Advertisement

Molecular Neurobiology

, Volume 56, Issue 4, pp 2375–2378 | Cite as

Correction to: Hepcidin Mediates Transcriptional Changes in Ferroportin mRNA in Differentiated Neuronal-like PC12 Cells Subjected to Iron Challenge

  • Steinunn Sara Helgudottir
  • Jacek Lichota
  • Annette Burkhart
  • Torben MoosEmail author
Correction
  • 300 Downloads

Correction to: Mol Neurobiol

  https://doi.org/10.1007/s12035-018-1241-3

The original version of this article unfortunately contained mistakes on Figs. 1, 2, and 7 as some of the data were not visible. With this, the correct images are hereby published.

In Table 4 footnote, "Forty millimolar40 mM" should be changed two times to "Forty millimolar (40mM)". Also layout of Tables 2 - 4 were changed as per request of authors. Corrected Tables are presented herewith.

Fig. 1

ad Growth properties of PC12 cells before (a) and after receiving 50 ng/mLNGF-β for 1, 3, and 6 daysDIV(bd). Eighty to ninety percent of the cells display differentiated morphology after 6 DIV. eh Areas marked with respective squares in ad shown in higher magnification obtained by computed enlargement. The PC12 cells differentiate into cells with morphological changes corresponding to neurons with polygonal cell bodies and extended cellular processes with several branches sharing the morphology of mature neurites. Scale bar = 200 μm

Fig. 2

ab Confocal images of differentiated PC12 cells after 6 days of treatment with NGF-β revealing protein expression and cellular localization of Tubb4b (a, d) (green) and ferroportin (b, e) (red). Nuclei are counterstained with DAPI (blue). de Areas marked with respective squares in ac shown in higher magnification obtained by computed enlargement. The extended processes of the differentiated PC12 cells are clearly seen in these high-power magnifications. c, f Merged photos. Scale bar = 20 μm

Fig. 7

Overview of our hypothesis regarding the action of hepcidin on Fpn mRNA in NGF-β differentiated PC12 cells depending on the iron status. (Left) In iron overload, a strong upregulation of Fpn mRNA is mediated by hepcidin. This could lead to increase translation of Fpn mRNA and hence more ferroportin protein (yellow dots) in spite hepcidin also provokes a degradation of the ferroportin when present in the cellular membrane. A raised cytosolic appearance of ferroportin may nonetheless aid capture of excess iron and prevent ROS-mediated damage caused by unbound intracellular iron. (Right) In cellular iron deficiency, hepcidin mediates a decrease in Fpn mRNA expression, which lowers the translational and presence of ferroportin protein (yellow dots) in the cellular membrane. In turn, this increases the survival of the cell by retaining iron intracellularly to facilitate its availability

Table 2

Primers used for RT-qPCR

Target

Forward primer

Reverse primer

Fth

GACCACCGCGTCTCCCTCGC

CAGGGCCACATCATCCCGGTC

Ftl

TGACGTGGCTTTGGAAGGCG

GATGGCTTCTGCACATCCTGG

Hdac1

GCTGAGGAGATGACCAAG

GTGGACAACTGACAGAAC

Phf8

CCAGAAAGCAAAGCTCAA

GCACTGTCTACCTTCTTC

Tet1

GAGTCTTCACCATGACAC

GGACATGAATTCTTAGAACTATC

Table 3

The expression of Fpn mRNA after treatment with various concentrations of FAC in combination with a fixed concentration of hepcidin. Values below 1 indicate downregulation of Fpn mRNA expression, and values above 1 the reverse.

Treatment group

Ratio (treatment/control)

Effect on Fpn mRNA

Significance

FAC 10 mM

0.889

(↓)

n.s

FAC 20 mM

1.49

(↑)

n.s

FAC 30 mM

5.97

(↑)

n.s

FAC 6 mM + 1.0 μM hepcidin

14.122

(↑)

n.s

FAC 20 mM + 1.0 μM hepcidin

95.14

***

FAC 20 mM + 1.0 μM hepcidin/FAC 20 mM

93.92

***

The expression of Fpn after treatment with FAC is normalized to that of the control group receiving no treatment, whereas the expression of Fpn after treatment with FAC in combination with hepcidin is normalized to the group receiving 1.0 μM hepcidin. Effects presented in brackets display tendency without significance. Combining 20 mM FAC and 1.0 μM hepcidin upregulates the expression of Fpn, approximately times 90. A comparison between the treatments with 20 mM FAC and 20 mM FAC in combination with 1.0 μM hepcidin, measured as the ratio of expression, demonstrates a significant increase mediated by hepcidin to the two situations with identical concentrations of FAC. Significance: ***p = 0.0001–-0.001, n.s. not significant.

Table 4

The expression of Fpn mRNA after treatment with 40 mM DFO in combination with 2.3 μM hepcidin.

Treatment group

Ratio (treatment/control)

Effect on Fpn mRNA

Significance

DFO 40 mM

8.81

*

DFO 40 mM + 2.3 μM hepcidin

0.42

n.s.

DFO 40 mM/DFO 40 mM +2.3 μM hepcidin

20.63

**

Values below 1 indicate a downregulation of Fpn mRNA expression, and values above 1 the reverse. The expression of Fpn after treatment with DFO is normalized to that of the control group receiving no treatment, whereas the expression of Fpn after treatment with DFO in combination with hepcidin is normalized to the group receiving 2.3 μM hepcidin. Forty millimolar40 mM DFO upregulates Fpn significantly. Forty millimolar40 mM DFO combined with 2.3 μM hepcidin results in downregulation of Fpn mRNA. A comparison between the treatments with 40 mM DFO and 40 mM DFO + 2.3 μM hepcidin, measured as the ratio of expression, reveals strong upregulation of Fpn mRNA in the single treatment group without hepcidin with an approximately 20 times higher expression. Significance: *p = 0.01–-0.05, ** p = 0.001–-0.01, n.s. not significant.

Copyright information

© Springer Science+Business Media, LLC, part of Springer Nature 2018

Authors and Affiliations

  • Steinunn Sara Helgudottir
    • 1
  • Jacek Lichota
    • 1
  • Annette Burkhart
    • 1
  • Torben Moos
    • 1
    Email author
  1. 1.Laboratory of Neurobiology, Biomedicine Group, Department of Health Science and TechnologyAalborg UniversityAalborg EastDenmark

Personalised recommendations