Lipids

, Volume 47, Issue 7, pp 669–678 | Cite as

Oral Supplementation of Butyrate Reduces Mucositis and Intestinal Permeability Associated with 5-Fluorouracil Administration

  • Talita Mayra Ferreira
  • Alda Jusceline Leonel
  • Marco Antônio Melo
  • Rosana R. G. Santos
  • Denise Carmona Cara
  • Valbert N. Cardoso
  • Maria I. T. D. Correia
  • Jacqueline I. Alvarez-Leite
Original Article

Abstract

Mucositis affects about 40 % of patients undergoing chemotherapy. Short chain fatty acids (SCFA), mainly butyrate, are claimed to improve mucosal integrity, reduce intestinal permeability and act as anti-inflammatory agents for the colon mucosa. We evaluated the effects of oral administration of SCFA or butyrate in the 5FU-induced mucositis. Mice received water, SCFA or butyrate during all experiment (10 days) and a single dose of 5FU (200 mg/kg) 3 days before euthanasia. We evaluated inflammatory and histological score by morphometry, and by activity of enzymes specific to neutrophil, eosinophil and macrophage and TLR-4, TNF-alpha and IL6 expressions. Intestinal permeability and tight junction protein ZO-1 expression were evaluated. Mice from the 5FU (5-Fluorouracil) group presented weight loss, ulcerations and inflammatory infiltration of neutrophils and eosinophils, increased expression of IL6 and TNF-alpha and increased intestinal permeability. SCFA minimized intestinal damage, reduced ulcerations without affecting intestinal permeability. Butyrate alone was more efficient at improving those parameters than in SCFA solution and also reduced intestinal permeability. The expression of pro-inflammatory cytokines and ZO-1 tended to be higher in the SCFA supplemented but not in the butyrate supplemented group. We showed the beneficial effects of butyrate on intestinal mucositis and its promising function as an adjuvant in the treatment of diseases not only of the colon, but also of the small intestine.

Keywords

Mucositis Inflammation Short-chain fatty acids Butyrate 5-Fluorouracil Lipids 

Abbreviations

5FU

5-Fluorouracil

CCL2/MCP-1

Monocyte chemotactic protein-1

DMSO

Dimethyl sulfoxide

DTPA

Diethyleneaminopentacetic acid

EPO

Eosinophil peroxidase

GLP-2

Glucagon-like peptide-2

MCT

Monocarboxylate transporters

MPO

Myeloperoxidase

NAG

N-Acetylglucosaminidase

SCFA

Short-chain fatty acid

TJ

Tight junctions

(ZO)-1

Zonula occludens-1

Introduction

Short-chain fatty acids (SCFA) mainly acetate, propionate and butyrate are produced by bacterial fermentation, particularly of dietary fiber and carbohydrate in the large intestine. They are readily absorbed and are metabolized in the liver, producing energy. Butyrate, the 4-carbon fatty acid, has been tested as one of the therapeutic options for colon inflammatory diseases but was not previously tested for small intestine conditions, such as mucositis. Several in-vitro and in-vivo studies have shown that butyrate stimulates cell proliferation, inhibits inflammatory mediator production, reduces intestinal permeability and induces apoptosis in colon cancer cells [11, 19, 22, 28]. Moreover, SCFA and butyrate enemas have been considered in the therapy of ulcerative colitis [10, 15, 28].

Mucositis secondary to 5FU chemotherapy is related to alterations in intestinal permeability, causing bacterial translocation and changes in the intestinal immune status. Gut barrier disruption could be related to reduction of cell proliferation or an increase in apoptosis, both influenced by the presence of butyrate in the intracellular milieu. Intestinal paracellular permeability is regulated by the tight junctions [26] which consist of junctional protein complexes located in the apical portion of enterocytes and formed by transmembrane as well as peripheral membrane proteins such as occludin, claudin-1 and zonula occludens (ZO)-1.

Our group has previously shown the beneficial effect of a solution of SCFA (acetate, propionate and butyrate) in the clinical manifestations of ARA-C induced mucositis in mice [20]. In that study, the mechanism of such an action and the specific fatty acid responsible for this effect was not investigated. Due to its metabolic relevance on cell metabolism butyrate is the more promising candidate for such an effect.

Considering the significant clinical impact of mucositis and the beneficial effects of the SCFA solution on the small intestinal mucosa, we aimed to characterize the effects of oral administration of either SCFA or butyrate solutions on the amelioration of intestinal mucosa after 5-fluorouracil (5FU) administration.

