Advertisement

Polymorphism of DNA Repair Genes via Homologous Recombination (HR) in Ovarian Cancer

  • Beata SmolarzEmail author
  • Magdalena M. Michalska
  • Dariusz Samulak
  • Hanna Romanowicz
  • Luiza Wójcik
Open Access
Original Article
  • 153 Downloads

Abstract

Ovarian cancer is one of the most common types of cancer in women. The repair system via homologous recombination repairs double-strand breaks (DSB) of DNA, which are the most mortal for cell, out of all DNA damages. The genes, which encode the double-strand break repairing proteins, are highly polymorphic and, taking into account the significance of the repaired defects for cancer development, it seems important to learn the role of the polymorphisms in ovarian cancer development. The aim of the study was to determine the relationship between DNA repair genes via homologous recombination (HR) and modulation of the risk of ovarian cancer. The following polymorphisms were analysed: XRCC3-Thr241Met (rs861539), XRCC2--41657C/T (rs718282), XRCC2-Arg188His (rs3218536), BRCA1-Q356R (rs1799950) and RAD51–135 G/C (rs1801320). The study group included 600 patients with ovarian cancer and 600 healthy controls. The PCR-RFLP (PCR-based restriction fragment length polymorphism) technique was applied for polymorphism analysis. Allele XRCC3-241Met (OR 0.85, 95%CI 0.72–0.99, p < 0.045), XRCC2-41657 T (OR 1.67, 95% CI 1.42–1.96, p < .0001), BRCA1-356R (OR 1.61; % CI 1.37–1.90, p < .0001) and RAD51–135C (OR 5.16; 95% CI 4.29–6.20, p < .0001) strongly correlated with the neoplastic disease. No relationship was observed between the studied polymorphisms and the cancer progression stage according to FIGO classification. The results indicate that polymorphisms of DNA repair genes via homologous recombination may be associated with the incidence of ovarian cancer. Further research on larger groups is warranted to determine the influence of above-mentioned genetic variants on ovarian cancer risk.

Keywords

Ovarian cancer DNA repair Polymorphism Gene 

Introduction

Ovarian cancer is the fourth most common cause of cancer among women in Poland. Because of the current lack of unequivocal molecular markers of ovarian carcinoma in its early stages, the primary objective of our study became an evaluation of the possibility to enrich the range of molecular markers, allowing for a more effective prognosis of ovarian cancer formation [1].

Cancer diseases are driven by a compromised DNA repair capacity [2]. The repair process usually encompasses two stages: the excision of lesion and the repair synthesis. This is how repair system act via base-excision repair (BER), nucleotide excision repair (NER), and mismatch repair (MMR) [3]. Totally converse is the repair system activity by direct lesion reversal, in which there is merely a single-stage process with maintained integrity of the DNA phosphodiester chain and the system of recombination repair. Defects of the proteins, which directly participate in DNA repair and its control, are associated with an increased susceptibility to malignant changes. The genes of the DNA lesion repair systems play the key role in maintaining the genome integrity and control the repair of mutation-affected DNA [4, 5]. Without the genes, DNA would continue the accumulation of errors which would within a short time prevent further cell survival. Proper DNA repair ensures genomic integrity and plays a significant role in its protection against effects of carcinogenic factors. The polymorphism of repair genes may influence the performance of the process, by which defects of genetic material are removed, thus influencing the individual susceptibility to formation of neoplastic disease [6].

The repair by recombination enables removal of a number of serious DNA lesions, including double-stranded breaks [7, 8, 9]. These breaks may bring about a loss of some chromosomes, causing translocation of genetic material between them. The repair pathway via homologous recombination allows for lesion removal, while ensuring high reproduction faithfulness of the primary sequence of modified DNA. A DNA molecule, characterised by sequential homology (usually, it is the undamaged homolog of the chromosome) is used as an array in the rep air process of damaged chromosome [10]. There were more than 130 DNA repair genes identified, in which a series of single nucleotide polymorphisms (SNPs) were discovered [11].

In order to define the role, which may be played by these variants in modulating the risk of cancer formation, it is necessary to define their functional significance. The variability, perceived in DNA repair genes, may be of clinical importance for evaluation of the risk of occurrence of a given type of cancer, its prophylactics and therapy.

We studied the relationship between the polymorphisms of DNA repair genes via homologous recombination and the predisposition to malignancies in the ovary. The following polymorphisms were analysed: XRCC3-Thr241Met (rs861539), XRCC2--41657C/T (rs718282), XRCC2-Arg188His (rs3218536), BRCA1-Q356R (rs1799950) and RAD51–135 G/C (rs1801320).

The goals of our studies included:
  1. 1.

    Searching for genetic polymorphisms which participate in DNA damage repair pathways via homologous recombination, which may lead to the risk of malignancy formation.

     
  2. 2.

    Comparison of DNA repair polymorphisms via homologous recombination in

    the process of neoplasia.

