Advertisement

Environmental Science and Pollution Research

, Volume 26, Issue 3, pp 2851–2863 | Cite as

Biochemical and transcriptomic response of earthworms Eisenia andrei exposed to soils irrigated with treated wastewater

  • Marouane Mkhinini
  • Iteb BoughattasEmail author
  • Noureddine Bousserhine
  • Mohammed Banni
Research Article
  • 93 Downloads

Abstract

In order to ensure better use of treated wastewater (TWW), we investigated the effect of three increasing doses of TWW, 10%, 50%, and 100%, on biochemical and transcriptomic statuses of earthworms Eisenia andrei exposed during 7 and 14 days. The effect of TWW on the oxidative status of E. andrei was observed, but this effect was widely dependent on the dilution degree of TWW. Results showed a significant decrease in the catalase (CAT) activity and an increase in the glutathione-S-transferase (GST) activity, and considerable acetylcholinesterase (AChE) inhibition was recorded after 14 days of exposure. Moreover, malondialdehyde (MDA) accumulation was found to be higher in exposed animals compared to control worms. The gene expression level revealed a significant upregulation of target genes (CAT and GST) during experimentation. These data provided new information about the reuse of TWW and its potential toxicity on soil organisms.

Keywords

Eisenia andrei Oxidative stress TWW Gene expression level Lipid peroxidation 

Introduction

An ecosystem engineer is defined as an organism that directly or indirectly modulates a resource’s availability to themselves or other ecosystem habitats by changing biotic or abiotic materials (Jones et al. 2014). In the soil, earthworms are considered the largest terrestrial macrofaunal biomass that prefers moist habitats of moderate temperature (Edwards and Bohlen 1996; Coleman et al. 2004; Li et al. 2017). Moreover, they participate in the transformation and the remold of organic matter, minerals, and chemicals in the soil (Brown et al. 2000) through bioturbation, burrowing activities, mucus secretion, and excretion (Rodriguez-Campos et al. 2014). Moreover, earthworms are considered a typical model in toxicological studies to assess the lethality, changes in behavior and inhibition of enzymes, gene expression levels, and DNA damages (Sánchez-Hernández 2006; Antunes et al. 2008; Moore et al. 2006; Banni et al. 2014; Sforzini et al. 2014; Liu et al. 2017; Wang et al. 2017). Indeed, assessing cellular activities that take place in the soil help in the comprehension of the soil ecosystem (Sforzini et al. 2014; Boughattas et al. 2016; Boughattas et al. 2017).

On the other hand, arid and semi-arid regions have been facing water scarcity in the past decades. This is exacerbated by population growth, rapid urbanization, and climate changes (Wu et al. 2014a, b). The agricultural field is among the most threatened sector as it is vulnerable to water shortage. Indeed, under the enormous pressure on freshwater resources, treated wastewater (TWW) has come to be considered a sustainable water resource to support agricultural needs. TWW has been increasingly integrated into the planning and development of water resources in Tunisia where its reuse had been regulated since 1965 (El Ayni et al. 2011). The challenge in promoting TWW reuse on irrigation is the wide varieties of pollutants contained in those non-conventional resources. However, due to the increasing interest in soil pollution, numerous studies have focused on the risks related to the reuse of TWW, which has started to garner public attention (Kim et al. 2007; Gros et al. 2010; Sui et al. 2011; Tanoue et al. 2012; Wu et al. 2014a, b; Jaramillo and Restrepo 2017). Nevertheless, this resource can be a potential natural fertilizer as a source of organic matter, minerals, and other nutrients for plant, microorganisms, and invertebrates.

Moreover, TWW is characterized by high salinity and the presence of emergent contaminants, in addition to heavy metals and pathogens. As a result, they are classified to be among the pollqutant effluents that contribute to the modification of soil parameters, consequently affecting the functioning of the soil’s invertebrates (Pelosi et al. 2014; Vasseur and Bonnard 2014; Abegunrin et al. 2016).

Several studies have established that toxics can readily cross cell membranes (Xue et al. 2009; Sforzini et al. 2018). This is a process that can generate a variable amount of reactive oxygen species (ROS) such as hydrogen peroxide (H2O2) and free radicals such as superoxide anions (O2·) and hydroxyl radical (·OH) (Roniz et al. 2004; Luo et al. 2005; Sun et al. 2008). In order to maintain the balance oxidant/antioxidant, earthworms use antioxidant enzymes such as catalase (CAT), which protects the cells from ROS damages and glutathione-S-transferase (GST) that have an essential role in xenobiotic biotransformation. In addition, acetylcholinesterase (AChE) is a crucial enzyme in the transmission of a nervous signal (Sanchez-Hernandez et al. 2018c). It rapidly hydrolyzes the neurotransmitter acetylcholine (ACh) at cholinergic synapses as well as at neuromuscular junctions (Grisaru et al. 2001; Sperling et al. 2012). Therefore, to assess the damages caused by the reactive species, malondialdehyde accumulation can provide information about the earthworm’s oxidative status as a final product of lipid peroxidation. Interestingly, an evaluation of the gene expression involved in xenobiotic detoxification pathway has been defined as a very helpful tool to understand the effect of chemicals and external pollutants on aquatic and terrestrial organisms, as reported by several recent studies (Chouchene et al. 2011; Banni et al. 2014; Banni et al., 2016a, b; Boughattas et al. 2017; Novo et al. 2018).

This work aims to investigate the effect of short-term TWW irrigation on biochemical and transcriptomic responses in the earthworm Eisenia andrei. First, the earthworm’s biochemical responses through enzyme activities of CAT, GST, AChE, and MDA accumulation were assessed. Second, a transcriptomic study was carried out based on available DNA sequences in order to quantify the gene expression pattern of two targets (CAT and GST).

Materials and methods

Soil sampling

Surface soil (0–20 cm) was taken from the experimental station in the Higher Institute of Agronomy Chott Meriem, Tunisia (Fig. 1). Experimental field is a biological plot situated in the middle east of Tunisia at the seaside that covers approximately 1 ha irrigated with freshwater and cultured mostly with vegetables like lettuce, cucumber, and artichoke. Soil sampling was effectuated at different points then homogenized and finally air-dried then crushed to pass 2-mm screen.
Fig. 1

Maps of Tunisia and localization of the biological plot in the higher agronomic institute of Chott-Mariem in Sousse Governorate where soils were collected (35° 54′ 50.17″ N; 10° 33′ 32.25″ E)

TWW sampling

Secondary TWW used in the experimentation was collected from the valve of an irrigated plot in Sousse Governorate in Tunisia. In polyethylene bottles, TWW samples were conserved with some drops of nitric acid and were analyzed later for pH, electrical conductivity respectively with pH meter (MetrOhm 744) and pH/Conductometer (MetrOhm 914); biochemical oxygen demand (BOD) and chemical oxygen demand (COD) according to (AFNOR NF in 1988-1 and AFNOR NF T 90-101 1988); and total coliform and Escherichia coli using MPN multiple-tube fermentation method according to (NF T 90-413). Finally, major elements (sodium, Na; potassium, K; calcium, Ca; and magnesium, Mg) and heavy metals (cadmium, Cd; copper, Cu; zinc, Zn; nickel, Ni; and chromium, Cr) were assessed using inductively coupled plasma based on optical emission spectroscopy (ICP-OES, Spectroblue) (NF EN ISO 11885).

Animals

Earthworms of the species Eisenia andrei (Bouché, 1972) were cultured as described in the OECD guidelines (OECD, 2004a). Organisms were selected from a synchronized culture with a homogeneous age structure. Adult worms with clitellum of similar size and weight (400–500 mg) were utilized in the experiments.

Exposure procedure

Experimented soils were irrigated with three concentrations of TWW against a control condition, control (C) 0% (deionized water), dose 1 (D1) 10% (90% deionized water/10% TWW), and dose 2 (D2) 50% (50% deionized water/50% TWW) and dose 3 (D3) 100% of TWW. In addition, soils were brought to 70% of their holding capacity and this was maintained during experimentation. Twenty earthworms were kept in 1 kg of soil placed in glass test containers (OECD 2004b). At least three replicates per condition were used. The test containers were maintained in a climate-controlled chamber at 20 ± 1 °C for a period of 7 and 14 days. Before chemical and molecular analyses, earthworms were kept on moist filter paper for 24 h to allow gut clearance.