Materials and Methods

Four-week-old female Swiss mice from animal facility of the Federal University of Minas Gerais (Brazil) received water, SCFA or butyrate solutions (replacing drink water) ad libitum for 10 days Table 1. On the 7th day, animals were injected intraperitoneally with a single dose of 5-fluorouracil (5FU, 200 mg/kg, Eurofarma®, Brazil) or PBS. The SCFA solution was prepared according to Ramos et al. [20] and contained 35 mM of acetate, 15 mM of propionate, and 9 mM of butyrate (Sigma-Aldrich, USA). The butyrate solution had a concentration of 9 mM. The pH of all solutions was adjusted to 7.4 by adding sodium hydroxide (50 %).
Table 1

Experimental groups of Swiss mice receiving water or experimental solutions and chow diet during 10 days

Group

Liquid intake

Treatment (single dose)

Control

Water

PBSa

SCFA

C2 (35 mM) + C3(15 mM) + C4 (9 mM)b

PBS

Butyrate

Butyrate (9 mM)

PBS

5FU

Water

5FU (200 mg/kg)

5FU + SCFA

C2 (35 mM) + C3(15 mM) + C4 (9 mM)

5FU (200 mg/kg)

5FU +Butyrate

Butyrate (9 mM)

5FU (200 mg/kg)

aPBS or 5-fluorouracil (5FU) were intraperitoneally administered on the 7th experimental day. The pH of all solutions was 7.4 ± 0.2

bC2, acetate; C3, propionate; C4, butyrate

The animals were subdivided into 6 groups: 1, control group (n = 12): no mucositis induction and receiving water; 2, 5FU group: with mucositis and receiving water; 3, SCFA group (n = 4): no mucositis induction and receiving SCFA solution; 4, 5FU + SCFA group (n = 18): with mucositis and receiving SCFA solution, 5, Butyrate group(n = 18): no mucositis induction and receiving butyrate solution and 6, 5FU + butyrate group (n = 18): with mucositis and receiving butyrate solution.

On the 10th experimental day, all animals were anesthetized and euthanized for blood and organ collection. Body weight, liquid intake and food intake were measured on the 1st and 10th experimental days. The energy intake was calculated, taking into consideration calories from food and solutions. The protocol was approved by the Animal Care Committee of Universidade Federal de Minas Gerais (UFMG), CETEA # 46/2008.

Histological Analysis

The small intestine and colon were removed from the pylorus to the ileocecal valve and from the cecum to the rectum, respectively. The organs were washed, gently perfused with PBS and measured with an inextensible millimeter ruler. The intestine was divided into the duodenum, jejunum and ileum and then fixed in paraformaldehyde (4 %) for 15 min. The segments were opened along their longitudinal axes, fixed in Bouin's solution for 6 h, embedded in paraffin and cut into 5 µm thick sections before being stained with hematoxylin-eosin (H&E). Images were obtained using a JVC TK-1270/RGB microcamera and the KS300 software built into a Kontron Eletronick/Carl Zeiss image analyzer. Ten fields from H&E sections were randomly chosen for villi height measurement.

Alterations of the mucosal architecture (general structure, cell distribution, mucosa and submucosa aspect), ulcerations, inflammation, villus height and inflammatory infiltration were used to determine the histological score. The samples were coded and then scored by a trained pathologist. The score ranged from zero (no alteration) to 3 (severe alteration) according to Soares et al. [24]. The results are presented as the sum of the score obtained for each parameter.

Neutrophil, Macrophage and Eosinophil infiltrations were evaluated by analyzing the enzyme activity of myeloperoxidase (MPO), N-acetylglucosaminidase (NAG) and eosinophil peroxidase (EPO), respectively. Samples were homogenized and centrifuged, and precipitates were used for quantification of enzyme activities as previously described [28]. Briefly, precipitates were dissolved in HETAB 0.5 % (Sigma-Aldrich®, USA) in phosphate buffer and centrifuged.

For EPO quantification, 75 µL of supernatant was added to 75 µL of OPD (Sigma-Aldrich®, USA), diluted in Tris–HCl and H2O2 and incubated at 37 °C for 30 min. The reaction was stopped by adding 50 µL H2SO4 before being read at wavelength 492 nm in a microplate spectrophotometer (TermoPlate, Brazil).

For MPO quantification, 25 µL of supernatant was added to 25 µL of TMB in DMSO (Sigma-Aldrich®, USA). After addition of 100 µL H2O2, the solution was incubated at 37 °C for 5 min. The reaction was stopped by adding H2SO4 before being read at 450 nm in a microplate spectrophotometer (TermoPlate, Brazil).

For NAG quantification, precipitates were dissolved in 0.1 % Triton X-100 (Sigma-Aldrich®, USA) and centrifuged before the supernatant was added to p-nitrophenyl-N-acetyl-β-d-glucosamine solution in citrate/phosphate. After incubation, the reaction was stopped by the addition of glycine buffer and read at 400 nm in a microplate spectrophotometer (TermoPlate, Brazil). Results were expressed in arbitrary units (based on absorbance) by 100 mg of tissue.