     
  3. 3.

    Evaluation of the significance of obtained study results as new risk factors for neoplasia in the Polish population.

     

Materials and Methods

Patients

Formalin-fixed paraffin-embedded (FFPE) tumor tissue specimens were obtained from ovarian cancer patients (n = 600), treated at the Departments of Gynaecology, Polish Mother’s Memorial Hospital - Research Institute in Lodz during the years 2003–2017. All the diagnosed tumors were assessed by criteria of the International Federation of Gynaecology and Obstetrics (FIGO). The study groups of patients were ethnically uniform, including females of the Polish origin, inhabitants of the Lodz Region. In addition 600 normal ovarian tissue (control samples) was obtained from women undergoing laparoscopy for non-malignant conditions. See Table 1 for a complete specification of the patients. Histopathological studies were carried out at the Department of Clinical Pathomorphology. The Local Ethic Committee approved the study and each patient gave written informed consent. (No 33/2015).
Table 1

The characteristics summary of ovarian cancer patients

Characteristics

Number of cases (%)

Number of controls (%)

Median age (range)

41.2 (37–79)

43.1 (35–77)

Menarche

< 12 years old

270 (45.0%)

200 (30%)

> 12 years old

330 (55.0%)

400 (70%)

Number of pregnancy

1

252 (42.0%)

240 (40%)

2–3

200 (33.3%)

180 (30%)

>4

148 (24.7%)

180 (30%)

Use of hormone replacement therapy - HRT

Yes

410 (68.3%)

390 (75%)

No

190 (31.7%)

210 (35%)

Body mass index (BMI) (kg/m2)

<24.9

200 (33.3%)

195 (32.5%)

25–29.9

240 (40.0%)

210 (35.0%)

>30

160 (26.7%)

195 (32.5%)

Family cancer

Yes

310 (51.7%)

 

No

290 (48.3%)

 

Histology of tumour

Serous

176 (29.3)

 

Mucinous

48 (8.0)

 

Endometrioid

149 (24.8)

 

Clear cell

51 (8.5)

 

Undifferentiated

131 (21.8)

 

Other

45 (7.5)

 

Grading

G1

170 (28.3%)

 

G2

405 (67.5%)

 

G3

25 (4.2%)

 

Size of tumor

> 5 cm

170 (28.3%)

 

< 5 cm

430 (71.7%)

 

Tumour wall infiltration/injury

Present

220 (36.7%)

 

Absent

380 (63.3%)

 

n = 600

DNA Isolation

DNA was extracted using a QIAamp DNA FFPE Tissue Kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer instruction.

PCR-RFLP Analyses

Genomic DNA was isolated and the SNPs in DNA repair genes were determined by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. The reactive mixture, used when copying the fragments of all studied genes, had the same composition except the starting sequences (Table 2). Polymorphisms of the DNA repair gene was determined by PCR-RFLP, using the primers specified in Table 2. The 50 μL PCR mixture contained about 100 ng of DNA, 12.5 pmol of each primer, 0.2 mmol/L of dNTPs, 2 mmol/L of MgCl2 and 1 U of Taq DNA polymerase (TaKaRa, Japan). Amplification was carried out in a PTC-100 thermocycler of MJ Research Inc. (Walthman, MA, USA) in conditions, tailored to each of the selected genes (see Table 3).
Table 2

Primers used to analyze SNPs of the DNA repair gene

Gene

Polymorphism

Primer sequence

forward

reverse

XRCC3

Thr241Met

5′ACAGGGCTCTGGAAGGCACTGCTCAGCTCACGCACC3′

5′GCCTGGTGGTCATCGACTC3′

XRCC2

Arg188His

5’TGTAGTCACCCATCTCTCTGC3′

5′AGTTGCTGCCATGCCTTACA3′

XRCC2

-41657C/T

5′GGAGGCCGCAATGAGCTGAGATG3′

5′TCGGGAAGCTGAGGTGGGAGGA3′

RAD51

135G/C

5′TGGGAACTGCAACTCATCTGG3′

5′GCGCTCCTCTCTCCAGCAG3′

BRCA1

Q356R

5′-GGA CTC CCA GCA CAG AAAAA-3′

5′-TCC CCA TCA TGT GAG TCATC-3′

Table 3

Thermal cycler conditions for PCR and fragment lengths for polymorphic variants of the studied DNA repair genes

Gene

Polymorphism

Thermal cycler conditions

Restriction endonuclease

Fragments after digestion (bp)