Worms analysis

Oxidative stress biomarkers

Gut-cleaned earthworms (0.4–0.5 g; n = 10) were homogenized in a glass homogenizer in 0.1 M ice-cold extraction buffer (pH 7.5) containing 100 mM of K2HPO4 and 100 mM KH2PO4. The homogenates were centrifuged at 9000g for 25 min to generate the S9 fraction. After centrifugation, the supernatants were collected and stored at 80 °C until analysis.

All procedures were carried out at 4 °C. Proteins in the S9 fraction were quantified according to the Bradford method (1976) using Coomassie Blue reagent.

The CAT activity was determined according to Claiborne method (1985). The reaction mixture had a final volume of 1 mL and contained 0.78 mL 0.1 M phosphate buffer (pH 7.5) and 0.2 mL 0.5 mM H2O2. After 30 s of pre-incubation, the reaction was started by the addition of 0.02 mL of the S9 solution containing the CAT fractions. CAT activity was evaluated by kinetic measurement at 20 °C using a VWR-UV3100PC spectrophotometer (λ = 240 nm). The results were expressed as micromole of hydrogen peroxide transformed per minute and per milligram of protein.

The GST activity was measured by the method of Habig et al. (1974) using 10 μg of protein, 1 mM 1-chloro-2,4-dinitrobenzene (CDNB) (Sigma-Aldrich, Saint Louis, MO, USA) as a substrate, and 4 mM glutathione (reduced form; GSH) in 100 mM sodium phosphate buffer, pH 7.5. GST activity was determined by kinetic measurement at 20 °C using a VWR-UV3100PC spectrophotometer (λ = 340 nm). The results were expressed as micromole GSH-CDNB produced per minute and per milligram of protein.

The AChE activity was carried out according to the method of Ellman et al. (1961) using 50 μl of the S9 fraction, 2 mM acetylthiocholine as a substrate, and 8 mM 5-5′ DiThio Nitobenzoate-Bis (DTNB) in 100 mM sodium phosphate buffer, pH 7.5. AChE activity was determined by kinetic method after 2 min of incubation at 25 °C using a Jenway 6105 spectrophotometer (λ = 412 nm). Results were expressed as micromole transformed acetylthiocholine per minute per milligram of proteins.

MDA accumulation was evaluated as described by Livingstone et al. (1990) using 0.67% thiobarbituric acid TBA and 20% trichloroacetic acid TCA with 200 μl of protein fraction S9. The product of cell membrane’s degradation reacts with the mixture TCA/TBA to generate a pink product read on (λ = 532 nm). MDA concentration was expressed as micromole of produced MDA per milligram of protein.

Gene expression

Total RNA was extracted from worm pieces using acid phenol-chloroform precipitation according to Chomczynski and Sacchi (1987) with TRI-Reagent (Sigma-Aldrich). RNA was further purified by precipitation in the presence of 1.5 M LiCl2, and the quality of each RNA preparation was confirmed by UV spectroscopy and TBE agarose gel electrophoresis in the presence of formamide. The mRNA abundance of the genes CAT and GST was evaluated in multiplex Taqman assays according to Banni et al. (2007) and Negri et al. (2013). Probes and primer pairs (Table 1) were designed using Beacon Designer v3.0 (Premier Biosoft International, Inc.). MWG-Biotech GMBH (Germany) synthesized all primers and dual-labeled Taqman probes. cDNA (25 ng RNA reverse-transcribed to cDNA) was amplified in a CFX384 Real-Time PCR detection system (Bio-Rad Laboratories) using the iQTM Multiplex Power mix (Bio-Rad Laboratories) according to the manufacturer’s instructions for the triplex protocol. All multiplex combinations accounted for the following dual fluorescence tags: 6-carboxyfluorescein/Black Hole (BH) 1,6-carboxy-20,4,40,50,7,70-hexachlorofluorescein/BH1, and Texas Red/BH2. Briefly, cDNA was amplified in the presence of 1X iQTM Multiplex Power mix, 0.3 mM each primer, and 0.1 mM each probe (Table 2) in a final volume of 10 mL. Relative expression data were geometrically normalized to18S rRNA (AB558505.1), an invariant actin isotype (DQ286722.1), and ribosomal protein riboS13 (BB998368.1) (Tsyusko et al. 2012). A specific triplex Taqman assay was developed to amplify 0.25 ng of RNA reverse-transcribed to cDNA in the presence of 0.1 mM of each dual-labeled probe (hexachlorofluorescein/BH1 foractin, Texas Red/BH2 for 18S rRNA, and Hex/BH2 for proteinriboS13) and 0.1 mM, 0.4 mM, and 0.4 mM of the forward and reverse primers, respectively, for 18S rRNA, actin, and proteinriboS13 (Table 1). For all TaqMan assays, the thermal protocol was as follows: 30 s at 95 °C, followed by 40 cycles of 10 s at 95 °C, and 20 s at 60 °C. qRT-PCR was performed with four biological replicates and three technical replicates. Statistical analyses were carried out on the group mean values using a random reallocation test (Pfaffl et al. 2002). The relative expression stability of the three reference genes was calculated in our experimental conditions using GeNorm (Vandesompele et al. 2002). Our data showed expression stability values of 0.31 and 0.43 and 0.38 respectively for beta-actin and 18S and RiboS13 targets (Table 1).
Table 1

Q-PCR primers and Taqman probes

 

Probe 5′ 3′

Forward primer 5′ 3′

Reverse primer 5′ 3′

18S

CGCCGACAGAGTGCCATCGACGAA

AATTCCGATAACGAACGAGACTCT

GCCACTTGTCCCTCTAAGAAGTTA

Actin

AGTCCGGGCCATCCATCGTCCACA

GGATCAGCAAGCAGGAGTACG

TGGTCATTGATAATGGAGGCACTT

RiboS13

TCGCATGGTGTCGCTCAGACCCGT

TCACAGATTGGTGTTATCCTTCGA

GCAAGACCCTTAGCCTTCAGG

GST

AGCGGAGTGCCTGACCACGACCTC

GGTGTCCGATAGAATTCCTGCTAT

CTCCAGACCATTGTCTACAGCTAA

CAT

TGCCTTGTCTCTTGCCGCCATCGT

CTCGATTTCGTCTTATTCTTCGCC

CTTGTATTCGTTGAGTTGCTCGG

Given are gene ID, NCBI gene identifier; Taqman probe, sense primer, and antisense primer sequences. All sequences are given 5′ to 3′. Legend: 18S (AB558505.1), b-Actin (DQ286722.1), RiboS13 (BB998368.1), CAT (DQ286713.1)

Table 2

Physicochemical analysis of TWW used for the irrigation of the sampled soils

Parameters

 

Unit

Mean ± SD

Tunisian limitsa

pH

 

8.1 ± 0.02

6.5–8.5

Electrical conductivity

EC

mS cm−1

7.45 ± 0.12

7

Biochemical oxygen demand

BOD5

mg L−1

26.22 ± 0.47

30

Chemical oxygen demand

COD

mg L−1

87.47 ± 9.34

90

Calcium

Ca2+

mg L−1

187.05 ± 7.25

Sodium

Na+

mg L−1

310.33 ± 2.15

300

Potassium

K+

mg L−1

54 ± 1.17

50

Magnesium

Mg2+

mg L−1

63.17 ± 2.02

50

Escherichia coli

/100 mL

12,000

Total coliform

/100 mL

103,000

Data are presented as mean ± SD (n = 3)

aTunisian standard for wastewater reuse, NT 106.002 (1989)

Statistical analysis

The results for enzymatic activity, MDA content, and transcriptomic data were presented as the mean ± SD of 10 samples. SPSS Software version 21.0 was used for statistical analysis. For multiple comparisons, a parametric one-way analysis of variance (ANOVA) was performed on data along with Tukey’s test.

In order to analyze the relationship between different biomarkers, principal component analyses (PCAs) were performed using the R software and the package ADE4TkGUI (Thioulouse and Dray 2007).