Study of Intestinal Permeability

We studied intestinal permeability using 99mTcdiethyleneaminopentacetic acid (DTPA). Because DTPA is not absorbed by the healthy small intestine, its presence in the blood is proportional to the increase in the damage of intestinal paracellular permeability. Animals were gavaged with 0.1 mL of DTPA labeled with 3.7 MBq 99mtechnetium in the form of sodium pertechnetate (Na99mTcO4), obtained by a 99molybdenum/99mtechnetium generator (IPEN/CNEMA, São Paulo, Brazil) [7]. Four hours after gavage, animals were anesthetized and exsanguinated by the axillary plexus. The radioactivity of the standard dose and blood samples was determined in an automatic pit scintillator (ANSR, Abbott®, USA), and the percentage of recovered dose in each animal was calculated as follows: radioactivity of blood/radioactivity of standard dose × 100. The average of the control group values was used as a reference. The results were presented as the increase seen in experimental groups over the control group (expressed as a percent).

RT-PCR

The total RNA from the ileum was extracted using the TRIzol® reagent according to the manufacturer’s protocol. The reverse transcription was performed using 2 µg of the total RNA, 200 U of the reverse transcriptase, 2.5 µL of the 5× RT buffer, 1.8 µL of the 10 mM dNTPs, 0.2 µL of the 10,000 U/mL RNasin, and 1.0 µL of the 50 µM oligo dT. The temperature settings for this reaction were 70 °C for 5 min, on ice for 2 min, 42 °C for 60 min, 70 °C for 15 min and 4 °C for the final step. The resulting cDNA was used for real-time PCR as described below. The specific primers were designed using the Primer Express software and synthesized by IDT. Real time PCR was carried out on a StepOne sequence detection system (Applied Biosystems) using the Power SYBR Green PCR Master Mix (Applied Biosystems). The dissociation curve indicated that only one product was obtained in each reaction. The relative levels of gene expression were determined using the ΔΔCycle threshold method as described by the manufacturer, in which data for each sample is normalized to the β-actin expression. The PCR results were analyzed with the SDS 2.1 software (Applied Biosystems), and the amount of mRNA of each gene of interest was normalized to the amount of the murine β-actin gene. mRNA expression levels were calculated as the fold difference relative to the housekeeping gene: relative expression = 2−(CT [target gene] − CT [β-actin-1]).

The sequences of the primers used are as follows:

TNFα: 5′CGTCGTAGCAAACCACCAAG3′ and 5′GAGATAGCAAATCGGCTGACG3′

IL6: 5′ACAACCACGGCCTTCCCTACTT-3′ and 5′CACGATTTCCCAGAGAACATGTG3′

TLR4: 5′TGACAGGAAACCCTATCCAGAGTT3′ and 5′TCTCCACAGCCACCAGATTCT3′

ZO-1: 5′CCAGCTTATGAAAGGGTTGTTC3′ and 5′TCCTCTCTTGCCAACTTTTCTC3′

β-actin: 5′CTGCCTGACCAAGTC3′ and 5′CAAGAAGGAAGGCTGGAAAGG A3′

Statistical Analysis

Statistical analysis was performed using the Graph Pad Prism 7.0® software (San Diego CA). The results were tested for outliers (Grubbs’ test) and normality using the Kolmogorov–Smirnov test. The one-way ANOVA and the Newman–Keuls multiple comparison post-test were used for all parameters except for architecture alteration and villus height (non-parametric distribution), which were instead analyzed by the Kruskal–Wallis and Dunn’s post-test. To compare gene expression of a specific group with the control group, an unpaired t test or a Mann–Whitney test was used. A significant difference was defined as p ≤ 0.05.

Results

Initially we compared the effect of the three control groups (control, SCFA and butyrate groups) on weight gain and intestinal morphology. The results showed that the three groups presented the same weight evolution and intestinal mucosa aspect (data not shown), demonstrating that SCFA and butyrate administrations do not interfere with intestinal mucosa integrity. For this reason, we omitted data from SCFA and butyrate control groups, presenting only the results of control mice (without SCFA or butyrate supplementation).

Energy and Hydric Intake and Ponderal Evolution

Total liquid intake was similar among all experimental groups, although food intake was reduced in the 5FU group compared to the control group (Fig. 1a, b). Yet, as expected, animals from the 5FU group lost weight. However, animals receiving the SCFA solution lost less weight, and those treated with butyrate did not lose any (Fig. 1c), suggesting that these solutions, mainly butyrate solution, attenuate aggression induced by 5FU. Intestinal length, one of the mucositis characteristics, was reduced in the 5FU group and presented an intermediated level after SCFA and butyrate supplementation (Fig. 1d).
Fig. 1

Energy (a) and liquid (b) intake, weight variation (c) and intestinal length (d) of control mice and mice treated with 5FU (IP) and receiving water (5FU group), SCFA (5FU + SCFA group) or butyrate (5FU + butyrate group) for 10 days. n = 15–18/group. Bars represent average and vertical lines represent standard error. Different letters indicate a statistical difference (p < 0.05)