XRCC3

Thr241Met

1. 95 ° C – 5 min

2. 95 ° C – 20 s

3. 63 ° C – 20 s

4. 72 ° C – 20 s

5. 2 → 3 → 4 × 35 cycles

6. 72 °C – 3 min

NcoI

Thr/Thr: 136

Thr/Met: 136, 97, 39

Met/Met: 97, 39

XRCC2

Arg188His

1. 95 ° C – 5 min

2. 95 °C – 20 s

3. 60 °C – 20 s

4. 72 °C – 20 s

5. 2 → 3 → 4 × 35 cycles

6. 72 °C – 3 min

HpnI

Arg/Arg: 290

Arg/His: 290, 148, 142

His/His: 148, 142

XRCC2

-41657C/T

1. 95 ° C – 5 min

2. 95 °C – 40 s

3. 72 °C – 45 s

4. 72 °C – 60 s

5. 2 → 3 → 4 × 35 cycles

6. 72 °C – 3 min

MvaI

C/C: 315, 59, 42,

C/T: 357, 315, 59, 42

T/T: 357, 59

RAD51

135 G/C

1. 95 °C – 5 min

2. 95 °C – 20 s

3. 68 °C – 20 s

4. 72 °C – 20 s

5. 2 → 3 → 4 × 35 cycles

6. 72 °C – 3 min

MvaI

G/G: 86, 71

G/C: 157, 86, 71

C/C: 157

BRCA1

Q356R

1. 95 ° C – 3 min

2. 95 °C – 30 s

3. 57 °C – 45 s

4. 72 °C – 1 min

5. 2 → 3 → 4 × 35 cycles

6. 72 °C – 7 min

AluNI

R/R: 211

Q/Q: 134, 77

Q/R: 211, 134, 77

In order to obtain allelic variants of particular genes, the obtained PCR products were submitted to incubation with appropriate restrictive enzymes, revealing target sequences at polymorphic site within one of the variants. The PCR products, contained in 10 μl of the reactive mixture, were incubated for 16 h with 1 U of an appropriate restrictive enzyme (see Table 3). All the applied enzymes were products of the MBI Fermentas Company (Vilnius, Lithuania). Table 3 presents fragment lengths for various polymorphic variants of the studied DNA repair genes.

Statistical Analysis

The effect of polymorphisms on the risk of cancer formation was evaluated by odds ratio (OR), together with 95% confidence interval (CI), obtained by means of a logistic regression model. The wild type of genotype and allele acted as reference.

In order to verify whether the Hardy-Weinberg principle is reflected in the studied populations, a specific computer program was applied, being available at the www.ihg.gfs.de (Institute of Human Genetics, Technical University Munich and Helmholtz Center Munich).

All the statistical tests were carried at the level of significance α = 0.05. In order to verify the hypothesis about the significance of age, body mass index (BMI), menarche, hormonal replacement therapy, and family cancer in the studied group, the χ2 analysis was used. P-values <0.05 were considered significant.

Results

This study demonstrated that XRCC3-Met/Met genotype of Thr241Met polymorphism was statistically significantly correlated with ovarian cancer (Table 4). The Met/Met homozygote decreased the risk of cancer (OR 0.70; 95% CI 0.50–0.97, p = 0.041).
Table 4

Distribution of DNA repair genes genotype in patients and control group

 

Patients (n = 600)

Controls (n = 600)

  

XRCC3-Thr241Met

Number

(%)

Number

(%)

OR (95% CI)a

p b

Thr/Thr

147

24.5

117

19.5

1.00 Ref

 

Thr/Met

307

51.2

317

52.8

0.77 (0.57–1.03)

0.090

Met/Met

146

24.3

166

27.7

0.70 (0.50–0.97)

0.041

Thr

601

50.1

551

45.9

1.00 Ref

 

Met

599

49.9

649

54.1

0.85 (0.72–0.99)

0.045

XRCC2- -41657C/T

Number

(%)

Number

(%)

OR (95% CI)a

p

C/C

150

25.0

180

30.0

1.00 Ref

 

C/T

150

25.0

240

40.0

0.75 (0.56–1.01)

0.067

T/T

300

50.0

180

30.0

2.00 (1.50–2.66)

<.0001

C

450

37.5

600

50.0

1.00 Ref

 

T

750

62.5

600

50.0

1.67 (1.42–1.96)

<.0001

XRCC2-Arg188His

Number

(%)

Number

(%)

OR (95% CI)a

p

Arg/Arg

177

29.5

190

31.7

1.00 Ref

 

Arg/His

243

40.5

220

36.6

1.19 (0.90–1.56)

0.250

His/His

180

30.0

190

31.7

1.02 (0.76–1.36)

1.000

Arg

597

49.8

600

50.0

1.00 Ref

 

His

603

50.2

600

50.0

1.01 (0.86–1.18)

0.920

BRCA1- Q356R

Number

(%)

Number

(%)

OR (95% CI)a

p

Q/Q

155

25.8

190

31.7

1.00 Ref

 

Q/R

155

25.8

226

37.7

0.84 (0.62–1.13)

0.279

R/R

290

48.4

184

30.6

1.93 (1.46–2.56)

<.0001

Q

465

38.8

606

50.5

1.00 Ref

 