Results

TWW analysis

In order to control the physicochemical quality of TWW used for the irrigation (Table 2) pH and electrical conductivity, EC were assessed. pH means 8.1 ± 0.02 was slightly basic without exceeding Tunisian standards (TS) NT 106.03 (6.5–8.5). In contrast, EC was a little bit higher than TS.

Organic pollution of TWW destined for irrigation was determined by BOD5 and COD which were high but did not exceed TS fixed at 30 and 90 mg L−1 respectively. Regarding major elements, means Na and K were almost higher than TS. Heavy metals given in Table 3 were under standards except for Cd (17.32 ± 0.75 μg L−1) which is higher than TS of TWW used for irrigation. Bacteriological analysis showed that TWWs are contaminated with coliform and E. coli, whatever it depends on the origin of wastewater.
Table 3

Heavy metal contents of TWW

Heavy metals

 

Unit

Means ± SD

Tunisian limitsa

Cadmium

Cd

μg L−1

17.32 ± 0.75

10

Copper

Cu

μg L−1

220.11 ± 2.25

500

Zinc

Zn

μg L−1

180.07 ± 9.34

5000

Chromium

Cr

μg L−1

10.7 ± 1.75

100

Nickel

Ni

μg L−1

110.43 ± 8.62

200

Data are presented as mean ± SD (n = 3)

aTunisian standard for wastewater reuse, NT 106.002 (1989)

Biochemical analyses

In this work, no mortality was observed in all investigated conditions (Table 4). However, no significant changes were observed globally except for earthworms exposed to 100% of TWW which showed a significant decrease of body weight 8.25 ± 0.29 (g) compared to an initial weight of 10.4 ± 0.72 (g).
Table 4

Body weight of Eisenia andrei (g) exposed for 7 and 14 days to three doses of TWW (C, control; D1, 10%; D2, 50%; and D3, 100%)

Period

C

D1

D2

D3

0 days

10.76 ± 1.22

11.36 ± 0.73

10.66 ± 0.9

10.4 ± 0.72

7 days

10.36 ± 1.33

10.7 ± 0.42

10 ± 0.78

9.6 ± 0.34

14 days

10.28 ± 0.84

10.65 ± 0.39

10.08 ± 0.68

8.25 ± 0.29**

Data are presented as mean ± SD

*Significant differences compared to earthworms exposed to control soil (p < 0.05)

CAT activity in animals exposed during 7 and 14 days to soils irrigated with different concentrations of TWW is shown in Fig. 2. Results demonstrated a significant decrease in CAT activity after 7 days of exposure, especially in soil irrigated with 100% of TWW where mean reach 4.97 ± 1.95 μmole/min/mg of protein. However, an essential recovery of the activity was recorded after 14 days compared to their control and to the activity recorded at day 0 (30.25 ± 1.2 μmole/min/mg of protein). This was noted mainly with D1 where CAT activity reached 27.29 ± 3.18 μmole/min/mg of protein.
Fig. 2

Relative activity of catalase measured in earthworms Eisenia andrei after 7 and 14 days of exposure to different doses of TWW (control; D1, 10%; D2, 50%; and D3, 100% of TWW). Values represent the mean ± SD of at least five replicates. (a) Statistically significant differences (p < 0.05) in comparison with 0-day control soils. (b) Statistically significant differences (p < 0.05) in comparison with 7-day control soils. (c) Statistically significant differences (p < 0.05) in comparison with 14-day control soils. (*) Statistically significant differences (p < 0.05) between 7- and 14-day soils

GST activity in earthworms E. andrei exposed for 7 and 14 days to soils irrigated with different doses of TWW was reported in Fig. 3. Within the range of tested concentration, GST activity did not exhibit any significant changes at a lower dose. However, the activity increased significantly in animals exposed to the higher TWW dose (100%) compared to the control and day 0 conditions and reached 10.21 ± 1.7 and 5.84 ± 0.75 μmole/min/mg of protein respectively after 7 and 14 days of exposure.
Fig. 3

Relative activity of glutathione-S-transferase measured in earthworms Eisenia andrei after 7 and 14 days of exposure to different doses of TWW (control; D1, 10%; D2, 50%; and D3, 100% of TWW). Values represent the mean ± SD of at least five replicates. (a) Statistically significant differences (p < 0.05) in comparison with 0-day control soils. (b) Statistically significant differences (p < 0.05) in comparison with 7-day control soils. (c) Statistically significant differences (p < 0.05) in comparison with 14-day control soils. (*) Statistically significant differences (p < 0.05) between 7- and 14-day soils

The effect of worm’s exposure to TWW on MDA contents is shown in Fig. 4. Compared to the control, MDA content in exposed earthworms increased gradually with TWW concentration to attend its maximum when exposed to D3 where means reached 8.16 ± 0.47 and 7.48 ± 0.44 μmole MDA/mg of tissue respectively after 7 and 14 days compared to an initial rate of 1.25 ± 0.18 at day 0.
Fig. 4

Malondialdehyde accumulation in Eisenia andrei earthworm tissues after 7 and 14 days of exposure to different dose of TWW (control; D1, 10%; D2, 50%; and D3, 100% of TWW). Values represent the mean ± SD of at least five replicates. (a) Statistically significant differences (p < 0.05) in comparison with 0-day control soils. (b) Statistically significant differences (p < 0.05) in comparison with 7-day control soils. (c) Statistically significant differences (p < 0.05) in comparison with 14-day control soils. (*) Statistically significant differences (p < 0.05) between 7- and 14-day soils

AChE inhibition in earthworms E. andrei tissues exposed to upwarded TWW doses is reported in Fig. 5. The enzymatic activity was inhibited especially in animals exposed to D2 and D3. The most inhibition was recorded with the application of 100% of TWW where the activity decreased by 91.22% and 88.65% respectively after 7 and 14 days, compared to the initial and control values.
Fig. 5

Relative activity of acetylcholinesterase measured in earthworms Eisenia andrei after 7 and 14 days of exposure to different doses of TWW (control; D1, 10%; D2, 50%; and D3, 100% of TWW). Values represent the mean ± SD of at least five replicates. (a) Statistically significant differences (p < 0.05) in comparison with 0-day control soils. (b) Statistically significant differences (p < 0.05) in comparison with 7-day control soils. (c) Statistically significant differences (p < 0.05) in comparison with 14-day control soils. (*) Statistically significant differences (p < 0.05) between 7- and 14-day soils

The result from PCA using biomarkers’ data in Eisenia andrei exposed to different doses of TWW illustrated in Fig. 6 showed that the first axis (59.9%) is slightly influenced by MDA and GST, while CAT and AChE composed mainly the second axis (24.3%).
Fig. 6.

PCA analysis of earthworm’s biomarkers evolution after 7 and 14 days of exposure to different soils irrigated with TWW. The plot of the oxidative biomarkers (a) and the plot of the four soils (b) are represented. Sampled are named: C: Control, D1: 10%, D2: 50%, D3: 100% and the number is the incubation time (0D, 7D and 14D)

These axes appeared associated with a specific earthworm response since firstly the three concentrations were clearly separated from control and day 0 (axis 1) and the two periods of exposure were different (axis 2). Indeed, animals exposed to D3 (100% of TWW) for 7 days are characterized by a high GST activity, a high MDA content, and an inhibition of CAT activity. Furthermore, animals exposed to pure TWW showed a crucial inhibition of AChE activity.

Transcriptomic analyses

Transcripts level of tow targets CAT and GST showed a significant variation between dose groups and control throughout 7 and 14 days’ test (Fig. 7a and b).
Fig. 7

QPCR data of a CAT and b GST targets. Gene expression was performed with respect to the reference condition (day 0) and was normalized against 18S rRNA, an invariant actin isotype and ribosomal protein riboS13. *Significantly different from reference condition. *p < 005, threshold cycle random reallocation test according to Pfaffl et al. (2002), n = 4. Worms were exposed for 7 and 14 days to different soils irrigated with TWW

After 7 days, an upregulation of CAT transcripts was shown, especially in worms exposed to 100% of TWW where mean reached 1.56 ± 0.12. After 14 days, a slight recovery was recorded, mainly in worms exposed to D1 where value recorded was 3.76 ± 0.33.