Histological Analyses

Histological analyses of the 5FU group showed the mucositis picture with tissue damage, a reduction in villus height, the presence of inflammatory cells and ulcerations all along the small intestine, which was more intense in the ileal segment (Fig. 2a). On the other hand, animals receiving SCFA or butyrate solutions presented less intense tissue damage, preservation of villi length in all segments of the small intestine and a lack of mucosa ulceration (Fig. 2a). These results of histological analyses confirm the more effective protection of butyrate compared to SCFA. Colon histology did not reveal any inflammation (data not shown), reinforcing the fact that the tissue damage driven by 5FU is restricted to the small intestine.
Fig. 2

(Refer to the on-line version for this figure in color) Morphology of the ileum of a control mice and mice treated with 5FU (IP) and receiving b water, c SCFA solution or d butyrate solution replacing water for 10 days. In 5FU group: tissue damage with loss of villi, presence of inflammatory cells and ulceration. 5FU + SCFA group: reduction of tissue damage with relative preservation of mucosa villi length and architecture. Inflammatory cells are still seen in mucosa and submucosa. 5FU + butyrate group: improvement of general architecture and villus height. Inflammatory infiltration (arrow heads) is still present in mucosa and submucosa. Histological scores of duodenum (e), jejunum (f) and ileum (g) of control, 5FU, 5FU + SCFA or 5FU + butyrate groups. n = 6 per group. In e, f and g the results are the sum of the score obtained for each parameter. Bars represent average and vertical lines represent the standard error. Different letters indicate a statistical difference (p < 0.05)

Histological Score

Mucosa improvement was confirmed by the worse histological score for 5FU-treated animals compared to the control animals (Fig. 2b–d). When each intestinal segment was analyzed separately, the duodenum was moderately affected by 5FU treatment, while the inflammation score was intense for both the jejunum and ileum of mice from the 5FU group. Nonetheless, after SCFA and butyrate treatment, the histological score was reduced in all intestinal segments (Fig. 2b, c).

Next, we individually analyzed the four parameters used for the histological score. Mucosa ulceration and general architecture as well as the villus length contribute to the intestinal mucosa recovering following SCFA and butyrate supplementation (Fig. 3). Interestingly, inflammatory infiltration did not decrease after SCFA or butyrate supplementation.
Fig. 3

Evaluation of mucosa architecture alteration (a), mucosa ulcerations (b), inflammatory infiltration (c) and villus height (d) of duodenum, jejunum and ileum of control mice or mice treated with 5FU and receiving water (5FU group), SCFA (5FU + SCFA group) or butyrate (5FU + butyrate group) for 10 days. n = 6 per group. Bars represent average and lines represent standard error. Different letters indicate a statistical difference (p < 0.05)

Leukocyte Infiltration and Cytokine Expression

Because no differences were observed in the inflammatory infiltration between groups, we evaluated the activity of neutrophils, macrophages and eosinophils in the intestines of all animals through the determination of MPO, NAG and EPO enzyme activities, respectively. Neutrophil infiltration, as measured by MPO activity was increased as a consequence of 5FU treatment (Fig. 4). Following the results of the inflammatory score, neither SCFA nor butyrate altered MPO activity (neutrophil infiltration). NAG activity (macrophage infiltration) was similar among groups, including the control group, suggesting it is not relevant to the damage induced by 5FU in this phase of inflammation (Fig. 4). Regarding EPO activity (eosinophil infiltration), it increased 4 times with 5FU treatment compared to the control group. Nevertheless, EPO returned to the control levels after SCFA and butyrate treatments (Fig. 5).
Fig. 4

Evaluation of the enzyme activity of MPO, NAG and EPO, as indirect determination of neutrophil (a), macrophage (b) and eosinophil (c) infiltration, respectively, in the small intestine of control mice or mice treated with 5FU (IP) and receiving water (5FU group), SCFA (5FU + SCFA group) or butyrate (5FU + butyrate group) for 10 days. n = 7/group. Bars represent average and vertical lines represent standard error. Different letters indicate a statistical difference (p < 0.05)

Fig. 5

TLR4 (a), TNF-α (b) and IL-6 (c) mRNA amplifications in the ileum of control mice or mice treated with 5FU (IP) and receiving water (5FU group), SCFA (5FU + SCFA group) or butyrate (5FU + butyrate group) for 10 days. Bars represent average and lines represent standard error. N = 4/group. #p = 0.061 and *p = 0.057 compared to the control group

Amplification of mRNA of Pro-Inflammatory Molecules

Gene expression of TLR-4, IL-6 and TNF-α was analyzed by RT-PCR. The TLR4 expression presented a strong tendency (p = 0.06) to be higher in 5FU mice compared to controls but it was not different between supplemented groups (Fig. 5a). Regarding TNF-α and IL-6 expressions, a strong tendency (p = 0.057) of increased values was seen in 5FU and 5FU + SCFA, but not in 5FU + butyrate (Fig. 5b).

