Isolation and characterization of microsatellite loci from blue-footed boobies (Sula nebouxii)

  • Brant C. Faircloth
  • Alejandra Ramos
  • Hugh Drummond
  • Patricia Adair Gowaty
Open Access
Technical Note

Abstract

Blue-footed boobies (Sula nebouxii) are socially monogamous, colonial seabirds exhibiting intra-specific nest parasitism and extra-pair copulations. Prior DNA fingerprinting assays failed to detect extra-pair offspring in the nests of congeners, and the rate of intra-specific nest parasitism has not been estimated using molecular techniques. We describe the development and characterization of 11 microsatellite DNA loci, tested using 31 individuals collected on Isla Isabel, Nayarit, México. The number of alleles per locus ranged from three to 22, averaging seven; total exclusionary power of the microsatellite panel was 0.99; no loci deviated from Hardy-Weinberg equilibrium; and we did not detect linkage disequilibrium following Bonferroni correction. This microsatellite panel will facilitate future studies of nest parasitism and extra-pair paternity in blue-footed boobies.

Keywords

Microsatellites SSRs Blue-footed booby Sula nebouxii Sulidae 

Blue-footed boobies (Sula nebouxii) are colonial seabirds that nest annually on small Pacific Ocean islands (Nelson 1978). They reproduce several times during their lifetime of up to 20 years, forming pair bonds lasting 1–5 years (Torres and Drummond, unpublished data). Female boobies lay clutches of 1–3 eggs and provide parental care jointly with males until chicks fledge at approximately 90 days. Though socially monogamous, both sexes perform consensual, extrapair copulations that peak in frequency during the female’s presumed fertile period (Osorio-Beristain and Drummond 1998; Perez-Staples and Drummond 2005) and some females lay eggs in the nests of neighbors [intraspecific nest parasitism (INP)]. Females also lay eggs in the nests of their male extra-pair partners [quasi nest parasitism (QNP)]. Observation revealed consistently hostile responses by incubating (host) females to INP and flexible responses by males to QNP-ranging from egg destruction to acceptance (Osorio-Beristain et al. 2005).

While the occurrence of extrapair and unrelated chicks in S. nebouxii nests is plausible, it remains unproven. Doubts arise because fingerprinting analyses failed to detect extrapair chicks in all congeners tested: nazca (Sula granti, Anderson and Boag 2006), masked (Sula dactylatra) and brown (Sula leucogaster) boobies (Baumgarten et al. 2001).

Understanding the evolution of extra-pair mating, mate-guarding and nest parasitism in blue-footed boobies, as well as violent conflict between broodmates (Drummond et al. 1986; Gonzalez-Voyer et al. 2007), requires assignment of genetic parentage to and estimation of relatedness between brood mates. Mendelian inheritance, combined with high levels of polymorphism, makes microsatellite loci ideal for these purposes and for analyses of small and isolated populations, like blue-footed boobies (Hedrick 1999; Selkoe and Toonen 2006). In this manuscript, we describe the isolation and characterization of 11 microsatellite loci, which we tested using 31 S. nebouxii. These are the first microsatellites characterized in members of the genus Sula.

We developed a double-enriched microsatellite library following Glenn and Schable (2005) using DNA purified (5-Prime ArchivePure Blood Kit) from blood collected from a female blue-footed booby on Isla Isabel, Nayarit, México. We modified the enrichment protocol of Glenn and Schable (2005) using MyOne C1 streptavidin beads (Invitrogen) with 2X (10 μM Tris HCl, pH 7.5; 1 μM EDTA; 2 M NaCl; 0.2% Tween 20) and 1X B&W Buffer (Invitrogen) during the enrichment steps. From this library, we selected 285 positive (white) colonies using the β-galactosidase gene and bi-directionally sequenced colony PCR products of 500–1,200 base pairs using 1/16th BigDye [v3.1, Applied Biosystems (ABI)] sequencing reactions and an ABI PRISM 3730xl sequencer. We aligned and edited sequences and assembled 179 contigs using Sequencher 4.2 (Gene Codes Corp.). Prior to primer design, we tested for sequence homology using BLAST (Altschul et al. 1990).

Using MSATCOMMANDER (Faircloth 2008), we located microsatellite repeat arrays within 68 contigs, designed 45 primers, and applied 5′-tags (CAG or M13R) to primer pairs for subsequent polymorphism testing (Boutin-Ganache et al. 2001; Glenn and Schable 2005). We reviewed contigs containing repeats for which the automated software indicated primer design errors, and we manually designed primers for these regions (N = 15) using Oligo 6.0 (Molecular Biology Insights) and the 5′-tagging approach. We added GTTT “pigtails” to the 5′ end of each primer lacking either CAG or M13R tag to facilitate the addition of adenosine by Taq polymerase (Brownstein et al. 1996).