In contrast, GST expression level showed a significant upregulation, especially in worms exposed to D1 where mean reached 3.54 ± 0.29. After 14 days, a slight recovery was recorded and the most decrease was observed in animals exposed to D3 where transcripts reached 1.76 ± 0.21.

Discussion

Currently, there is an increasing concern about the reuse of TWW as a sustainable strategy to face the water shortage around the world. It is relatively well known that TWW is considered a potent natural fertilizer that brings in organic matter, minerals, and benefic strains of bacteria (Hamilton et al. 2007; Sharma et al. 2007; Angelakis and Durham 2008; Travis et al. 2010). However, numerous studies have provided evidence that TWW reuse on irrigation can also cause contamination due to the presence of heavy metals, xenobiotics, hydrocarbons, phenols, and pathogens in the water, which may affect the soil’s biological process (Wang et al. 2007; Arora et al. 2008; Al-Laham et al. 2003; Behera et al. 2011; Bedbabis et al. 2015; Belhaj et al. 2015). On the other hand, the biomarkers and bioindicator approach is being massively used in recent years and has become a suitable line for ecosystem diagnosis and assessment of the biological effects of the exposure of living beings to pollutants such as xenobiotic, heavy metals, organophosphates, hydrocarbons, and plastics (Hyne and Maher 2003; Weeks et al. 2004; Sanchez-Hernandez 2006; Rodriguez-Castellanos and Sanchez-Hernandez 2007). Moreover, several studies have proved that the earthworm is an impressive candidate for the assessment of the effect of pollutants on soil ecosystems (Hattab et al. 2015; Boughattas et al. 2016; Chen et al. 2017; Mkhinini et al. 2019).

In the current study, the effect of irrigation using three increasing doses of TWW on earthworms Eisenia andrei was investigated using a battery of biomarkers at the biochemical and transcriptomic levels. To our knowledge, this is the first work to deal with the effect of short-term TWW application on soil organisms, especially earthworms.

Physicochemical analysis and heavy metal concentrations of TWW, collected directly from a valve in an irrigated plot in Sousse Governorate (Tables 2 and 3), showed that they contain high levels of Na and K. Additionally, their pH and EC values were slightly high, which gave those effluents an alkaline character. In addition, the TWW used in this study contains an important amount of Escherichia coli, which exceeded the standard Tunisian limits. Thus, numerous studies have assessed the effect of secondary TWW on the soil properties in Tunisia and proved that their mediocre quality can affect some physicochemical and microbial properties of soils (Klay et al. 2010; Bedbabis et al. 2014; Bedbabis et . 2015; Houda et al. 2016).

Additionally, the heavy metal and bacteriological properties of TWW could be a severe threat to crops and soil organisms. This is in agreement with numerous studies (Emongor and Ramolemana 2004; Heiderpour et al. 2007; Chung et al. 2011; Khadhar et al. 2013; Belhaj et al. 2015; Houda et al. 2016; Zoghlami et al. 2018) that found that TWW, depending on its origin and quality, may also contain traces of elements such as cadmium, arsenic, or lead, or pathogens such as E.coli, which are environmental pollutants and toxic for animals and plants.

At a biochemical level, the oxidative stress biomarkers in earthworms E. andrei showed significant changes, demonstrating that they responded to a crucial oxidative stress caused by the pollutants present in the TWW used in the experimentation. The CAT activity decreased after 7 days and showed a slight recovery after 14 days. Our results are in opposition to Shreck et al.’s (2008) findings, which reported that the CAT activity in earthworms Aporrectodea caliginosa that were exposed to pesticides increased significantly, followed by a decrease after the long exposure period. Obviously, such a high toxicity may increase the ROS production, which surely involves the inhibition of enzymatic activities. Therefore, an adaptation process may happen with a prolongation of the exposure period (Zhang et al. 2016; Panzarino et al. 2016; Liang et al. 2017). Additionally, the decrease of the CAT activity could also be explained by an increase in the superoxide anion, as proved by (Kono and Fridovich 1982; Geret et al. 2002; Velki and Hackenberger 2013).

Moreover, the GST activity was significantly induced in earthworms exposed to D3 after 7 and 14 days of exposure compared to control. However, GST is a phase II of detoxification system’s enzyme and has the potential to catalyze the conjugation reaction of glutathione (GSH) and electrophilic xenobiotics that lead to the elimination of reactive electrophiles (Gondhowiardjo and van Haeringen, 1993; Saint-Denis et al. 2001; Maity et al. 2018).

Several studies have reported that TWW may bring pollutant and emergent contaminants to soils (Negreanu et al. 2012; Wu et al. 2014a, 2014b). Consequently, those exogenous inputs could create a cellular imbalance. So, in order to face these damages, earthworms enhance their defense mechanisms in several ways, such as, for example, by increasing enzymatic activities (Du et al. 2015).

One of the most damaging effects of the ROS and their products in cells is the peroxidation of the lipidic membrane, which is indicated by the MDA detection (Shalata and Tal 1998; Muir et al. 2007; Du et al. 2015). The MDA content in our study was significantly induced at 100% of TWW, demonstrating that the lipid peroxidation in the earthworm was promoted. Interestingly, several studies suggested that the lipid peroxidation of the cellular membrane is strongly related to an unbalanced increase of reactive oxygen species (Candan and Tarhan 2003; Xu et al. 2012; Du et al. 2015).

AChE activity was significantly inhibited after an exposure to different TWW doses after 7 days. Even after 14 days, the inhibition of this crucial enzyme continued. Additionally, our results showed a dose-response effect between the AChE inhibition and TWW concentration. The cholinesterase activity was widely studied; then its activity is inconstant as well as inhibition or activation, and this was reported by several studies (Booth et al. 1998, 2001; Romani et al. 2003; Frasco et al. 2005; Boughattas et al. 2017; Campani et al. 2017). Nevertheless, our findings can be compared to numerous works that assessed the AChE inhibition in earthworms after exposure to a wide variety of pollutants, especially pesticides and trace elements (Gambi et al. 2007; Jouni et al. 2018; Mkhinini et al. 2019; Sanchez-Hernandez et al. 2018a, b; Yang et al. 2018).

In order to follow the gene expression pattern of the tow target CAT and GST involved in the antioxidant defense system, a quantitative method (q-PCR) was used. The transcriptomic data also underlined contrasting effects of the TWW reuse on earthworms E. andrei. However, the gene expression level of the CAT and GST decreased significantly as the dosage of TWW increased. But overall, there is an upregulation of CAT and GST targets at 7 and 14 days of exposure when compared to the control level.

Taken together, the enzymatic activity and gene expression pattern of CAT decreased after 7 days and increased after 14 days of exposure to a growing gradient of TWW. In contrast, the GST activity and its gene expression level were inversely proportional, which means that the enzymatic activity elevation was associated with a downregulation of gene expression. During stressed conditions, organisms can adjust its cellular processes via the transcriptional pathway. The capacity of a stressed organism to regulate its cellular processes can allow it to cope with the alterations of cellular functions and avoid non-reversible cellular alterations (Banni et al. 2011; Hattab et al. 2015; Banni et al. 2016a, b; Boughattas et al. 2017).

Finally, the secondary TWW reuse in agriculture could be considered a sustainable way to palliate water scarcity and a natural fertilizer that brings a large amount of organic matter and minerals to soils, as has been shown widely in numerous works (Zayneb et al. 2015; Abdoulkader et al. 2015; Assouline et al. 2015). In Tunisia, based on the origin of the wastewater collected commonly from the urban zone, hospitals, hotels, and some industries; the methods and levels of treatments (activated sludge, secondary treatments); and period, it can be said that some parameters in TWW can exceed the national limits.

Conclusion

In summary, this ecotoxicological study showed that earthworm Eisenia andrei has been subject to crucial oxidative stress. This was manifested by several changes in the enzymatic activities of CAT, GST, and AChE; MDA accumulation; and the gene expression of tow targets (CAT and GST). The TWW used in this study contains many pollutants that exceed the maximum recommended values, such as Cd and E. coli, hence presenting a serious threat to the soil ecosystem.

