Advertisement

Hepatology International

, Volume 7, Issue 1, pp 199–207 | Cite as

Serum miR-483-5p as a potential biomarker to detect hepatocellular carcinoma

  • Zhoujing Zhang
  • Shengxiang Ge
  • Xiaomin Wang
  • Quan Yuan
  • Qiang Yan
  • Huiming Ye
  • Yaojian Che
  • Yanyan Lin
  • Jun Zhang
  • Pingguo Liu
Original Article

Abstract

Background and goals

There are no highly sensitive and specific minimally invasive biomarkers for hepatocellular carcinoma (HCC) to date. The objective of this study was to identify serum microRNAs (miRNAs) as potential HCC biomarkers.

Methods

Using miRCURY LNA™ microRNA arrays, the levels of circulating miRNAs in the serum of patients with HCC were compared and controls were matched. Then 253 subjects (112 HCC, 85 chronic hepatitis B [CHB], and 56 healthy controls) were recruited and 12 serum miRNAs were compared by quantitative real-time polymerase chain reaction (qRT-PCR). It was followed by the comparison of serum miRNA concentrations before and after the surgical resection in HCC group.

Results

Median levels of miR-483-5p and miR-500a were higher in HCC patients than in patients with CHB and in healthy controls (p < 0.0001), but there were no differences between CHB patients and healthy controls (p > 0.05) and miR-483-5p levels were significantly reduced in serum samples obtained 30 days after surgical resection (p < 0.0001). The area under receiver operating characteristic curves of miR-483-5p and miR-500a was 74% (cutoff [Ct] value = 2.824, sensitivity = 74%, and specificity = 66%) and 66% (Ct value = 1.830, sensitivity = 74%, and specificity = 51%) for the prediction of HCC, respectively. In detecting HCC, combining α-fetoprotein (AFP) and serum miR-483-5p (sensitivity = 81% and specificity = 83%) was better than AFP alone (sensitivity = 78%, specificity = 70%).

Conclusion

Our observations suggest that serum miR-483-5p and miR-500a might serve as novel, noninvasive biomarkers for HCC. Serum miR-483-5p might complement AFP in detecting HCC.

Keywords

Biomarker Hepatocellular carcinoma Microrna miR-483-5p Serum 

Notes

Acknowledgments

This study was supported by grants from the Medical Innovation Project of Fujian Province, China (2009-CXB-55) and the Science and Technology Project of Xiamen, China (3502Z20100002).

Conflicts of interest

The authors confirm that there are no conflicts of interest.

Supplementary material

12072_2012_9341_MOESM1_ESM.tif (1.8 mb)
Fig. S1. Scatter plot analysis of the miRNA Array (A–F). a HCC-1 versus Control-1; b HCC-1 versus Control-2; c HCC-2 versus Control-1; d HCC-2 versus Control-2; e HCC-1 versus HCC-2; and f Control-1 versus Control-2. (TIFF 1888 kb)
12072_2012_9341_MOESM2_ESM.tif (123 kb)
Fig. S2. The miR-483-5p IGF-2 relative expression level in liver tissue. The miR-483-5p relative expression level (according to U6, [a]), IGF-2 expression level (according to GAPDH, [b]), and IGF-2 protein expression level (c) in 10 HCC tissue control to paired normal liver tissue. Primer and probe sequences for real-time PCR: U6, forward: ctgcgcaaggatgaca, reverse: tatggaacgcttcacg. IGF-2, forward: actgcttccaggtgtcatatt, reverse: cctggagacgtactgtgcta. probe: FAM–cggacaacttccccagataccccg-BHQ-1. GAPDH, forward: ggcgatgctggcgctgagtac, reverse: tggtccacacccatgacga. probe: ROX-ttcaccaccatggagaaggctggg-BHQ-2. Antibody used for IGF-2 western blot were purchased from abcam, NO. Anti-IGF2 antibody (ab9574). (TIFF 123 kb)
12072_2012_9341_MOESM3_ESM.tif (1.9 mb)
Fig. S3. The qRT-PCR amplification curve of miR-483-5p, miR-500a, and Ath-miR-156a (A–C). The qRT-PCR amplification curve of miR-483-5p, miR-500a, and Ath-miR-156a, using miRNAs standard preparation and analysis were performed on CFX Manager (Bio-Rad). Tenfold serial dilution of miRNA was used to generate the standard curves. (TIFF 1958 kb)
12072_2012_9341_MOESM4_ESM.tif (3.1 mb)
Fig. S4. Initial cluster result of Fig. 1 and Table S3. (TIFF 3151 kb)
12072_2012_9341_MOESM5_ESM.doc (2.9 mb)
Supplementary material 5 (DOC 2944 kb)