We tested 60 primer pairs for amplification using phenol-chloroform purified DNA collected from three blue-footed boobies on Isla Isabel during 1994. We performed PCR amplifications in 10 μL volumes using ABI 9700 thermal cyclers. Concentrations for reactions were 10 mM Tris pH 8.4, 50 mM KCl, 0.5 μM “pigtailed” primer, 0.05 μM CAG or M13-reverse (M13R) tagged primer (CAG or M13R + primer), 0.45 μM dye labeled tag (Dye + CAG or M13R), 1.5 mM MgCl2, 0.5 mM dNTPs, 0.5 U AmpliTaq Gold DNA Polymerase (ABI), and 20 ng DNA. We labeled M13R and CAG universal primers with VIC, NED, FAM, or PET fluorescent dyes (ABI). We performed reactions using a touchdown thermal cycling program (Don et al. 1991), and we evaluated each primer at a starting annealing temperature of 60°C. We used the following cycling parameters: 1 cycle of 95°C for 5 m; followed by 20 cycles of 95°C for 20 s, 60°C for 30 s minus 0.5°C per annealing cycle, and 72°C for 90 s; followed by 20 cycles of 95°C for 20 s, 50°C for 30 s, 72°C for 90 s; and a final extension period of 10 m at 72°C. We scored each amplicon using an ABI Prism 3730xl DNA Sequencer in combination with LIZ600 fluorescent size standard (ABI), GeneMapper 4.0 Software (ABI) and the Local Southern size calling method.

Based on the performance of primers during the initial test, we selected 18 primer pairs for subsequent optimization and polymorphism testing. The primers we did not select for additional testing were monomorphic (N = 25, 78%) or failed to amplify (N = 7, 22%) during the initial test. We optimized and screened primers using phenol-chloroform purified DNA collected from 31 individuals sampled on Isla Isabel and amplification conditions identical to those presented above. When visual assessment of resulting peak morphologies indicated that increased annealing temperatures might improve amplification quality, we also genotyped and scored loci using a starting annealing temperature of 65°C (−0.5°C step). We selected the starting annealing temperature resulting in the most precise peaks without inducing allelic dropout, and we removed any loci from the candidate set yielding ambiguous peaks or inconsistent results.

We calculated observed (HO) and expected (HE) heterozygosity and polymorphic information content (PIC) using Cervus 3.0 (Marshall et al. 1998; Kalinowski et al. 2007), and we tested for deviations from Hardy-Weinberg equilibrium (HWE) and evaluated genotypic linkage disequilibrium (LD) using Genepop (Raymond and Rousset 1995). We conducted a posteriori Bonferroni correction (Rice 1989) for each analysis consisting of multiple, concurrent statistical tests (HWE and LD).

Table 1 presents the characteristics of 11 primer pairs amplifying microsatellite loci in blue-footed boobies. The number of alleles ranged from three to 22, averaging seven. No loci deviated from HWE, and we did not detect LD following Bonferroni correction. Total exclusionary power with both parents unknown was 0.99.
Table 1

Characteristics of 11 primer pairs amplifying microsatellite DNA loci in blue-footed boobies (Sula nebouxii) sampled from Isla Isabel, Nayarit, México