R

735

61.2

594

49.5

1.61 (1.37–1.90)

<.0001

RAD51–135G/C

Number

(%)

Number

(%)

OR (95% CI)

p

G/G

89

14.8

147

24.5

1.00 Ref

 

G/C

50

8.4

363

60.5

0.23 (0.15–0.34)

<.0001

C/C

461

76.8

90

15.0

8.46 (5.98–11.96)

<.0001

G

228

19.0

657

54.8

1.00 Ref

 

C

972

81.0

543

45.2

5.16 (4.29–6.20)

<.0001

aCrude odds ratio (OR), 95% CI = confidence interval at 95%, bChi square

Arg188His and -41657C/T polymorphisms of XRCC2 gene, respectively were analysed in patients. The prevalence of -41,657 T allele in those studies was statistically significantly higher in the group of patients with ovarian cancer vs. the control group (OR 1.67; 95% CI 1.42–1.96, p < .0001). The T/T homozygote may increase the risk of cancer (OR 2.00; 95% CI 1.50–2.66, p < .0001). The −41,657 T allele increased the risk of cancer progression (Table 4).

No statistically significant differences were observed in genotype frequencies of XRCC2 Arg188His polymorphism between the control group and the ovarian cancer patients (see Table 4).

A correlation was found of Q356R BRCA1 gene polymorphism with ovarian cancer in the examined patients. Based on the obtained results, it was demonstrated that 356R allele predisposed to cancer development (OR 1.61; 95% CI 1.37–1.90, p < 0.001). The R/R genotype may increase the risk of cancer (OR 1.93; 95% CI 1.46–2.56, p < .0001).

The studies successfully demonstrated that 135C allele of RAD51 gene 135G/C polymorphism was correlated with an increased risk of ovarian cancer in the studied population (OR 5.16; 95% CI 4.29–6.20, p < 0.001). The C/C homozygote may increase the risk of progression of the studied cancer (OR 8.46; 95% CI (5.98–11.96, p < 0.001).

No relationship was observed between the studied polymorphisms and the cancer progression stage acc. to FIGO classification.

The studied polymorphisms of DNA repair genes via HR were not associated with other risk factors, such as the body mass index (BMI), menarche, number of pregnancy and hormonal replacement therapy (p > 0.05).

Discussion

The identification of cancer risk markers is one of major challenges for contemporary medicine. The observed imperfections of cancer prophylactics result, among others, from:
  • the identification of pathology at the stage of morphological, and not molecular changes,

  • possible technical and diagnostic errors,

  • the necessity of frequent repetitions of diagnostic procedures,

  • impossibility of pathology progression prognosis [12, 13]

At the actual level of medical knowledge, we are capable of dealing with almost any type of cancer, provided it is identified early enough. There are many factors which play a significant role in triggering cancer formation process, with genetic factors being of major significance. Ovarian cancer is characterised by the occurrence of different genetic changes in various genes [14, 15, 16, 17]. Consequently, it is often not possible to give a straightforward answer to the question, whether these changes are more like causes or more like effects of the disease. If they are perceive as causes, it is justified to study if the genetic variability, observed in many populations and defined as genetic polymorphism, may in any way contribute to induction and/or development of malignant changes, including ovarian cancer. The discovery of genetic background for the cancer formation process is an extremely difficult challenge, as in the majority of cases, the reason lies in a combined activity of several factors.

A set of alleles of repair protein encoding genes may largely define the individual abilities for DNA damage repair, as well as the susceptibility to tumour development [18, 19]. The single nucleotide polymorphisms (SNPs) may change the risk of cancer disease. SNPs may then be regarded as potential markers of carcinogenesis [20, 21].

The repair system via homologous recombination repairs double-strand breaks (DSB) of DNA, which are the most mortal for cell, out of all DNA damages [7, 9].

Non-repaired DSBs cause a loss of chromosome fragments and, in consequence, cellular death. Accumulated DSBs lead to genome destabilisation and to its rearrangement. Disorders in genome DNA are accumulated with the advancing age of organisms, causing deregulation of transcription process, leading to cancer formation. The genes, which encode the double-strand break repairing proteins, are highly polymorphic and, taking into account the significance of the repaired defects for cancer development, it seems important to learn the role of the polymorphisms in ovarian cancer development.

As literature data demonstrate DNA damages to be highly significant in the pathogenesis of ovarian cancer, especially those which require repair by homologous recombination. Therefore, my studies were continued in an analysis of subsequent polymorphisms in the gene, which encoded the protein, participating in repair by homologous recombination.

The first stage of the study concentrated on an evaluation of XRCC2 gene Arg188His and XRCC3 gene Thr241Met polymorphisms. XRCC2 and XRCC3 genes belong to the DNA repair system via a homological recombination, which removes a number of serious DNA defects, such as, for example, two-strand breaks [22, 23].