References

  1. 1.
    Jemal A, Bray F, Center MM, et al. Global cancer statistics. Cancer J Clin 2011;61:69–90CrossRefGoogle Scholar
  2. 2.
    Aravalli RN, Steer CJ, Cressman EN. Molecular mechanisms of hepatocellular carcinoma. Hepatology 2008;48:2047–2063PubMedCrossRefGoogle Scholar
  3. 3.
    Zinkin NT, Grall F, Bhaskar K, et al. Serum proteomics and biomarkers in hepatocellular carcinoma and chronic liver disease. Clin Cancer Res 2008;14:470–477PubMedCrossRefGoogle Scholar
  4. 4.
    Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 2004;116:281–297PubMedCrossRefGoogle Scholar
  5. 5.
    Farazi TA, Spitzer JI, Morozov P, et al. miRNAs in human cancer. J Pathol 2011;223:102–115PubMedCrossRefGoogle Scholar
  6. 6.
    Wu J, Liu Z, Shao C, et al. HMGA2 overexpression-induced ovarian surface epithelial transformation is mediated through regulation of EMT genes. Cancer Res 2011;71:349–359PubMedCrossRefGoogle Scholar
  7. 7.
    Kota J, Chivukula RR, O’Donnell KA, et al. Therapeutic microRNA delivery suppresses tumorigenesis in a murine liver cancer model. Cell 2009;137:1005–1017PubMedCrossRefGoogle Scholar
  8. 8.
    Zhang X, Liu S, Hu T, et al. Up-regulated microRNA-143 transcribed by nuclear factor kappa B enhances hepatocarcinoma metastasis by repressing fibronectin expression. Hepatology 2009;50:490–499PubMedCrossRefGoogle Scholar
  9. 9.
    Feitelson MA, Lee J. Hepatitis B virus integration, fragile sites, and hepatocarcinogenesis. Cancer Lett 2007;252:157–170PubMedCrossRefGoogle Scholar
  10. 10.
    Murakami Y, Toyoda H, Tanaka M, et al. The progression of liver fibrosis is related with overexpression of the miR-199 and 200 families. PLoS One 2011;6:e16081PubMedCrossRefGoogle Scholar
  11. 11.
    Chen X, Ba Y, Ma L, et al. Characterization of microRNAs in serum: a novel class of biomarkers for diagnosis of cancer and other diseases. Cell Res 2008;18:997–1006PubMedCrossRefGoogle Scholar
  12. 12.
    Mitchell PS, Parkin RK, Kroh EM, et al. Circulating microRNAs as stable blood-based markers for cancer detection. Proc Natl Acad Sci USA 2008;105:10513–10518PubMedCrossRefGoogle Scholar
  13. 13.
    Wang GK, Zhu JQ, Zhang JT, et al. Circulating microRNA: a novel potential biomarker for early diagnosis of acute myocardial infarction in humans. Eur Heart J 2010;31:659–666PubMedCrossRefGoogle Scholar
  14. 14.
    Wang K, Zhang S, Marzolf B, et al. Circulating microRNAs, potential biomarkers for drug-induced liver injury. Proc Natl Acad Sci USA 2009;106:4402–4407PubMedCrossRefGoogle Scholar
  15. 15.
    Hu Z, Chen X, Zhao Y, et al. Serum microRNA signatures identified in a genome-wide serum microRNA expression profiling predict survival of non-small-cell lung cancer. J Clin Oncol 2010;28:1721–1726PubMedCrossRefGoogle Scholar
  16. 16.
    Huang Z, Huang D, Ni S, et al. Plasma microRNAs are promising novel biomarkers for early detection of colorectal cancer. Int J Cancer 2010;127:118–126PubMedCrossRefGoogle Scholar
  17. 17.
    Vasilescu C, Rossi S, Shimizu M, et al. MicroRNA fingerprints identify miR-150 as a plasma prognostic marker in patients with sepsis. PLoS One 2009;4:e7405PubMedCrossRefGoogle Scholar
  18. 18.
    Reid G, Kirschner MB, van Zandwijk N. Circulating microRNAs: association with disease and potential use as biomarkers. Crit Rev Oncol Hematol 2011;80:193–208PubMedCrossRefGoogle Scholar
  19. 19.
    Tsujiura M, Ichikawa D, Komatsu S, et al. Circulating microRNAs in plasma of patients with gastric cancers. Br J Cancer 2010;102:1174–1179PubMedCrossRefGoogle Scholar
  20. 20.