Locus

Sequence

Accession

Anneal

N

A

Range

Repeat

HO

HE

PIC

BOOB-RM2-F07 U

GTTTGCTAATCCCCTGGTGCAAGTG

FJ587350

60

30

3

389–397

(CT)^8

0.60

0.59

0.50

BOOB-RM2-F07 L

GGAAACAGCTATGACCATACATCCGGTGCTCAGTTGTG

BOOB-RM3-D07 U

GTTTGGCCTACTGCCATCCAGGG

FJ587394

60

31

15

325–399

(AAAG)^35… (AAAG)^5

0.87

0.90

0.87

BOOB-RM3-D07 L

CAGTCGGGCGTCATCAGTTGCTCATAAACAGGCTGGTATTC

BOOB-RM3-F11 U

GTTTAGAGGGTGTAGGCTGAAATC

FJ587411

60

31

22

281–420

(CTTTT)^41

0.97

0.95

0.94

BOOB-RM3-F11 L

CAGTCGGGCGTCATCATTCTCTAGGCAAGGATCAATACC

BOOB-RM4-A08 U

GTTTCCTGAAAGTCCTTTATTGTGGAGGG

FJ587430

60

31

3

398–406

(AG)^6…(AGAT)^7…(ACAG)^6

0.58

0.54

0.42

BOOB-RM4-A08 L

CAGTCGGGCGTCATCAGCCTAGCACAGGGGTG

BOOB-RM4-B03 U

CAGTCGGGCGTCATCATGGACCAGCAGCTAAGGC

FJ587372

65

31

3

385–389

(AT)^6…(ATGT)^5

0.29

0.37

0.32

BOOB-RM4-B03 L

GTTTAGGTGAGTGGCTGGGTGG

BOOB-RM4-C03 U

CAGTCGGGCGTCATCATGGTCAAACAGTAACATGACAAGGAC

FJ587442

60

31

11

336–432

(AAAG)^29

0.84

0.80

0.77

BOOB-RM4-C03 L

GTTTCCAGTAACAACCACTCAGTTCAGG

BOOB-RM4-D07 U

CAGTCGGGCGTCATCAGCCACCCTCAAGCCATTCC

FJ587311

65

31

3

213–239

(GGAT)^13

0.52

0.45

0.36

BOOB-RM4-D07 L

GTTTCCAACAGTTCTGCTGCTCAC

BOOB-RM4-E03 U

GTTTGAGCTGTGTTCCAAAGTTGCTC

FJ587457

65

31

3

313–317

(ATCT)^7…(CT)^10…(ATCC)^4

0.39

0.36

0.33

BOOB-RM4-E03 L

CAGTCGGGCGTCATCATTTCTGTCCTGGTTAAAATTCCC

BOOB-RM4-E10 U

CAGTCGGGCGTCATCAAGTGCGCAGGGAAAACAG

FJ587461

65

31

5

251–267

(ATCT)^15…(ATCT)^4

0.65

0.62

0.53

BOOB-RM4-E10 L

GTTTGGCTGGCAGGGCTTTGTG

BOOB-RM4-F11 U

GTTTGTTGCTCAGGACATGCATCC

FJ587469

60

31

5

287–307

(AATAG)^12

0.61

0.61

0.54

BOOB-RM4-F11 L

CAGTCGGGCGTCATCACAAAGTCCAATTGACAGCCAG

BOOB-RM4-G03 U

CAGTCGGGCGTCATCAGGCAGCACTCAAGCTGAAGG

FJ587472

65

30

5

167–197

(ATCCT)^11

0.67

0.64

0.56

BOOB-RM4-G03 L

GTTTCTCAAGGTAGGGCAGGGTC

Sequences used to introduce sites for the universal, fluorescent tags are in bold italics. Underlined bases indicate sharing of nucleotides between the CAG tag (5′ - CAGTCGGGCGTCATCA - 3′), the M13R tag (5′ - GGAAACAGCTATGACCAT - 3′), or the locus-specific primer binding site and the GTTT “pigtail”. U upper primer; L lower primer; N number of individuals successfully genotyped at each locus; A number of alleles; HO observed heterozygosity; HE expected heterozygosity; PIC polymorphic information content

Incorporation of the MyOne C1 Streptavidin beads to the process did not appear to increase the efficiency of enrichment for fragments containing microsatellite repeats (38%) when compared to the older M-280 beads (≈50–60%, Crawford et al. 2009, BC Faircloth unpublished data). This observation may be species-specific or a general indication that the M-280 beads are more efficient for the purpose of microsatellite enrichment. Others (S Lance and T Glenn, University of Georgia, personal communication) have observed reduced enrichment efficiencies using MyOne C1 beads and B&W hybridization buffer.

The microsatellite loci identified here will serve as a useful resource for future studies of blue-footed boobies requiring a panel of polymorphic DNA markers.

Notes

Acknowledgements

Financial support was provided by: Universidad Nacional Autónoma de México; a UC-Mexus Small Grant to PAG and HD; and setup funds for PAG from the University of California, Los Angeles. We conducted blue-footed booby blood collection on Isla Isabel, Nayarit, Mexico under permits granted to HD by SEDESOL and SEMARNAT as part of his long-term research program on the island. The authors thank Tania del Rio Albrechtsen, Alejandra Nuñez and Sergio Ancona for collecting blood, and the Mexican Navy, San Blas fishermen and Isla Isabel staff for providing transportation and logistical support. BCF thanks Jonathan Drury, Kevin Tan and Alexandra Title for their assistance during the microsatellite enrichment process. PAG and HD acquired funding for this research and provided the physical and intellectual resources for its pursuit, BCF and AR conducted the data collection, BCF conducted the data analysis, and BCF and AR wrote the manuscript.

Open Access

This article is distributed under the terms of the Creative Commons Attribution Noncommercial License which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited.