Intestinal Permeability

5FU damage is associated with an increase in intestinal permeability, which can be detected by the blood recovery of 99mTc-DTPA after an oral dose. For animals in all 5FU groups, intestinal permeability was higher than the control group, which was not reversed by SCFA. However, butyrate administration reduced intestinal permeability to levels that were closer to those of the control groups (Fig. 6).
Fig. 6

Evaluation of intestinal permeability after oral administration of Tc99 labeled DTPA (a). Results represent the increase in the percentage of the radioactivity recovered in the blood of 5FU, 5FU + SCFA and 5FU + butyrate groups compared to the control group. n = 7/group. Different letters indicate a statistical difference (p < 0.05). b ZO-1 mRNA amplification in the ileum of control mice or mice treated with 5FU (IP) and receiving water (5FU group), SCFA (5FU + SCFA group) or butyrate (5FU + butyrate group) for 10 days. Bars represent average and lines represent standard error. N = 4/group. *p = 0.057 and 0.091 for 5FU and 5FU + SCFA groups, respectively compared to control group

Since paracellular permeability is linked to tight junction protein interactions, ZO-1 protein expression was also investigated, also showing a strong tendency to increased expression in 5FU (p = 0.056) and 5FU + SCFA (p = 0.09) groups. Once again, 5FU + butyrate mice presented ZO-1 expression closer to control ones.

Discussion

In the current study, we have shown that SCFA and, in particular, butyrate are effective in improving mucosa integrity and reducing inflammation in an experimental model of mucositis. Moreover, these effects were obtained by the oral supplementation of fatty acids rather than rectal via as is usually done. In a previous study, we showed that SCFA solution improves intestinal manifestation of mucositis [20]. However, we did not evaluate the effects of butyrate used alone and limited our analyses to the histological aspects of the intestinal mucosa. As far as we know, the current study is the first one to address the effect of butyrate supplementation on the evolution of chemotherapy-induced intestinal mucositis.

Role of SCFA and Butyrate on the Intestinal Integrity

Although the SCFA and butyrate solutions had beneficial effects on mucositis, the butyrate solution was the most effective. While it contained the same concentration of butyrate as the butyrate-alone solution, the SCFA solution only partially reduced weight loss and did not prevent permeability alteration or reduced the pro-inflammatory cytokine expression in the intestine. We believe that, rather than presenting deleterious effects, the presence of acetate and propionate in the SCFA solution reduced the intestinal absorption of butyrate via the border brush transporter. The transport of butyrate through monocarboxylate transporters (MCT) is saturable, coupled with H+ and inhibited by several monocarboxylates, such as acetate, propionate, pyruvate, l-lactate and α-ketobutyrate [8]. We hypothesize that the higher concentration of acetate (35 mM) and propionate (15 mM) in contrast to the lower concentration of butyrate (9 mM) in the SCFA solution could compete with the butyrate transport by MCT and/or another intestinal transporter, resulting in a smaller absorption and, consequently, a smaller post absorptive effect of butyrate in the SCFA solution compared to the butyrate alone.

Anti-Inflammatory Action

The mucosa analyses showed that neutrophil infiltration, as measured by MPO activity had increased in 5FU-treated animals and that SCFA or butyrate solutions did not interfere in this aspect. Moreover, macrophage infiltration, as measured by NAG activity, was not different in any 5FU-treated groups compared to the control group. This latter result could be explained by the pattern of cell migration towards the inflammatory site. Neutrophils are the first cells arriving at the inflammatory site causing an increase in MPO activity in the first hours after administration of 5FU as seen in the current study [3, 24]. In contrast, macrophages are effectors cells, most frequently seen in later inflammatory stages, mainly after 3 days of inflammatory stimulus [30]. Our mice were euthanized 3 days after the administration of 5FU, which may explain the lack of differences in macrophage concentration between the control and 5FU groups. Regarding eosinophils, we found an intense infiltration related to mucositis that was prevented by SCFA and butyrate supplementation. Although the role of eosinophils in mucositis is seldom studied, the detection of eosinophils in the intestinal mucosa of patients with inflammatory intestinal diseases, even in small quantities, has been associated with adverse clinical consequences, such as weight loss, malabsorption and shortening of large intestine crypts [21, 31]. Thus, a reduction of these cells in the groups treated with SCFA and butyrate is considered a sign of a better prognosis.

The expression of the pro-inflammatory molecules TLR4, IL6 and TNFα tended to be higher in the 5FU group. This increase was possibly due to the inflammation caused by 5FU itself and due to the rupture of the intestinal barrier permitting bacterial translocation and LPS-induced TLR4 activation. In concordance to the permeability data and MPO activity, 5FU + butyrate group kept cytokine expression closer to the control group. These data suggest that the better intestinal trophism seen in this group attenuates the inflammatory stimulus secondary to LPS and bacterial translocations, reducing activation of mucosal immune cells.

The absence of differences between the 5FU and butyrate groups for NAG and MPO activities as well as inflammatory score suggest that a trophic rather than immunologic effect is the main mechanism for both butyrate and SCFA protection. Nonetheless, butyrate demonstrated a more intense effect on the intestinal barrier that could be due to its metabolic effect as an energetic source associated to its action on gene expression. The results of butyrate on cytokines and TLR4 expressions compared to SCFA are in agreement with the improvement of intestinal permeability which will reduce bacterial translocation and LPS induced immune response activation.