A consequence of faulty repair may be a loss of some chromosomes and translocation of genetic material, what may lead to the development of cancers [8, 24, 25, 26].

Moreover, they are strong inducers of programmed cell death. The system of repair via homologous recombination allows for defect removal, ensuring high reproduction accuracy of the primary sequence of modified DNA. The cells, which are defective with regard to XRCC2 and XRCC3 genes, demonstrate a particular sensitivity to ionising radiation, UV and to factors which induce cross-bonding formation [27].

XRCC2 Arg188His and XRCC3 Thr241Met polymorphisms were selected for their documented participation in the pathogenesis of cancers. Following the data from world literature, both polymorphisms may increase the risk of occurrence of various neoplasms, including pancreas, ovary, breast, head and neck carcinoma [28, 29, 30, 31, 32, 33, 34, 35].

The presented study demonstrated a significant association of studied Thr241Met polymorphism of XRCC3 gene with the occurrence of ovarian cancer. In the reported study, the second investigated polymorphism, Arg188His of XRCC2 gene, was not associated with ovarian carcinoma occurrence.

A subsequent stage of the study focused on 41657C/T polymorphism of XRCC2 gene. It has been demonstrated in a number of reports that it plays a significant role in the development of neoplastic diseases, including ovarian cancer [36, 37, 38, 39].

The presented studies, carried out within the population of Polish women, confirmed the relationship of the studied XRCC2 gene polymorphism to the development of ovarian cancer.

The search for markers of ovarian cancer development was carried on in the further part of the study by an analysis of the polymorphisms of HR genes (RAD51 and BRCA1). It was demonstrated in the literature reports that the 135G/C and Q356R polymorphisms of RAD51 and BRCA1 genes, respectively, were associated with an increased risk of cancer and influenced the histological malignancy grading [40, 41].

Earlier reports of many researchers, dealing with SNPs in RAD51 gene, with my co-authorship as well, concentrated mainly on G135C and G172 T polymorphisms at 5′ region, not subject of translation. Since RAD51 participates in DNA repair, while also interacting with BRCA proteins, the mutations of which are often identified in ovarian cancer, the above-mentioned polymorphisms may be associated with a higher risk of this cancer development [42, 43].

Previous studies suggest that RAD51 gene 135G/C polymorphism was associated with susceptibility to breast cancer and head-and-neck cancer [44, 45].

Recently, a variety of studies have focused on the association between the 135G/C polymorphism in the RAD51 gene and ovarian cancer. However, the observed associations of these studies were inconclusive [46, 47, 48].

135G/C polymorphism can modify the way of mRNA splicing, what, in turn, affects the protein functions or the effectiveness of translation [49].

In spite of the abundance of results, there is still no unequivocal explanation of the role of RAD51 in cancer formation. Our assumption was such that another genetic variability could act either additively or independently of the above-mentioned polymorphisms in 5’UTR region, what may help explain the role of RAD51 in ovarian cancer development. The presented study demonstrated a significant association of studied 135G/C and Q356R polymorphisms of RAD51 and BRCA1 genes, respectively, with the occurrence of ovarian cancer.

Conclusion

A significant correlation was revealed between single nucleotide polymorphisms of DNA double-strand break repair genes via homologous recombination (HR) XRCC3-Thr241Met (rs861539), XRCC2--41657C/T (rs718282), BRCA1-Q356R (rs1799950) and RAD51–135 G/C (rs1801320) and ovarian cancer development.

Our research are affected certain limitations. The sample for the present study comprised of 600 patients. This sample is only a very small proportion of the entire population of ovarian carcinoma women in the country. Therefore the obtained results can not be considered as definitive and require further, more extensive evaluations, performed on bigger groups of patients.

To conclude, the SNPs within the analysed genes of DNA repair systems comprise the new potentially important group of risk factors of ovarian cancer development in the Polish women. The SNPs analysis may be used in the near future as a convenient method of selecting patients with high risk of morbidity. However, considering the equivocal results of the studies presented in the literature, further research in this field on larger groups of patients is recommended.

Notes

Acknowledgements

Authors acknowledge the financial support provided by the Institute of Polish Mother’s Memorial Hospital, Lodz, Poland, to conduct the study.

Author’s Contributions

Conceived and designed the experiments: BS. Performed the experiments – case group: MMM, DS, HR. Case group design and collect: MMM, DS, HR. Performed the experiments – control group: BS. Analysed data: BS. Contributed reagents/materials/analysis tools BS. Contributed to the writing of manuscript: BS, LW. All authors approved the final manuscript.

Funding

This work was supported by the Institute of Polish Mother’s Memorial Hospital, Lodz, Poland from the Statutory Development Fund.

Compliance with Ethical Standards

All procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 Helsinki declaration and its later amendments or comparable ethical standards.

Ethics Approval

All the study participants gave a written informed consent. A formal consent was also issued by the Bioethical Committee of the Institute of the Polish Mother’s Memorial Hospital in Lodz (Approval number, No 33/2015).