Few studies on the harmful effects following TWW irrigation are so far available, with the ones available being restricted to vegetables and the physicochemical properties of soils that have been irrigated for many years with this non-conventional resource. Our findings underlined how TWW can affect the biological activities of earthworms, which are the most popular biomass among soil organisms. This must be carefully considered with the view to come up with a well-managed and periodic control of TWW before their reuse in irrigation.

References

  1. Abdoulkader BA, Mohamed B, Nabil M, Alaoui-Sossé B, Eric C, Aleya L (2015) Wastewater use in agriculture in Djibouti: Effectiveness of sand filtration treatments and impact of wastewater irrigation on growth and yield of Panicum maximum. Ecol Eng 84:607–614.  https://doi.org/10.1016/j.ecoleng.2015.09.065 Google Scholar
  2. Abegunrin TP, Awe GO, Idowu DO, Adejumobi MA (2016) Impact of wastewater irrigation on soil physico-chemical properties, growth and water use pattern of two indigenous vegetables in southwest Nigeria. Catena 139:167–178.  https://doi.org/10.1016/j.catena.2015.12.014 Google Scholar
  3. AFNOR NF EN 1988-1. Water quality-determination of biochemical oxygen demand after n days (BODn)Google Scholar
  4. AFNOR NF T 90-101 (1988) Qualité de l’eau. Détérm. Oxyg (DCO), Demande Chim.Google Scholar
  5. Al-Lahham O, El Assi NM, Fayyad M (2003) Impact of treated wastewater irrigation on quality attributes and contamination of tomato fruit. Agric Water Manag 61:51–62.  https://doi.org/10.1016/S0378-3774(02)00173-7 Google Scholar
  6. Angelakis AN, Durham B (2008) Water recycling and reuse in EUREAU countries: Trends and challenges. Desalination 218(1-3):3–12.  https://doi.org/10.1016/j.desal.2006.07.015 Google Scholar
  7. Antunes SC, Castro BB, Nunes B, Pereira R, Gonçalves F (2008) In situ bioassay with Eisenia andrei to assess soil toxicity in an abandoned uranium mine. Ecotoxicol Environ Saf 71:620–631.  https://doi.org/10.1016/j.ecoenv.2008.02.007 Google Scholar
  8. Arora M, Kiran B, Rani S, Rani A, Kaur B, Mittal N (2008) Heavy metal accumulation in vegetables irrigated with water from different sources. Food Chem 111:811–815.  https://doi.org/10.1016/j.foodchem.2008.04.049 Google Scholar
  9. Assouline S, Narkis K, Gherabli R, Sposito G (2015) Combined effect of sodicity and organic matter on soil properties under long-term irrigation with treated wastewater.  https://doi.org/10.2136/vzj2015.12.0158
  10. Banni M, Dondero F, Jebali J, Guerbej H, Boussetta H, Viarengo A (2007) Assessment of heavy metal contamination using real-time PCR analysis of mussel metallothionein mt10 and mt20 expression: a validation along the Tunisian coast. Biomarkers 12:369–383.  https://doi.org/10.1080/13547500701217061
  11. Banni M, Negri A, Mignone F, Boussetta H, Viarengo A, Dondero F (2011) Gene expression rhythms in the mussel mytilus galloprovincialis (Lam.) across an annual cycle. PLoS One 6.  https://doi.org/10.1371/journal.pone.0018904
  12. Banni M, Hajer A, Sforzini S, Oliveri C, Boussetta H, Viarengo A (2014) Transcriptional expression levels and biochemical markers of oxidative stress in Mytilus galloprovincialis exposed to nickel and heat stress. Comp Biochem Physiol - C Toxicol Pharmacol 160:23–29.  https://doi.org/10.1016/j.cbpc.2013.11.005 Google Scholar
  13. Banni M, Sforzini S, Balbi T, Corsi I, Viarengo A, Canesi L (2016a) Combined effects of n-TiO2and 2,3,7,8-TCDD in Mytilus galloprovincialis digestive gland: a transcriptomic and immunohistochemical study. Environ Res 145:135–144 .  https://doi.org/10.1016/j.envres.2015.12.003
  14. Banni M, Sforzini S, Balbi T, et al. (2016b) Digestive gland : a transcriptomic and immunohistochemical study. 145:135–144 .  https://doi.org/10.1016/j.envres.2015.12.003
  15. Bedbabis S, Ben Rouina B, Boukhris M, Ferrara G (2014) Effect of irrigation with treated wastewater on soil chemical properties and infiltration rate. J Environ Manage 133:45–50.  https://doi.org/10.1016/j.jenvman.2013.11.007 Google Scholar
  16. Bedbabis S, Trigui D, Ben C, et al. (2015) Long-terms effects of irrigation with treated municipal wastewater on soil , yield and olive oil quality. Agric Water Manag 160:14–21 .  https://doi.org/10.1016/j.agwat.2015.06.023
  17. Behera SK, Kim HW, Oh JE, Park HS (2011) Occurrence and removal of antibiotics, hormones and several other pharmaceuticals in wastewater treatment plants of the largest industrial city of Korea. Sci Total Environ 409:4351–4360.  https://doi.org/10.1016/j.scitotenv.2011.07.015 Google Scholar
  18. Belhaj D, Baccar R, Jaabiri I, Bouzid J, Kallel M, Ayadi H, Zhou JL (2015) Fate of selected estrogenic hormones in an urban sewage treatment plant in Tunisia (North Africa). Sci Total Environ 505:154–160.  https://doi.org/10.1016/j.scitotenv.2014.10.018 Google Scholar
  19. Booth LH, Heppelthwaite V, Eason CT (1998) Cholinesterase and glutathione S-transferase in the earthworm Apporectodea Caliginosa as biomarkers of organophosphate exposure. Society 138–142Google Scholar
  20. Booth LH, Hodge S, O’Halloran K (2001) Use of biomarkers in earthworms to detect use and abuse of field applications of a model organophosphate pesticide. Bull Environ Contam Toxicol 67:633–640.  https://doi.org/10.1007/s001280171 Google Scholar
  21. Bouché MB (1972) Lombriciens de France. Ecologie et systématique, I.N.R.A.Google Scholar
  22. Boughattas I, Hattab S, Boussetta H, Sappin-Didier V, Viarengo A, Banni M, Sforzini S (2016) Biomarker responses of Eisenia andrei to a polymetallic gradient near a lead mining site in North Tunisia. Environ Pollut 218:530–541.  https://doi.org/10.1016/j.envpol.2016.07.033 Google Scholar
  23. Boughattas I, Hattab S, Boussetta H, Banni M, Navarro E (2017) Impact of heavy metal contamination on oxidative stress of Eisenia andrei and bacterial community structure in Tunisian mine soil. Environ Sci Pollut Res 24:18083–18,095.  https://doi.org/10.1007/s11356-017-9449-8 Google Scholar
  24. Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254.  https://doi.org/10.1016/0003-2697(76)90527-3 Google Scholar
  25. Brown GG, Barois I, Lavelle P (2000) Regulation of soil organic matter dynamics and microbial activityin the drilosphere and the role of interactionswith other edaphic functional domains. Eur J Soil Biol 36:177–198.  https://doi.org/10.1016/S1164-5563(00)01062-1 Google Scholar
  26. Campani T, Caliani I, Pozzuoli C, Romi M, Fossi MC, Casini S (2017) Assessment of toxicological effects of raw and bioremediated olive mill waste in the earthworm Eisenia fetida: A biomarker approach for sustainable agriculture. Appl Soil Eco 119:18–25.  https://doi.org/10.1016/j.apsoil.2017.05.016 Google Scholar
  27. Candan N, Tarhan L (2003) The correlation between antioxidant enzyme activities and lipid peroxidation levels in Mentha pulegium organs grown in Ca2+, Mg2+, Cu2+, Zn2+and Mn2+stress conditions. Plant Sci 165:769–776.  https://doi.org/10.1016/S0168-9452(03)00269-3 Google Scholar