Intestinal Permeability

Cell infiltration and intestinal permeability are important markers of tissue damage and mucosal inflammation [2, 17]. We have observed that butyrate reduced the alteration in intestinal permeability that is typically seen in 5FU mice. Our results are in agreement with other in-vitro studies showing the improvement of intestinal permeability with butyrate solutions [14, 19, 27]. The mechanism of this effect can be linked to gene expression of tight junction proteins, since butyrate and trichostatin A, an inhibitor of histone acetylase decreased tight junction permeability in Caco-2 cells via lipoxynase activation [18].

ZO-1 is a TJ protein that interacts with occludin, ZO-2, ZO-3 and actin, reducing intestinal permeability and inducing cell differentiation. Since 5FU treatment induced the increase of intestinal permeability, one would expect a reduction in ZO-1 protein in tight junctions [13, 16, 23]. However, our results showed that ZO-1 expression was increased in groups which presented an increase in permeability (5FU and 5FU + SCFA) compared to the control. We believe that this higher expression of ZO-1 reflects the more intense mucosal repair after 5FU-induced damage. ZO-1 protein and expression are generally tested under conditions of continuous inflammatory stimuli such as cell incubation with pro-inflammatory agents [23] or animal models with chronic inflammatory diseases [13, 16]. This continuous inflammatory stimulus maintains ZO-1 expression down-regulated in those models, avoiding the repair of the intestinal barrier. However, in our mucositis model, 5FU that has a short half-life [4] was given as a single dose 3 days before euthanasia of the mice. Since intestinal mucosa is renewed every 3–4 days, we believe that new intestinal cells formed after 5FU injection overexpressed ZO-1 in order to compensate the important intestinal barrier disruption. In the 5FU + butyrate group, mucosal damage was lower (as seen by the reduction in intestinal permeability and mucosa recovery) compared to the 5FU non-supplemented group, reducing the necessity of a compensatory ZO-1 expression. Probably, ZO-1 expression, intestinal permeability in the 5FU + butyrate group was closer to the control group, reinforcing our hypothesis. Moreover, ZO-1 altered expression in the 5-FU and 5FU + SCFA groups can be related to the ZO-1 translocation from the cell boundary (tight junction location) to the cytoplasm as previously described [23]

Possible Mechanisms of Action

The mechanisms of action of SCFA and butyrate on intestinal cells are not totally understood. Oral administration of SCFA exposes the stomach and small intestine mucosa to these fatty acids before reaching the colon [25, 29] and are transported to the liver [8]. There, they can be metabolized to glutamate, glutamine and acetoacetate [5] important fuels for enterocytes [1, 5, 6]. Butyrate also increases the pancreatic secretion and the activity of jejunal brush-border enzymes [9], increasing availability of nutrients for enterocyte regeneration, stimulates of Glucagon-like peptide-2 (GLP-2) [32], a pleiotropic intestinotrophic hormone that enhances digestive and absorptive capacity [12]. All these components propitiate the mucosa integrity, protecting cells from 5FU damage, including the increase in intestinal permeability. As a consequence, the bacterial translocation is reduced, minimizing the inflammatory response.

In conclusion, the results presented here highlight, for the first time, the potential use of butyrate in inflammatory diseases of the small intestine, such as mucositis. Oral administration of butyrate contributes to rebuilding the intestinal mucosa by quickly repairing ulcerated and inflamed tissue.

Notes

Acknowledgments

This study was supported by grants from the Conselho Nacional de Desenvolvimento Científico e Tecnologico (CNPq); Coordenação de Aperfeiçoamento de Nível Superior (CAPES), Fundação de Amparo a Pesquisa de Minas Gerais (FAPEMIG) e Pro-Reitoria de Pesquisa (PRPq) da UFMG. The authors are grateful to Maria Helena Alves, for taking care of the animals.

Conflict of interest

The authors declare that they have no conflict of interest.

