl populations are generally obligate migrants, whereas those to the south are year-round residents. Many populations have declined in abundance, often in response to the eradication of ground-dwelling mammals and/or loss of habitat. Thus, numerous American states list burrowing owls as a species of concern (Klute et al. 2003). Burrowing owls are federally endangered in Canada.

Korfanta et al. (2002) previously developed primers for seven microsatellite DNA loci and used these loci to investigate genetic variation among North American western burrowing owl populations (Korfanta et al. 2005). Their analyses also included comparisons between the disjunct western and Florida (A. c. floridana) subspecies of burrowing owls. Korfanta et al. (2005) found that populations within subspecies were essentially panmictic and genetic differentiation across subspecies was modest, although the western and Florida forms were easily distinguishable based on allelic absences in Florida populations, assignment tests, and well-supported branches on the inferred phylogenetic tree (Korfanta et al. 2005). Despite population declines, there was also no evidence for genetic bottlenecks (Korfanta et al. 2005).

Microsatellite loci have not been applied to studies of burrowing owl mating behavior or individual relatedness within nesting colonies, results of which interest conservation biologists and behavioral ecologists. Analysis of mating systems and relatedness is a task that requires a moderate to large number of genetic markers (Blouin 2003; Marshall et al. 1998; Milligan 2003; Selkoe and Toonen 2006). Thus, our objective was to develop a microsatellite panel sufficient to facilitate these studies that could be used alone or in combination with previously developed loci. Here we describe the isolation and characterization of 18 new microsatellite loci, building upon the panel previously developed by Korfanta et al. (2002).

We developed a double-enriched microsatellite library following Glenn and Schable (2005) and incorporating Invitrogen MyOne streptavidin beads (Invitrogen, Inc.; Faircloth et al. 2009) using DNA purified (5-Prime ArchivePure Blood Kit) from blood taken from a female burrowing owl collected in Idaho. From this library, we selected 760 positive (white) colonies using the β-galactosidase gene and bi-directionally sequenced 285 colony PCR products of 500–1,200 base pairs using 1/16th BigDye [v3.1, Applied Biosystems (ABI)] sequencing reactions and an ABI PRISM 3730xl sequencer. We aligned and edited sequences and assembled 184 contigs using Sequencher 4.2 (Gene Codes Corp.). We screened contigs against themselves, using BLAST (Altschul et al. 1990), to test for sequence homology, and we removed duplicate contigs. Using BLAST (Altschul et al. 1990), we also screened contigs for high-probability matches (e-score = 1 × 10−5) to burrowing owl sequences (Korfanta et al. 2002) present within GenBank (Benson et al. 2008). None of the contigs screened matched burrowing owl sequences within GenBank.

Using MSATCOMMANDER (Faircloth 2008), we located microsatellite repeat arrays within 59 contigs (32%), designed 33 primers, and applied 5′-tags (CAG or M13R) to primer pairs for polymorphism testing (Boutin-Ganache et al. 2001; Glenn and Schable 2005). We manually designed primers (N = 12), for microsatellite-containing contigs where MSATCOMMANDER indicated primer design errors, using Oligo 6.0 (Molecular Biology Insights) and the 5′-tagging approach. We added GTTT “pigtails” to the 5′ end of all primers lacking either CAG or M13R tag to facilitate the addition of adenosine by Taq polymerase (Brownstein et al. 1996).

We tested 45 primer pairs for amplification using DNA collected from three burrowing owls using DNeasy kits (Qiagen Inc.). Prior to amplification, we treated DNA samples 1:1 (v/v) with 10% chelex resin (BioRad Laboratories), and we added 5 ng DNA to each PCR reaction. We performed all PCR amplifications in 10 μL volumes using ABI 9700 thermal cyclers in combination with the reaction mix and cycling parameters (60°C touchdown PCR; −0.5°C step; Don et al. 1991) presented in Faircloth et al. (2009). We labeled M13R and CAG universal primers with VIC, NED, FAM or PET fluorescent dyes (ABI). We scored amplicons using an ABI Prism 3730xl DNA Sequencer in combination with LIZ600 fluorescent size standard (ABI), GeneMapper 4.0 Software (ABI) and the Local Southern size calling method.

Based on the performance of primers during the initial test, we selected 28 primer pairs for subsequent optimization and polymorphism testing. We did not select primer pairs for additional testing that were monomorphic (N = 10, 22%) or failed to amplify cleanly (N = 7, 16%) during the initial test.

Using DNA collected from 23 individual burrowing owls and purified with Qiagen DNeasy kits, we optimized and screened selected primers using conditions identical to those presented above. We did not produce and analyze amplicons using multiple annealing temperatures because a majority of peak morphologies were clear and easily resolved at a starting annealing temperature of 60°C. We removed loci from the candidate set yielding ambiguous peaks or inconsistent results.