  28. Chen X, Wang X, Gu X, Jiang Y, Ji R (2017) Oxidative stress responses and insights into the sensitivity of the earthworms Metaphire guillelmi and Eisenia fetida to soil cadmium. Sci Tot Environ 574:300–306.  https://doi.org/10.1016/j.scitotenv.2016.09.059 Google Scholar
  29. Chomczynski P (1987) Single-step method of RNA isolation by acid guanidinium extraction. 159:156–159.  https://doi.org/10.1016/0003-2697(87)90021-2
  30. Chouchene L, Banni M, Kerkeni A, Saïd K, Messaoudi I (2011) Cadmium-induced ovarian pathophysiology is mediated by change in gene expression pattern of zinc transporters in zebrafish (Danio rerio). Chem Biol Inter 193(2):172–179.  https://doi.org/10.1007/s10534-011-9456-z Google Scholar
  31. Chung BY, Song CH, Park BJ, Cho JY (2011) Heavy metals in brown rice (Oryza sativa L.) and soil after long-term irrigation of wastewater discharged from domestic sewage treatment plants. Pedosphere 21:621–627.  https://doi.org/10.1016/S1002-0160(11)60164-1 Google Scholar
  32. Claiborne A (1985) Catalase activity. In: Greenwald RA (ed) Handbook of methods for oxygen radical research. CRC Press, Boca Raton, pp 283–284Google Scholar
  33. Coleman DC, Crossley DA Jr, Hendrix PF (2004) Fundamentals of Soil Ecology, 2nd edn. Elsevier Academic Press, San DiegoGoogle Scholar
  34. Du L, Li G, Liu M, Li Y, Yin S, Zhao J, Zhang X (2015) Evaluation of DNA damage and antioxidant system induced by di-n-butyl phthalates exposure in earthworms (Eisenia fetida). Ecotoxicol Environ Saf 115:75–82.  https://doi.org/10.1016/j.ecoenv.2015.01.031 Google Scholar
  35. Ayni F El, Cherif S, Jrad A, Trabelsi-Ayadi M (2011) Impact of treated wastewater reuse on agriculture and aquifer recharge in a coastal area: Korba Case Study. Water Resour Manag 25:2251–2265 .  https://doi.org/10.1007/s11269-011-9805-2
  36. Edwards CA, Bohlen PJ (1992) The effects of toxic chemicals on earthworms. Environ Contam Toxicol 125:23–100Google Scholar
  37. Ellman GL, Courtney KD, Andres V Jr, Featherstone RM (1961) A new and rapid colorimetric determination of acetylcholinesterase activity. Bioch Pharm 7(2):88–95.  https://doi.org/10.1016/0006-2952(61)90145-9 Google Scholar
  38. Emongor VE, Ramolemana GM (2004) Treated sewage effluent (water) potential to be used for horticultural production in Botswana. Phys Chem Earth 29:1101–1108.  https://doi.org/10.1016/j.pce.2004.08.003 Google Scholar
  39. Frasco MF, Fournier D, Carvalho F, Guilhermino L (2005) Do metals inhibit acetylcholinesterase (AchE)? Implementation of assay conditions for the use of AchE activity as a biomarker of metal toxicity. Biomarkers 10:360–375.  https://doi.org/10.1080/13547500500264660 Google Scholar
  40. Gambi N, Pasteris A, Fabbri E (2007) Acetylcholinesterase activity in the earthworm Eisenia andrei at different conditions of carbaryl exposure. Comp Biochem Physiol - C Toxicol Pharmacol 145:678–685.  https://doi.org/10.1016/j.cbpc.2007.03.002 Google Scholar
  41. Geret F, Serafim A, Barreira L, João Bebianno M (2002) Response of antioxidant systems to copper in the gills of the clam Ruditapes decussatus. Mar Environ Res 54:413–417.  https://doi.org/10.1016/S0141-1136(02)00164-2 Google Scholar
  42. Gondhowiardjo TD (1993) Corneal aldehyde dehydrogenase, glutathione reductase, and glutathione S-transferase in pathologic corneas. Cornea 12(4):310–314Google Scholar
  43. Grisaru D, Deutsch V, Shapira M, Pick M, Sternfeld M, Melamed-Book N, Kaufer D, Galyam N, Gait MJ, Owen D, Lessing JB, Eldor A, Soreq H (2001) ARP, a peptide derived from the stress-associated acetylcholinesterase variant, has hematopoietic growth promoting activities. Mol Med 7:93–105Google Scholar
  44. Gros M, Petrović M, Ginebreda A, Barceló D (2010) Removal of pharmaceuticals during wastewater treatment and environmental risk assessment using hazard indexes. Environ Int 36:15–26.  https://doi.org/10.1016/j.envint.2009.09.002 Google Scholar
  45. Habig WJ, Pabst MJ, Jacoby WB (1974) Glutathione S-transferase, the first enzymatic step in mercapturic acid formation. J Biol Chem 249:7130–7139Google Scholar
  46. Hamilton AJ, Stagnitti F, Xiong X, Kreidl SL, Benke KK, Maher P (2007) Wastewater irrigation: the state of play. Vadose Zo J 6:823.  https://doi.org/10.2136/vzj2007.0026 Google Scholar
  47. Hattab S, Boughattas I, Boussetta H, Viarengo A, Banni M, Sforzini S (2015) Transcriptional expression levels and biochemical markers of oxidative stress in the earthworm Eisenia andrei after exposure to 2,4-dichlorophenoxyacetic acid (2,4-D). Ecotoxicol Environ Saf 122:76–82.  https://doi.org/10.1016/j.ecoenv.2015.07.014 Google Scholar
  48. Heidarpour M, Mostafazadeh-Fard B, Abedi Koupai J, Malekian R (2007) The effects of treated wastewater on soil chemical properties using subsurface and surface irrigation methods. Agric Water Manag 90:87–94.  https://doi.org/10.1016/j.agwat.2007.02.009 Google Scholar
  49. Houda Z, Bejaoui Z, Albouchi A (2016) Comparative study of plant growth of two poplar tree species irrigated with treated wastewater , with particular reference to accumulation of heavy metals ( Cd , Pb , As , and Ni ).  https://doi.org/10.1007/s10661-016-5102-0
  50. Hyne RV, Maher WA (2003) Invertebrate biomarkers: links to toxicosis that predict population decline. Ecotoxicol Environ Saf 54:366–374.  https://doi.org/10.1016/S0147-6513(02)00119-7 Google Scholar
  51. Jaramillo MF, Restrepo I (2017) Wastewater reuse in agriculture: a review about its limitations and benefits. Sustain 9.  https://doi.org/10.3390/su9101734
  52. Jones CG, Lawton JH, Shachak M (2014) Positive and negative effects of organisms as physical ecosystem engineers positive and negative effects of organisms as. 78:1946–1957Google Scholar
  53. Jouni F, Sanchez-hernandez JC, Mazzia C, Jobin M (2018) Interspecific differences in biochemical and behavioral biomarkers in endogeic earthworms exposed to ethyl-parathion. ECSN.  https://doi.org/10.1016/j.chemosphere.2018.03.060
  54. Khadhar S, Abdelkarim C, Yassin H, Teruo H (2013) The effect of long-term soil irrigation by wastewater on organic matter, polycyclic aromatic hydrocarbons, and heavy metals evolution: case study of Zaouit Sousse (Tunisia). Arab J Geosci 6(11):4337–4346.  https://doi.org/10.1007/s12517-012-0666-7 Google Scholar
  55. Kim S, Aga DS (2007) Potential ecological and human health impacts of antibiotics and antibiotic-resistant bacteria from wastewater treatment plants. J Toxicol Environ Heal - Part B Crit Rev 10:559–573.  https://doi.org/10.1080/15287390600975137 Google Scholar
  56. Klay S, Charef A, Ayed L et al (2010) Effect of irrigation with treated wastewater on geochemical properties (saltiness, C, N and heavy metals) of isohumic soils (Zaouit Sousse perimeter, Oriental Tunisia). Desalination 253:180–187.  https://doi.org/10.1016/j.desal.2009.10.019 Google Scholar