Informed Consent

Informed consent was obtained from all individual participants included in the study.

A formal consent was also issued by the Bioethical Committee of the Institute of the Polish Mother’s Memorial Hospital in Lodz (Approval number, No 33/2015).

Consent for Publication

Not applicable, the manuscript doesn’t contain any individual person’s data.

Conflicts of Interest

Authors declare no conflict of interest.

References

  1. 1.
    Edmondson RJ, Monaghan JM (2001) The epidemiology of ovarian cancer. Int J Gynecol Cancer 11:423–429CrossRefGoogle Scholar
  2. 2.
    Hakem R (2008) DNA-damage repair; the good, the bad, and the ugly. EMBO J 27:589–605CrossRefGoogle Scholar
  3. 3.
    Mitra S, Boldogh I, Izumi T, Hazra TK (2001) Complexities of the DNA base excision repair pathway for repair of oxidative DNA damage. Environ Mol Mutagen 38:180–190CrossRefGoogle Scholar
  4. 4.
    Broustas CG, Lieberman HB (2014) DNA damage response genes and the development of cancer metastasis. Radiat Res 181:111–130CrossRefGoogle Scholar
  5. 5.
    Davis JD, Lin SY (2011) DNA damage and breast cancer. World J Clin Oncol 2:329–338CrossRefGoogle Scholar
  6. 6.
    Slyskova J, Lorenzo Y, Karlsen A, Carlsen MH, Novosadova V, Blomhoff R, Vodicka P, Collins AR (2014) Both genetic and dietary factors underlie individual differences in DNA damage levels and DNA repair capacity. DNA Repair (Amst) 16:66–73CrossRefGoogle Scholar
  7. 7.
    Jasin M, Rothstein R (2013) Repair of Strand breaks by homologous recombination. Cold Spring Harb Perspect Biol 5:a012740CrossRefGoogle Scholar
  8. 8.
    Lieber MR (2010) The mechanism of double-Strand DNA break repair by the nonhomologous DNA end joining pathway. Annu Rev Biochem 79:181–211CrossRefGoogle Scholar
  9. 9.
    Davis AJ, Chen DJ (2013) DNA double strand break repair via non-homologous end-joining. Transl Cancer Res 2:130–143Google Scholar
  10. 10.
    Genois MM, Paquet ER, Laffitte MCN, Maity R, Rodrigue A, Ouellette M, Masson JY (2014) DNA Repair Pathways in Trypanosomatids: from DNA Repair to Drug Resistance. Microbiol Mol Biol Rev 78:40–73CrossRefGoogle Scholar
  11. 11.
    Wood RD, Mitchell M, Sgouros J, Lindahl T (2001) Human DNA repair genes. Science 291:1284–1289CrossRefGoogle Scholar
  12. 12.
    Sielska J, Matecka M, Dąbrowska E, Jakubek E, Urbaniak M (2015) What do women know about breast cancer prophylaxis and a healthy style of life? Rep Pract Oncol Radiother 20:321–327CrossRefGoogle Scholar
  13. 13.
    Harris HR, Eke AC, Chavarro JE, Missmer SA (2018) Fruit and vegetable consumption and risk of endometriosis. Hum Reprod 33:715–727.  https://doi.org/10.1093/humrep/dey014 CrossRefGoogle Scholar
  14. 14.
    Ling KS, Chen GD, Tsai HJ, Lee MS, Wang PH, Liu FS (2005) Genetic changes in ovarian cancer. Taiwanese J Obstet Gynecol 44:218–231CrossRefGoogle Scholar
  15. 15.
    Toss A, Tomasello C, Razzaboni E, Contu G, Grandi G, Cagnacci A, Schilder RJ, Cortesi L (2015) Hereditary ovarian Cancer: not only BRCA 1 and 2 genes. Biomed Res Int 2015:341723CrossRefGoogle Scholar
  16. 16.
    Orsulic S, Li Y, Soslow RA, Vitale-Cross LA, Gutkind JS, Varmus HE (2002) Induction of ovarian cancer by defined multiple genetic changes in a mouse model system. Cancer Cell 1:53–62CrossRefGoogle Scholar
  17. 17.
    Hollis RL, Gourley C (2016) Genetic and molecular changes in ovarian cancer. Cancer Biol Med 13:236–247CrossRefGoogle Scholar
  18. 18.
    Kappil MA, Liao Y, Terry MB, Santella RM (2016) DNA repair gene expression levels as indicators of breast cancer in the breast cancer family registry. Anticancer Res 36:4039–4044CrossRefGoogle Scholar
  19. 19.
    Kidane D, Chae WJ, Czochor J, Eckert KA, Glazer PM, Bothwell ALM, Sweasy JB (2014) Interplay between DNA repair and inflammation, and the link to cancer. Crit Rev Biochem Mol Biol 49:116–139CrossRefGoogle Scholar