    Gui J, Tian Y, Wen X, et al. Serum microRNA characterization identifies miR-885-5p as a potential marker for detecting liver pathologies. Clin Sci (Lond) 2011;120:183–193CrossRefGoogle Scholar
  21. 21.
    Xu J, Wu C, Che X, et al. Circulating microRNAs, miR-21, miR-122, and miR-223, in patients with hepatocellular carcinoma or chronic hepatitis. Mol Carcinog 2011;50:136–142PubMedCrossRefGoogle Scholar
  22. 22.
    Zhang Y, Jia Y, Zheng R, et al. Plasma microRNA-122 as a biomarker for viral-, alcohol-, and chemical-related hepatic diseases. Clin Chem 2010;56:1830–1838PubMedCrossRefGoogle Scholar
  23. 23.
    Qu KZ, Zhang K, Li H, et al. Circulating microRNAs as biomarkers for hepatocellular carcinoma. J Clin Gastroenterol 2011;45:355–360PubMedCrossRefGoogle Scholar
  24. 24.
    Yamamoto Y, Kosaka N, Tanaka M, et al. MicroRNA-500 as a potential diagnostic marker for hepatocellular carcinoma. Biomarkers 2009;14:529–538PubMedCrossRefGoogle Scholar
  25. 25.
    Rosenwald S, Gilad S, Benjamin S, et al. Validation of a microRNA-based qRT-PCR test for accurate identification of tumor tissue origin. Mod Pathol 2010;23:814–823PubMedCrossRefGoogle Scholar
  26. 26.
    Li LM, Hu ZB, Zhou ZX, et al. Serum microRNA profiles serve as novel biomarkers for HBV infection and diagnosis of HBV-positive hepatocarcinoma. Cancer Res 2010;70:9798–9807PubMedCrossRefGoogle Scholar
  27. 27.
    Bruix J, Sherman M. Management of hepatocellular carcinoma. Hepatology 2005;42:1208–1236PubMedCrossRefGoogle Scholar
  28. 28.
    Meyer-Rochow GY, Jackson NE, Conaglen JV, et al. MicroRNA profiling of benign and malignant pheochromocytomas identifies novel diagnostic and therapeutic targets. Endocr Relat Cancer 2010;17:835–846PubMedCrossRefGoogle Scholar
  29. 29.
    Weber JA, Baxter DH, Zhang S, et al. The microRNA spectrum in 12 body fluids. Clin Chem 2010;56:1733–1741PubMedCrossRefGoogle Scholar
  30. 30.
    Wang K, Zhang S, Weber J, et al. Export of microRNAs and microRNA-protective protein by mammalian cells. Nucleic Acids Res 2010;38:7248–7259PubMedCrossRefGoogle Scholar
  31. 31.
    Zubakov D, Boersma AW, Choi Y, et al. MicroRNA markers for forensic body fluid identification obtained from microarray screening and quantitative RT-PCR confirmation. Int J Leg Med 2010;124:217–226CrossRefGoogle Scholar
  32. 32.
    Roos PH, Jakubowski N. Methods for the discovery of low-abundance biomarkers for urinary bladder cancer in biological fluids. Bioanalysis 2010;2:295–309PubMedCrossRefGoogle Scholar
  33. 33.
    Ma N, Wang X, Qiao Y, et al. Coexpression of an intronic microRNA and its host gene reveals a potential role for miR-483-5p as an IGF2 partner. Mol Cell Endocrinol 2011;333:96–101PubMedCrossRefGoogle Scholar
  34. 34.
    Patterson EE, Holloway AK, Weng J, et al. MicroRNA profiling of adrenocortical tumors reveals miR-483 as a marker of malignancy. Cancer 2011;117:1630–1639PubMedCrossRefGoogle Scholar
  35. 35.
    Zhao H, Shen J, Medico L, et al. A pilot study of circulating miRNAs as potential biomarkers of early stage breast cancer. PLoS One 2010;5:e13735PubMedCrossRefGoogle Scholar

Copyright information

© Asian Pacific Association for the Study of the Liver 2012

Authors and Affiliations

  • Zhoujing Zhang
    • 1
  • Shengxiang Ge
    • 2
  • Xiaomin Wang
    • 1
  • Quan Yuan
    • 2
  • Qiang Yan
    • 2
  • Huiming Ye
    • 1
  • Yaojian Che
    • 2
  • Yanyan Lin
    • 1
  • Jun Zhang
    • 2
  • Pingguo Liu
    • 1
  1. 1.Clinical Laboratory CenterZhongshan Hospital of Xiamen UniversityXiamenChina
  2. 2.National Institute of Diagnostic and Vaccine Development in Infectious DiseaseXiamen UniversityXiamenChina

Personalised recommendations