  57. Kono Y, Fridovich I (1982) Superoxide radical inhibits catalase. J Biol Chem 257:5751–5754Google Scholar
  58. Li L, Yang D, Song Y, Shi Y, Huang B, Bitsch A, Yan J (2017) The potential acute and chronic toxicity of cyfluthrin on the soil model organism, Eisenia fetida. Ecotoxicol Environ Saf 144:456–463.  https://doi.org/10.1016/j.ecoenv.2017.06.064 Google Scholar
  59. Liang J, Xia X, Yuan L, Zhang W, Lin K, Zhou B, Hu S (2017) The reproductive responses of earthworms (Eisenia fetida) exposed to nanoscale zero-valent iron (nZVI) in the presence of decabromodiphenyl ether (BDE209). Environ Pollut:1–8.  https://doi.org/10.1016/j.envpol.2017.10.130
  60. Liu T, Wang X, You X, Chen D, Li Y, Wang F (2017) Oxidative stress and gene expression of earthworm (Eisenia fetida) to clothianidin. Ecotoxicolo Environ Saf 142:489–496.  https://doi.org/10.1016/j.ecoenv.2017.04.012 Google Scholar
  61. Livingstone D, Martinez PG, Michel X, Narbonne JF, O'hara S, Ribera D, Winston GW (1990) Oxyradical production as a pollution-mediated mechanism of toxicity in the common mussel, Mytilus edulis L., and other molluscs. Func Eco 3(4):415–424.  https://doi.org/10.2307/2389604 Google Scholar
  62. Luo J, Shi R (2005) Acrolein induces oxidative stress in brain mitochondria. Neurochem Int 46:243–252.  https://doi.org/10.1016/j.neuint.2004.09.001 Google Scholar
  63. Maity S, Banerjee R, Goswami P et al (2018) Chemosphere oxidative stress responses of two different ecophysiological species of earthworms ( Eutyphoeus waltoni and Eisenia fetida ) exposed to Cd-contaminated soil. Chemosphere 203:307–317.  https://doi.org/10.1016/j.chemosphere.2018.03.189 Google Scholar
  64. Mkhinini M, Boughattas I, Alphonse V, Livet A, Bousserrhine N, Banni M (2019) Effect of treated wastewater irrigation in East Central region of Tunisia (Monastir governorate) on the biochemical and transcriptomic response of earthworms Eisenia andrei. Sci Tot Environ 647:1245–1255.  https://doi.org/10.1016/j.scitotenv.2018.07.449 Google Scholar
  65. Moore MN, Icarus Allen J, McVeigh A (2006) Environmental prognostics: an integrated model supporting lysosomal stress responses as predictive biomarkers of animal health status. Mar Environ Res 61:278–304.  https://doi.org/10.1016/j.marenvres.2005.10.005 Google Scholar
  66. Muir MA, Yunusa IAM, Burchett MD, Lawrie R, Chan KY, Manoharan V (2007) Short-term responses of two contrasting species of earthworms in an agricultural soil amended with coal fly-ash. Soil Bio Biochem 39(5):987–992.  https://doi.org/10.1016/j.soilbio.2006.10.006 Google Scholar
  67. Negreanu Y, Pasternak Z, Jurkevitch E, Cytryn E (2012) Impact of treated wastewater irrigation on antibiotic resistance in agricultural soils. Environ Sci Technol 46:4800–4808.  https://doi.org/10.1021/es204665b Google Scholar
  68. Negri A, Potocki W, Iwanicki A, Obuchowski M, Hinc K (2013) Expression and display of Clostridium difficile protein FliD on the surface of Bacillus subtilis spores. J Med Microbiol 62:1379–1385.  https://doi.org/10.1099/jmm.0.057372-0 Google Scholar
  69. Novo M, Verdú I, Trigo D, Martínez-Guitarte JL (2018) Endocrine disruptors in soil: effects of bisphenol A on gene expression of the earthworm Eisenia fetida. Ecotoxicol Environ Saf 150:159–167.  https://doi.org/10.1016/j.ecoenv.2017.12.030 Google Scholar
  70. OECD, 2004a. Test no. 222. Earthworm reproduction test (Eisenia fetida/andrei). OECD Guidelines for the Testing of Chemicals, Organisation for Economic Co-operation and Development.Google Scholar
  71. OECD, 2004b. Test no. 220. Enchytraeid Reproduction Test. OECD Guidelines for the Testing of Chemicals, Organisation for Economic Co-operation and Development.Google Scholar
  72. Panzarino O, Hyršl P, Dobeš P, Vojtek L, Vernile P, Bari G, Terzano R, Spagnuolo M, de Lillo E (2016) Rank-based biomarker index to assess cadmium ecotoxicity on the earthworm Eisenia andrei. Chemosphere 145:480–486.  https://doi.org/10.1016/j.chemosphere.2015.11.077 Google Scholar
  73. Pelosi C, Barot S, Capowiez Y, Hedde M, Vandenbulcke F (2014) Pesticides and earthworms. A review. Agron Sustain Dev 34:199–228.  https://doi.org/10.1007/s13593-013-0151-z Google Scholar
  74. Pfaffl MW, Horgan GW, Dempfle L (2002) Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res 30:e36.  https://doi.org/10.1093/nar/30.9.e36 Google Scholar
  75. Rodriguez-Campos J, Dendooven L, Alvarez-Bernal D, Contreras-Ramos SM (2014) Potential of earthworms to accelerate removal of organic contaminants from soil: a review. Appl Soil Ecol 79:10–25.  https://doi.org/10.1016/j.apsoil.2014.02.010 Google Scholar
  76. Rodríguez-Castellanos L, Sanchez-Hernandez JC (2007) Earthworm biomarkers of pesticide contamination: current status and perspectives. J Pestic Sci 32:360–371 .  https://doi.org/10.1584/jpestics. R07-14
  77. Romani R, Antognelli C, Baldracchini F, De Santis A, Isani G, Giovannini E, Rosi G (2003) Increased acetylcholinesterase activities in specimens of Sparus auratus exposed to sublethal copper concentrations. Chem Biol Interact 145:321–329.  https://doi.org/10.1016/S0009-2797(03)00058-9 Google Scholar
  78. Ronis MJJ, Hakkak R, Korourian S, Albano E, Yoon S, Ingelman-Sundberg M, Lindros KO, Badger TM (2004) Alcoholic liver disease in rats fed ethanol as part of oral or intragastric low-carbohydrate liquid diets. Exp Biol Med (Maywood) 229:351–360Google Scholar
  79. Saint-Denis M, Narbonne JF, Arnaud C, Ribera D (2001) Biochemical responses of the earthworm Eisenia fetida andrei exposed to contaminated artificial soil: effects of lead acetate. Soil Biol Biochem 33:395–404.  https://doi.org/10.1016/S0038-0717(00)00177-2 Google Scholar
  80. Sanchez-Hernandez JC (2006) Earthworm biomarkers in ecological risk assessment. In: Reviews of environmental contamination and toxicology. Springer, New York, pp 85–126Google Scholar
  81. Sanchez-Hernandez JC, Manuel J, Andrés R (2018a) Response of digestive enzymes and esterases of ecotoxicological concern in earthworms exposed to chlorpyrifos-treated soils. Ecotoxicology:890–899.  https://doi.org/10.1007/s10646-018-1914-8
  82. Sanchez-Hernandez JC, Notario del Pino J, Capowiez Y et al (2018b) Soil enzyme dynamics in chlorpyrifos-treated soils under the influence of earthworms. Sci Total Environ 612:1407–1416.  https://doi.org/10.1016/j.scitotenv.2017.09.043 Google Scholar
  83. Sanchez-Hernandez JC, Notario del Pino J, Capowiez Y, Mazzia C, Rault M (2018c) Soil enzyme dynamics in chlorpyrifos-treated soils under the influence of earthworms. Sci Total Environ 612:1407–1416.  https://doi.org/10.1016/j.scitotenv.2017.09.043 Google Scholar
  84. Schreck E, Geret F, Gontier L, Treilhou M (2008) Neurotoxic effect and metabolic responses induced by a mixture of six pesticides on the earthworm Aporrectodea caliginosa nocturna. Chemosphere 71:1832–1839.  https://doi.org/10.1016/j.chemosphere.2008.02.003 Google Scholar