  20. 20.
    Hemminki K, Försti A, Bermejo JL (2005) Single nucleotide polymorphisms (SNPs) are inherited from parents and they measure heritable events. J Carcinog 4:2CrossRefGoogle Scholar
  21. 21.
    Erichsen HC, Chanock SJ (2004) SNPs in cancer research and treatment. Br J Cancer 90:747–751CrossRefGoogle Scholar
  22. 22.
    Helleday T (2003) Pathways for mitotic homologous recombination in mammalian cells. Mutat Res 532:103–115CrossRefGoogle Scholar
  23. 23.
    Jackson SP (2002) Sensing and repairing DNA double-strand breaks. Carcinogenesis 23:687–696CrossRefGoogle Scholar
  24. 24.
    Li X, Heyer WD (2008) Homologous recombination in DNA repair and DNA damage tolerance. Cell Res 18:99–113CrossRefGoogle Scholar
  25. 25.
    Gorbunova V, Seluanov A, Mao Z, Hine C (2007) Changes in DNA repair during aging. Nucleic Acids Res 35:7466–7474CrossRefGoogle Scholar
  26. 26.
    Khanna KK, Jackson SP (2001) DNA double-strand breaks: signaling, repair and the cancer connection. Nat Genet 27:247–254CrossRefGoogle Scholar
  27. 27.
    Trzeciak A, Błasiak J (2001) DNA repair in mammalian cells: mechanisms of homologous recombination. Postepy Biochem 47:38–51Google Scholar
  28. 28.
    Talar-Wojnarowska R, Gąsiorowska A, Olakowski M, Dranka-Bojarowska D, Lampe P, Smolarz B, Małecka-Panas E (2016) Analysis of XRCC2 and XRCC3 gene polymorphisms in pancreatic cancer. Biomed Rep 4:236–240CrossRefGoogle Scholar
  29. 29.
    Michalska MM, Samulak D, Romanowicz H, Jabłoński F, Smolarz B (2016) Association between single nucleotide polymorphisms (SNPs) of XRCC2 and XRCC3 homologous recombination repair genes and ovarian cancer in Polish women. Exp Mol Pathol 100:243–247CrossRefGoogle Scholar
  30. 30.
    Qureshi Z, Mahjabeen I, Baig R, Kayani M (2014) Correlation between selected XRCC2, XRCC3 and RAD51 gene polymorphisms and primary breast cancer in women in Pakistan. Asian Pac J Cancer Prev 15:10225–10229CrossRefGoogle Scholar
  31. 31.
    Smolarz B, Makowska M, Samulak D, Michalska MM, Mojs E, Wilczak M, Romanowicz H (2015) Association between single nucleotide polymorphisms (SNPs) of XRCC2 and XRCC3 homologous recombination repair genes and triple-negative breast cancer in Polish women. Clin Exp Med 15:151–157CrossRefGoogle Scholar
  32. 32.
    Du L, Xiong T, He Q, Wang Y, Shen J, Peng Y, Jia Q, Yang J, Zhang Y, Huang J (2014) The Thr241Met polymorphism in the XRCC3 gene is associated with increased risk of cancer in Chinese mainland populations. Tumour Biol 35:1371–1376CrossRefGoogle Scholar
  33. 33.
    Kayani MA, Khan S, Baig RM, Mahjabeen I (2014) Association of RAD 51 135 G/C, 172 G/T and XRCC3 Thr241Met gene polymorphisms with increased risk of head and neck cancer. Asian Pac J Cancer Prev 15:10457–10462CrossRefGoogle Scholar
  34. 34.
    Zhai M, Wang Y, Jiang MF (2015) Arg188His polymorphism in the XRCC2 gene and the risk of ovarian cancer: a meta-analysis. Genet Mol Res 14:10808–10815CrossRefGoogle Scholar
  35. 35.
    Zhang Y, Wang H, Peng Y, Liu Y, Xiong T, Xue P, Du L (2014) The Arg188His polymorphism in the XRCC2 gene and the risk of cancer. Tumour Biol 35:3541–3549CrossRefGoogle Scholar
  36. 36.
    Michalska MM, Samulak D, Bieńkiewicz J, Romanowicz H, Smolarz B (2015) Association between -41657C/T single nucleotide polymorphism of DNA repair gene XRCC2 and endometrial cancer risk in Polish women. Pol J Pathol 66:67–71CrossRefGoogle Scholar
  37. 37.
    Wang N, Dong XJ, Li Y, Guo W, Zhou RM, Zhang XJ, Wang SJ (2007) The association of XRCC2 gene polymorphism with susceptibility to esophageal squamous cell carcinoma and gastric cardiac adenocarcinoma in China. Zhonghua Yi Xue Yi Chuan Xue Za Zhi 24:538–543Google Scholar