We calculated observed (HO) and expected (HE) heterozygosity, polymorphic information content (PIC), and exclusion probability using Cervus 3.0 (Marshall et al. 1998; Kalinowski et al. 2007), and we tested for deviations from Hardy–Weinberg equilibrium (HWE) and evaluated genotypic linkage disequilibrium (LD) using Genepop (Raymond and Rousset 1995). We conducted a posteriori Bonferroni correction (Rice 1989) for each analysis consisting of multiple, concurrent statistical tests (HWE and LD).

Table 1 presents the characteristics of 18 primer pairs amplifying microsatellite loci in burrowing owls. Amplification success was 99.3%, and the number of alleles ranged from two to 11, averaging 5.1. BOOB-BM4-H06 and BOOB-BM4-A01 deviated (P < 0.01) from HWE following Bonferroni correction, and we were unable to estimate deviation from HWE for BOOB-RM2-H08. We did not detect LD following Bonferroni correction. The exclusion probability for parent pairs was >0.9999. As indicated by the probability of exclusion, the microsatellite loci identified in Table 1 should be sufficient for future studies of burrowing owl mating behavior and relatedness when used alone or in combination with the microsatellite loci characterized by Korfanta et al. (2002).
Table 1

Characteristics of 18 primer pairs amplifying microsatellite DNA loci in western burrowing owls (Athene cunicularia hypugaea)