References

  1. Altschul SF, Gish W, Miller W et al (1990) Basic local alignment search tool. J Mol Biol 215:403–410PubMedGoogle Scholar
  2. Anderson DJ, Boag PT (2006) No extra-pair fertilization observed in nazca booby (Sula granti) broods. Wilson J Ornithol 118:244–247CrossRefGoogle Scholar
  3. Baumgarten MM, Kohlrausch AB, Miyaki CY et al (2001) DNA fingerprinting and parentage in masked (Sula dactylatra) and brown (S. leucogaster) boobies. Ornitol Neotrop 12:319–326Google Scholar
  4. Boutin-Ganache I, Raposo M, Raymond M et al (2001) M13-tailed primers improve the readability and usability of microsatellite analyses performed with two different allele-sizing methods. BioTechniques 31:24–28PubMedGoogle Scholar
  5. Brownstein MJ, Carpenter JD, Smith JR (1996) Modulation of non-templated nucleotide addition by Taq polymerase: primer modifications that facilitate genotyping. BioTechniques 20:1004–1010PubMedGoogle Scholar
  6. Crawford NG, Peters MB, Hagen C et al (2009) Polymorphic microsatellite loci from Sprague’s pipit (Anthus spragueii), a grassland endemic passerine bird. Mol Ecol Res 9:315–317CrossRefGoogle Scholar
  7. Don RH, Cox PT, Wainwright BJ et al (1991) Touchdown PCR to circumvent spurious priming during gene amplification. Nucleic Acids Res 19:4008CrossRefPubMedGoogle Scholar
  8. Drummond H, González E, Osorno JL (1986) Parent-offspring cooperation in the blue-footed booby (Sula nebouxii): social roles in infanticidal brood reduction. Behav Ecol Sociobiol 19:365–372CrossRefGoogle Scholar
  9. Faircloth BC (2008) MSATCOMMANDER: detection of microsatellite repeat arrays and automated, locus-specific primer design. Mol Ecol Res 8:92–94CrossRefGoogle Scholar
  10. Glenn TC, Schable NA (2005) Isolating microsatellite DNA loci. In: Zimmer EA, Roalson EH (eds) Methods in enzymology 395, molecular evolution: producing the biochemical data, Part B. Academic Press, San Diego, CAGoogle Scholar
  11. Gonzalez-Voyer A, Székely T, Drummond H (2007) Why do some siblings attack each other? Comparative analysis of aggression in avian broods. Evol Int J org Evol 61:1946–1955Google Scholar
  12. Hedrick PW (1999) Perspective: highly variable loci and their interpretation in evolution and conservation. Evol Int J org Evol 53:313–318Google Scholar
  13. Kalinowski ST, Taper ML, Marshall TC (2007) Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Mol Ecol 16:1006–1099CrossRefGoogle Scholar
  14. Marshall TC, Slate J, Kruuk LEB et al (1998) Statistical confidence for likelihood-based paternity inference in natural populations. Mol Ecol 7:639–655CrossRefPubMedGoogle Scholar
  15. Nelson B (1978) The Sulidae: gannets and boobies. Oxford University Press, OxfordGoogle Scholar
  16. Osorio-Beristain M, Drummond H (1998) Non-aggressive mate guarding by the blue-footed booby: a balance of female and male control. Behav Ecol Sociobiol 43:307–315CrossRefGoogle Scholar
  17. Osorio-Beristain M, Perez-Staples D, Drummond H (2005) Does booby egg dumping amount to quasi-parasitism? Ethology 112:625–630CrossRefGoogle Scholar
  18. Perez-Staples D, Drummond H (2005) Tactics, effectiveness and avoidance of mate guarding in the blue-footed booby (Sula nebouxii). Behav Ecol Sociobiol 59:115–123CrossRefGoogle Scholar
  19. Raymond M, Rousset F (1995) GENEPOP (version 1.2) population genetics software for exact tests and ecumenicism. J Hered 86:248–249Google Scholar
  20. Rice WR (1989) Analyzing tables of statistical tests. Evol Int J org Evol 43:223–225Google Scholar
  21. Selkoe KA, Toonen RJ (2006) Microsatellites for ecologists: a practical guide using and evaluating microsatellite markers. Ecol Lett 9:615–629CrossRefPubMedGoogle Scholar

Copyright information

© The Author(s) 2009

Authors and Affiliations

  • Brant C. Faircloth
    • 1
  • Alejandra Ramos
    • 2
  • Hugh Drummond
    • 2
  • Patricia Adair Gowaty
    • 1
    • 3
    • 4
  1. 1.Department of Ecology and Evolutionary BiologyUniversity of CaliforniaLos AngelesUSA
  2. 2.Departamento de Ecología Evolutiva, Instituto de EcologíaUniversidad Nacional Autónoma de MéxicoMéxicoMéxico
  3. 3.Institute of the EnvironmentUniversity of CaliforniaLos AngelesUSA
  4. 4.Smithsonian Tropical Research Institute, Unit 0948Panama CityRepublic of Panama

Personalised recommendations