  38. 38.
    Michalska MM, Samulak D, Romanowicz H, Smolarz B (2015) Single Nucleotide Polymorphisms (SNPs) of RAD51-G172T and XRCC2-41657C/T Homologous Recombination Repair Genes and the Risk of Triple- Negative Breast Cancer in Polish Women. Pathol Oncol Res 21:935–940CrossRefGoogle Scholar
  39. 39.
    Michalska MM, Samulak D, Smolarz B (2014) An association between the -41657 C/T polymorphism of X-ray repair cross-complementing 2 (XRCC2) gene and ovarian cancer. Med Oncol 31:300CrossRefGoogle Scholar
  40. 40.
    Ricks-Santi LJ, Sucheston LE, Yang Y, Freudenheim JL, Isaacs CJ, Schwartz MD, Dumitrescu RG, Marian C, Nie J, Vito D, Edge SB, Shields PG (2011) Association of Rad51 polymorphism with DNA repair in BRCA1 mutation carriers and sporadic breast cancer risk. BMC Cancer 11:278CrossRefGoogle Scholar
  41. 41.
    Ricks-Santi LJ, Nie J, Marian C, Ochs-Balcom HM, Trevisan M, Edge SB, Kanaan Y, Freudenheim JL, Shields PG (2013) BRCA1 polymorphisms and breast cancer epidemiology in the Western New York exposures and breast cancer (WEB) study. Genet Epidemiol 37:504–511CrossRefGoogle Scholar
  42. 42.
    Lakhani SR, Manek S, Penault-Llorca F, Flanagan A, Arnout L, Merrett S, McGuffog L, Steele D, Devilee P, Klijn JG, Meijers-Heijboer H, Radice P, Pilotti S, Nevanlinna H, Butzow R, Sobol H, Jacquemier J, Lyonet DS, Neuhausen SL, Weber B, Wagner T, Winqvist R, Bignon YJ, Monti F, Schmitt F, Lenoir G, Seitz S, Hamman U, Pharoah P, Lane G, Ponder B, Bishop DT, Easton DF (2004) Pathology of ovarian cancers in BRCA1 and BRCA2 carriers. Clin Cancer Res 10:2473–2481CrossRefGoogle Scholar
  43. 43.
    Neff RT, Senter L, Salani R (2017) BRCA mutation in ovarian cancer: testing, implications and treatment considerations. Ther Adv Med Oncol 9:519–531CrossRefGoogle Scholar
  44. 44.
    Kayani MA, Khan S, Baig RM, Mahjabeen I (2014) Association of RAD51 135G/C, 172G/T and XRCC3 Thr241Met gene polymorphisms with increased risk of head and neck cancer. Asian Pac J Cancer Prev 5:10457–10462Google Scholar
  45. 45.
    Zhou GW, Hu J, Peng XD, Li Q (2011) RAD51 135G>C polymorphism and breast cancer risk: a metaanalysis. Breast Cancer Res Treat 125:529–535CrossRefGoogle Scholar
  46. 46.
    Hu X, Sun S (2015) RAD51 gene 135G/C polymorphism and ovarian cancer risk: a meta-analysis. Int J Clin Exp Med 8:22365–22370Google Scholar
  47. 47.
    Wang W, Li JL, He XF, Li AP, Cai YL, Xu N, Sun SM, Wu BY (2013) Association between the RAD51 135 G>C polymorphism and risk of cancer: a meta-analysis of 19,068 cases and 22,630 controls. PLoS One 8:e75153CrossRefGoogle Scholar
  48. 48.
    Zhang BB, Wang DG, Xuan C, Sun GL, Deng KF (2014) Genetic 135G/C polymorphism of RAD51 gene and risk of cancer: a meta-analysis of 28,956 cases and 28,372 controls. Familial Cancer 13:515–526CrossRefGoogle Scholar
  49. 49.
    Wang WW, Spurdle AB, Kolachana P, Bove B, Modan B, Ebbers SM, Suthers G, Tucker MA, Kaufman DJ, Doody MM, Tarone RE, Daly M, Levavi H, Pierce H, Chetrit A, kConFab, ABCFS/CFRBCS, AJBCS, NISOC, Yechezkel GH, Chenevix-Trench G, Offit K, Godwin AK, Struewing JP (2001) A single nucleotide polymorphism in the 5′ untranslated region of RAD51 and risk of cancer among BRCA1/2 mutation carriers. Cancer Epidemiol Biomark Prev 10:955–960Google Scholar

Copyright information

© Arányi Lajos Foundation 2019

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.

Authors and Affiliations

  1. 1.Laboratory of Cancer Genetics, Department of PathologyInstitute of Polish Mother’s Memorial HospitalLodzPoland
  2. 2.Department of Obstetrics and GynaecologyRegional Hospital in KaliszKaliszPoland
  3. 3.The State Higher Professional School of Stanisław WojciechowskiKaliszPoland

Personalised recommendations