Locus

Sequence

Accession

TA

N

A

Range

Repeat

HO

HF

PIC

BUOW-BM4-A01 U

BUOW-BM4-A01 L

GGAAACAGCTATGACCATAGGATCTCCCAAACATTCTGGC

GTTTGAATCTGGACTAGATGACCTCC

GQ228862

60

23

7

321–349

(ATCT)^14

0.35a

0.76

0.72

BUOW-BM4-A09 U

BUOW-BM4-A09 L

CAGTCGGGCGTCATCAGCACTTAGGGACATGGTTTAGTGG

GTTTCCTATGAAGACCCTCAAGCCC

GQ228853

60

23

5

375–391

(AGAT)^15

0.48

0.74

0.68

BUOW-BM4-A10 U

BUOW-BM4-A10 L

GGAAACAGCTATGACCATGTCCCTGAAATGTCAATACTTA

GTTTGCTTGTGATAACAGTGAA

GQ228863

60

23

10

177–215

(AGAT)^9

0.74

0.82

0.77

BUOW-BM4-B06 U

BUOW-BM4-B06 L

GTTTCCTTATTACAAATTCACAGTG

CAGTCGGGCGTCATCAGTTCACTTTTATACATACTCCT

GQ228868

60

23

11

186–227

(AG)^10

0.91

0.87

0.83

BUOW-BM4-B12 U

BUOW-BM4-B12 L

GTTTCTCTTAGGTTTGGACTGGGACG

CAGTCGGGCGTCATCATGCTAGCCGTATTCCTCTACCC

GQ228871

60

23

7

325–348

(ATCT)^8…(AAT)^4

0.83

0.74

0.68

BUOW-BM4-C12 U

BUOW-BM4-C12 L

CAGTCGGGCGTCATCATCTCTCTTGCCAGGTGTTCAGG

GTTTAAGCGATTTGGGAACTGGTTGG

GQ228875

60

22

7

305–330

(ATCT)^14

0.68

0.78

0.74

BUOW-BM4-D03 U

BUOW-BM4-D03 L

GTTTCAGTGAGAGTGGGTTAACAGGC

CAGTCGGGCGTCATCAGGAAGATGGGTTTCAGGAACAG

GQ228876

60

23

4

407–421

(AAAT)^4

0.44

0.55

0.44

BUOW-BM4-E11 U

BUOW-BM4-E11 L

CAGTCGGGCGTCATCATCTGCTCAGTAACACAAAGCTGG

GTTTATCTGGCTACAATGCTTCAGCG

GQ228884

60

23

5

347–371

(AGTT)^7

0.35

0.38

0.34

BUOW-BM4-F11 U

BUOW-BM4-F11 L

GGAAACAGCTATGACCATGCTCAACAACTGCTCATGAAGG

GTTTACCCATCTGCCGATACGCAAG

GQ228889

60

22

6

374–392

(AAC)^11

0.64

0.78

0.72

BUOW-BM4-H06 U

BUOW-BM4-H06 L

CAGTCGGGCGTCATCATTTAGGAGCAAACCAGGGAGGC

GTTTGCCAGTCCAGTGAGGTGTTACG

GQ228854

60

23

5

374–386

(AC)^13

0.22a

0.68

0.63

BUOW-RM2-B12 U

BUOW-RM2-B12 L

CAGTCGGGCGTCATCAGGCTTCCCTCTACAGCAGGTC

GTTTGCTAAGCATTACCTCACATTGTTCC

GQ228917

60

23

5

236–246

(AG)^12

0.57

0.68

0.61

BUOW-RM2-C12 U

BUOW-RM2-C12 L

GTTTCTCATGCGGCTAATGGACAACC

CAGTCGGGCGTCATCATGGCCTGTAGGGACTTGGATAG

GQ228927

60

23

3

166–170

(GT)^6

0.30

0.38

0.32

BUOW-RM2-D04 U

BUOW-RM2-D04 L

CAGTCGGGCGTCATCAGCTACCAGAATTTGGGCATGGG

GTTTACATCTGGCATTATGTTTCCCTTC

GQ228931

60

23

3

226–230

(AC)^7

0.65

0.50

0.42

BUOW-RM2-H07 U

BUOW-RM2-H07 L

GTTTGAGGACAGTGCTGAAGTAGCC

GGAAACAGCTATGACCATTCTAGGCAGCTGATGGGAGAC

GQ228964

60

22

2

253–255

(AAC)^6

0.50

0.50

0.37

BUOW-RM2-H08 U

BUOW-RM2-H08 L

CAGTCGGGCGTCATCACAGCTCCAGTAGGCAACATAAAG

GTTTGGGATGGATCACAGGCATTTC

GQ228965

60

23

2

237–241

(CT)^6

0.04

0.04

0.04

BUOW-RM3-1-C04 U

BUOW-RM3-1-C04 L

GTTTGCACTGGTGCCAAACCTC

CAGTCGGGCGTCATCACTCAGCTAATGCATCCAGTTTCC

GQ228990

60

23

3

300–309

(AAAC)^5

0.30

0.48

0.38

BUOW-RM3-1-C09 U

BUOW-RM3-1-C09 L

GTTTGCAGCCTTTGGCAAGTCATTC

CAGTCGGGCGTCATCATCTGGCTGCTATCACTACCTTG

GQ228993

60

23

2

275–279

(AGGT)^6

0.26

0.23

0.20

BUOW-RM3-1-H08 U

BUOW-RM3-1-H08 L

CAGTCGGGCGTCATCAGCAGAGGTTGTGCAGAGTTCAG

GTTTATAGAGAGCGCCCAGTATGTCC

GQ229029

60

23

4

197–211

(AAAG)^4

0.57

0.54

0.44

Sequences used to introduce sites for the universal, fluorescent tags are in bold italics. Underlined bases indicate sharing of nucleotides between the CAG tag (5′-CAGTCGGGCGTCATCA-3′), the M13R tag (5′-GGAAACAGCTATGACCAT-3′), or the locus-specific primer binding site and the GTTT “pigtail”

U upper primer, L lower primer, TA touchdown PCR starting anneal temperature, N number of individuals successfully genotyped at each locus, A number of alleles, HO observed heterozygosity, HE expected heterozygosity, PIC polymorphic information content

aLoci deviating from HWE following Bonferroni correction

Acknowledgments

Financial support was provided by: USDA CSREES National Research Initiative to JRB, an EPA Star Fellowship to one of JRB’s students, the US Bureau of Land Management, the Idaho Department of Fish and Game, Boise State University (BSU) Department of Biological Sciences, BSU Raptor Research Center funds to JRB, and setup funds for PAG from the University of California, Los Angeles. BSU’s Institutional Animal Care and Use Committee approved the collection of burrowing owl blood samples used in this study, and we trapped and sampled burrowing owls under USGS Bird Banding Laboratory Permit #22174 and Idaho Department of Fish and Game Scientific Collecting Permit #930810 to JRB. PAG and JRB acquired funding for this research and provided the physical and intellectual resources for its pursuit; JW assisted with sample collection and preparation; BCF, AT, and KT conducted the microsatellite enrichment and data collection, BCF conducted the data analysis, and BCF, AT, PAG, and JRB wrote the manuscript.

Open Access

This article is distributed under the terms of the Creative Commons Attribution Noncommercial License which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited.

Copyright information

© The Author(s) 2010

Authors and Affiliations

  • Brant C. Faircloth
    • 1
  • Alexandra Title
    • 2
  • Kevin Tan
    • 3
  • Justin Welty
    • 4
  • James R. Belthoff
    • 4
  • Patricia Adair Gowaty
    • 1
    • 5
    • 6
  1. 1.Department of Ecology and Evolutionary BiologyUniversity of CaliforniaLos AngelesUSA
  2. 2.Department of Environmental Science, Policy & ManagementUniversity of CaliforniaBerkeleyUSA
  3. 3.Department of Microbiology, Immunology, and Molecular GeneticsUniversity of CaliforniaLos AngelesUSA
  4. 4.Department of Biological Sciences and Raptor Research CenterBoise State UniversityBoiseUSA
  5. 5.Institute of the EnvironmentUniversity of CaliforniaLos AngelesUSA
  6. 6.Smithsonian Tropical Research InstituteDPO AAUSA

Personalised recommendations