References

  1. 1.
    Bergman EN (1990) Energy contributions of volatile fatty acids from the gastrointestinal tract in various species. Physiol Rev 70:567–590PubMedGoogle Scholar
  2. 2.
    Blijlevens NM, Van’t Land B, Donnelly JP, M’Rabet L, de Pauw BE (2004) Measuring mucosal damage induced by cytotoxic therapy. Support Care Cancer 12:227–233PubMedCrossRefGoogle Scholar
  3. 3.
    Broughton G 2nd, Janis JE, Attinger CE (2006) The basic science of wound healing. Plast Reconstr Surg 117:12S–34SPubMedCrossRefGoogle Scholar
  4. 4.
    Chu E, Sartorelli AC (2012) Cancer chemotherapy. In: Katzung BG, Masters SB, Trevor AJ (eds) Basic and clinical pharmacology, chap 54, 12th edn. McGraw-Hill, New YorkGoogle Scholar
  5. 5.
    Desmoulin F, Canioni P, Cozzone PJ (1985) Glutamate–glutamine metabolism in the perfused rat liver. 13C-NMR study using (2-13C)-enriched acetate. FEBS Lett 185:29–32PubMedCrossRefGoogle Scholar
  6. 6.
    Duee PH, Darcy-Vrillon B, Blachier F, Morel MT (1995) Fuel selection in intestinal cells. Proc Nutr Soc 54:83–94PubMedCrossRefGoogle Scholar
  7. 7.
    Generoso SV, Viana M, Santos R, Martins FS, Machado JA, Arantes RM, Nicoli JR, Correia MI, Cardoso VN (2010) Saccharomyces cerevisiae strain UFMG 905 protects against bacterial translocation, preserves gut barrier integrity and stimulates the immune system in a murine intestinal obstruction model. Arch Microbiol 192:477–484PubMedCrossRefGoogle Scholar
  8. 8.
    Guilloteau P, Martin L, Eeckhaut V, Ducatelle R, Zabielski R, Van Immerseel F (2010) From the gut to the peripheral tissues: the multiple effects of butyrate. Nutr Res Rev 23:366–384PubMedCrossRefGoogle Scholar
  9. 9.
    Guilloteau P, Savary G, Jaguelin-Peyrault Y, Rome V, Le Normand L, Zabielski R (2010) Dietary sodium butyrate supplementation increases digestibility and pancreatic secretion in young milk-fed calves. J Dairy Sci 93:5842–5850PubMedCrossRefGoogle Scholar
  10. 10.
    Hamer HM, Jonkers D, Venema K, Vanhoutvin S, Troost FJ, Brummer RJ (2008) Review article: the role of butyrate on colonic function. Aliment Pharmacol Ther 27:104–119PubMedCrossRefGoogle Scholar
  11. 11.
    Hinnebusch BF, Meng S, Wu JT, Archer SY, Hodin RA (2002) The effects of short-chain fatty acids on human colon cancer cell phenotype are associated with histone hyperacetylation. J Nutr 132:1012–1017PubMedGoogle Scholar
  12. 12.
    Hornby PJ, Moore BA (2011) The therapeutic potential of targeting the glucagon-like peptide-2 receptor in gastrointestinal disease. Expert Opin Ther Targets 15:637–646PubMedGoogle Scholar
  13. 13.
    Hudcovic T, Kolinska J, Klepetar J, Stepankova R, Rezanka T, Srutkova D, Schwarzer M, Erban V, Du Z, Wells JM, Hrncir T, Tlaskalova-Hogenova H, Kozakova H (2012) Protective effect of Clostridium tyrobutyricum in acute dextran sodium sulphate-induced colitis: differential regulation of tumour necrosis factor-alpha and interleukin-18 in BALB/c and severe combined immunodeficiency mice. Clin Exp Immunol 167:356–365PubMedCrossRefGoogle Scholar
  14. 14.
    Kinoshita M, Suzuki Y, Saito Y (2002) Butyrate reduces colonic paracellular permeability by enhancing PPARgamma activation. Biochem Biophys Res Commun 293:827–831PubMedCrossRefGoogle Scholar
  15. 15.
    Luhrs H, Gerke T, Muller JG, Melcher R, Schauber J, Boxberge F, Scheppach W, Menzel T (2002) Butyrate inhibits NF-kappaB activation in lamina propria macrophages of patients with ulcerative colitis. Scand J Gastroenterol 37:458–466PubMedCrossRefGoogle Scholar
  16. 16.
    Martinez C, Vicario M, Ramos L, Lobo B, Mosquera JL, Alonso C, Sanchez A, Guilarte M, Antolin M, de Torres I, Gonzalez-Castro AM, Pigrau M, Saperas E, Azpiroz F, Santos J (2012) The jejunum of diarrhea-predominant irritable bowel syndrome shows molecular alterations in the tight junction signaling pathway that are associated with mucosal pathobiology and clinical manifestations. Am J GastroenterolGoogle Scholar
  17. 17.
    Melo ML, Brito GA, Soares RC, Carvalho SB, Silva JV, Soares PM, Vale ML, Souza MH, Cunha FQ, Ribeiro RA (2008) Role of cytokines (TNF-alpha, IL-1beta and KC) in the pathogenesis of CPT-11-induced intestinal mucositis in mice: effect of pentoxifylline and thalidomide. Cancer Chemother Pharmacol 61(5):775–784PubMedCrossRefGoogle Scholar
  18. 18.
    Ohata A, Usami M, Miyoshi M (2005) Short-chain fatty acids alter tight junction permeability in intestinal monolayer cells via lipoxygenase activation. Nutrition 21:838–847PubMedCrossRefGoogle Scholar
  19. 19.
    Peng L, He Z, Chen W, Holzman IR, Lin J (2007) Effects of butyrate on intestinal barrier function in a Caco-2 cell monolayer model of intestinal barrier. Pediatr Res 61:37–41PubMedCrossRefGoogle Scholar
  20. 20.
    Ramos MG, Bambirra EA, Cara DC, Vieira EC, Alvarez-Leite JI (1997) Oral administration of short-chain fatty acids reduces the intestinal mucositis caused by treatment with Ara-C in mice fed commercial or elemental diets. Nutr Cancer 28:212–217PubMedCrossRefGoogle Scholar
  21. 21.
    Rothenberg ME (2004) Eosinophilic gastrointestinal disorders (EGID). J Allergy Clin Immunol 113:11–28 quiz 29PubMedCrossRefGoogle Scholar
  22. 22.
    Sanderson IR (2007) Dietary modulation of GALT. J Nutr 137:2557S–2562SPubMedGoogle Scholar
  23. 23.
    Sappington PL, Han X, Yang R, Delude RL, Fink MP (2003) Ethyl pyruvate ameliorates intestinal epithelial barrier dysfunction in endotoxemic mice and immunostimulated caco-2 enterocytic monolayers. J Pharmacol Exp Ther 304:464–476PubMedCrossRefGoogle Scholar
  24. 24.
    Soares PM, Mota JM, Gomes AS, Oliveira RB, Assreuy AM, Brito GA, Santos AA, Ribeiro RA, Souza MH (2008) Gastrointestinal dysmotility in 5-fluorouracil-induced intestinal mucositis outlasts inflammatory process resolution. Cancer Chemother Pharmacol 63:91–98PubMedCrossRefGoogle Scholar
  25. 25.
    Souba WW, Scott TE, Wilmore DW (1985) Intestinal consumption of intravenously administered fuels. JPEN J Parenter Enteral Nutr 9:18–22PubMedCrossRefGoogle Scholar
  26. 26.
    Turner JR (2009) Intestinal mucosal barrier function in health and disease. Nat Rev Immunol 9:799–809PubMedCrossRefGoogle Scholar
  27. 27.
    Van Deun K, Pasmans F, Van Immerseel F, Ducatelle R, Haesebrouck F (2008) Butyrate protects Caco-2 cells from Campylobacter jejuni invasion and translocation. Br J Nutr 100:480–484PubMedCrossRefGoogle Scholar
  28. 28.
    Vieira EL, Leonel AJ, Sad AP, Beltrao NR, Costa TF, Ferreira TM, Gomes-Santos AC, Faria AM, Peluzio MC, Cara DC, Alvarez-Leite JI (2012) Oral administration of sodium butyrate attenuates inflammation and mucosal lesion in experimental acute ulcerative colitis. J Nutr Biochem (in press)Google Scholar
  29. 29.
    Windmueller HG, Spaeth AE (1978) Identification of ketone bodies and glutamine as the major respiratory fuels in vivo for postabsorptive rat small intestine. J Biol Chem 253:69–76PubMedGoogle Scholar
  30. 30.
    Xavier RJ, Podolsky DK (2007) Unravelling the pathogenesis of inflammatory bowel disease. Nature 448:427–434PubMedCrossRefGoogle Scholar
  31. 31.
    Yan BM, Shaffer EA (2009) Primary eosinophilic disorders of the gastrointestinal tract. Gut 58:721–732PubMedCrossRefGoogle Scholar
  32. 32.
    Yazbeck R, Howarth GS, Abbott CA (2009) Growth factor based therapies and intestinal disease: is glucagon-like peptide-2 the new way forward? Cytokine Growth Factor Rev 20:175–184PubMedCrossRefGoogle Scholar

