Journal of Molecular Neuroscience

, Volume 43, Issue 3, pp 549–549

Erratum to: Population and Computational Analysis of the MGEA6 P521A Variation as a Risk Factor for Familial Idiopathic Basal Ganglia Calcification (Fahr’s Disease)

  • Roberta R. Lemos
  • Danyllo F. Oliveira
  • Mayana Zatz
  • João R. M. Oliveira
Erratum
  • 348 Downloads

Erratum to: J Mol Neurosci

DOI10.1007/s12031-010-9445-7

The original version of this article unfortunately contained a mistake. First, the correct primer pair listed in the Methods and Sample Collection section is: (5’caaaatcaaaggatacattcagga 3’forward) and (5’ agctccttttccaaataaaagttatc 3’reverse). Secondly, Figure 1, the image associated with subject I-1 from family a, is an MRI image and not a CT image.

Copyright information

© Springer Science+Business Media, LLC 2011

Authors and Affiliations

  • Roberta R. Lemos
    • 1
  • Danyllo F. Oliveira
    • 1
  • Mayana Zatz
    • 2
  • João R. M. Oliveira
    • 1
    • 3
  1. 1.Keizo Asami Laboratory (LIKA)Federal University of PernambucoRecifeBrazil
  2. 2.Human Genome Study CenterUniversity of São PauloSão PauloBrazil
  3. 3.Neuropsychiatry DepartmentFederal University of Pernambuco (UFPE)RecifeBrazil

Personalised recommendations