  85. Sforzini S, Moore MN, Boeri M, Bencivenga M, Viarengo A (2014) Effects of PAHs and dioxins on the earthworm Eisenia andrei: a multivariate approach for biomarker interpretation. Environ Pollut 196:60–71.  https://doi.org/10.1016/j.envpol.2014.09.015 Google Scholar
  86. Sforzini S, Oliveri C, Orrù A, Chessa G, Pacchioni B, Millino C, Jha AN, Viarengo A, Banni M (2018) Application of a new targeted low density microarray and conventional biomarkers to evaluate the health status of marine mussels: a field study in Sardinian coast, Italy. Sci Total Environ 628–629:319–320.  https://doi.org/10.1016/j.scitotenv.2018.01.293 Google Scholar
  87. Shalata A, Tal M (1998) The effect of salt stress on lipid peroxidation and antioxidants in the leaf of the cultivated tomato and its wild salt‐tolerant relative Lycopersicon pennellii. Physio Plant 104(2):169–174.  https://doi.org/10.1034/j.1399-3054.1998.1040204.x Google Scholar
  88. Sharma KP, Sharma S, Sharma S, Singh PK, Kumar S, Grover R, Sharma PK (2007) A comparative study on characterization of textile wastewaters (untreated and treated) toxicity by chemical and biological tests. Chemo 69(1):48–54.  https://doi.org/10.1016/j.chemosphere.2007.04.086 Google Scholar
  89. Sperling LE, Klaczinski J, Schütz C, Rudolph L, Layer PG (2012) Mouse acetylcholinesterase enhances neurite outgrowth of rat R28 cells through interaction with laminin-1. PLoS One 7:1–11.  https://doi.org/10.1371/journal.pone.0036683 Google Scholar
  90. Sui Q, Huang J, Deng S, Chen W, Yu G (2011) Seasonal variation in the occurrence and removal of pharmaceuticals and personal care products in different biological wastewater treatment processes. Environ Sci Tech 45(8):3341–3348.  https://doi.org/10.1021/es200248d Google Scholar
  91. Sun KH, De Pablo Y, Vincent F, Shah K (2008) Deregulated Cdk5 promotes oxidative stress and mitochondrial dysfunction. J Neurochem 107:265–278.  https://doi.org/10.1111/j.1471-4159.2008.05616.x Google Scholar
  92. Tanoue R, Sato Y, Motoyama M, Nakagawa S, Shinohara R, Nomiyama K (2012) Plant uptake of pharmaceutical chemicals detected in recycled organic manure and reclaimed wastewater.  https://doi.org/10.1021/jf303142t
  93. Thioulouse J, Dray S (2007) Interactive multivariate data analysis in R with the ade4 and ade4TkGUI Packages. J Stat Softw 22:1–14 . citeulike-article-id:3973175Google Scholar
  94. Travis MJ, Wiel-Shafran A, Weisbrod N, Adar E, Gross A (2010) Greywater reuse for irrigation: Effect on soil properties. Sci Tot Environ 408(12):2501–2508.  https://doi.org/10.1016/j.scitotenv.2010.03.005 Google Scholar
  95. Tsyusko OV, Hardas SS, Shoults-Wilson WA, Starnes CP, Joice G, Butterfield DA, Unrine JM (2012) Short-term molecular-level effects of silver nanoparticle exposure on the earthworm, Eisenia fetida. Environ Pollut 171:249–255.  https://doi.org/10.1016/j.envpol.2012.08.003 Google Scholar
  96. Vasseur P, Bonnard M (2014) Ecogenotoxicology in earthworms: a review. Curr Zool 60:255–272.  https://doi.org/10.1093/czoolo/60.2.255 Google Scholar
  97. Velki M, Hackenberger BK (2013) Inhibition and recovery of molecular biomarkers of earthworm Eisenia andrei after exposure to organophosphate dimethoate. Soil Biol Biochem 57:100–108.  https://doi.org/10.1016/j.soilbio.2012.09.018 Google Scholar
  98. Wang Y, Zhang Q, Lv J, Li A, Liu H, Li G, Jiang G (2007) Polybrominated diphenyl ethers and organochlorine pesticides in sewage sludge of wastewater treatment plants in China. Chemosphere 68(9):1683–1691.  https://doi.org/10.1016/j.chemosphere.2007.03.060 Google Scholar
  99. Wang C, Zhang Q, Wang F, Liang W (2017) Toxicological effects of dimethomorph on soil enzymatic activity and soil earthworm (Eisenia fetida). Chemosphere 169:316–323.  https://doi.org/10.1016/j.chemosphere.2016.11.090 Google Scholar
  100. Weeks JM, Spurgeon DJ, Svendsen C, Hankard PK, Kammenga JE, Dallinger R, Köhler HR, Simonsen V, Scott-Fordsmand J (2004) Critical analysis of soil invertebrate biomarkers: a field case study in Avonmouth, UK. Ecotoxicology 13:817–822.  https://doi.org/10.1007/s10646-003-4479-z Google Scholar
  101. Wu S, Kuschk P, Brix H, Vymazal J, Dong R (2014a) Development of constructed wetlands inperformance intensifications for wastewater treatment: a nitrogen and organic matter targeted review. Water Res 57:40–45.  https://doi.org/10.1016/j.watres.2014.03.020 Google Scholar
  102. Wu X, Conkle JL, Ernst F, Gan J (2014b) Treated wastewater irrigation: uptake of pharmaceutical and personal care products by common vegetables under field conditions. Environ Sci Technol 48:11286–11,293.  https://doi.org/10.1021/es502868k Google Scholar
  103. Xu FJ, Li G, Jin CW, Liu WJ, Zhang SS, Zhang YS, Lin XY (2012) Aluminum-induced changes in reactive oxygen species accumulation, lipid peroxidation and antioxidant capacity in wheat root tips. Biol Plant 56:89–96.  https://doi.org/10.1007/s10535-012-0021-6 Google Scholar
  104. Xue Y, Gu X, Wang X, Sun C, Xu X, Sun J, Zhang B (2009) The hydroxyl radical generation and oxidative stress for the earthworm Eisenia fetida exposed to tetrabromobisphenol A. Ecotoxicology 18:693–699.  https://doi.org/10.1007/s10646-009-0333-2 Google Scholar
  105. Yang G, Chen C, Yu Y et al (2018) Ecotoxicology and environmental safety combined effects of four pesticides and heavy metal chromium ( VI ) on the earthworm using avoidance behavior as an endpoint. Ecotoxicol Environ Saf 157:191–200.  https://doi.org/10.1016/j.ecoenv.2018.03.067 Google Scholar
  106. Zayneb C, Lamia K, Olfa E, Naïma J, Grubb CD, Bassem K et al (2015) Morphological, physiological and biochemical impact of ink industry effluent on germination of maize (Zea mays), Barley (Hordeum vulgare) and Sorghum (Sorghum bicolor). Bul Environ Contam Tox 95(5):687–693.  https://doi.org/10.1007/s00128-015-1600-y Google Scholar
  107. Zhang Y, Sallach JB, Hodges L, Snow DD, Bartelt-Hunt SL, Eskridge KM, Li X (2016) Effects of soil texture and drought stress on the uptake of antibiotics and the internalization of Salmonella in lettuce following wastewater irrigation. Environ Pollut 208:523–531.  https://doi.org/10.1016/j.envpol.2015.10.025 Google Scholar
  108. Zoghlami RI, Hamdi H, Boudabbous K, Hechmi S (2018) Seasonal toxicity variation in light-textured soil amended with urban sewage sludge : interaction effect on cadmium , nickel , and phytotoxicity. 3608–3615Google Scholar

Copyright information

© Springer-Verlag GmbH Germany, part of Springer Nature 2018

Authors and Affiliations

  • Marouane Mkhinini
    • 1
  • Iteb Boughattas
    • 1
    Email author
  • Noureddine Bousserhine
    • 2
  • Mohammed Banni
    • 1
  1. 1.Laboratory of Biochemistry and Environmental ToxicologyHigher Institute of Agronomy Chott-MeriemChott-MeriemTunisia
  2. 2.Laboratory of Water Environment and Urban SystemsUniversity Paris-Est CréteilCréteil cedexFrance

Personalised recommendations