Copyright information

© AOCS 2012

Authors and Affiliations

  • Talita Mayra Ferreira
    • 1
    • 3
  • Alda Jusceline Leonel
    • 1
    • 3
  • Marco Antônio Melo
    • 1
    • 3
  • Rosana R. G. Santos
    • 2
    • 3
  • Denise Carmona Cara
    • 2
    • 3
  • Valbert N. Cardoso
    • 2
    • 3
  • Maria I. T. D. Correia
    • 4
    • 3
  • Jacqueline I. Alvarez-Leite
    • 1
    • 3
    • 5
  1. 1.Departamento de Bioquímica e Imunologia, Instituto de Ciências BiológicasUniversidade Federal de Minas GeraisBelo HorizonteBrazil
  2. 2.Departamento de Análises Clínicas e Toxicológicas, Faculdade de FarmáciaUniversidade Federal de Minas GeraisBelo HorizonteBrazil
  3. 3.Departamento de Morfologia, Instituto de Ciências BiológicasUniversidade Federal de Minas GeraisBelo HorizonteBrazil
  4. 4.Departamento de Cirurgia, Faculdade de MedicinaUniversidade Federal de Minas GeraisBelo HorizonteBrazil
  5. 5.Universidade Federal de Minas GeraisBelo HorizonteBrazil

Personalised recommendations