Advertisement

Molecular Biology Reports

, Volume 47, Issue 2, pp 1543–1550 | Cite as

Microsatellite characterisation and sex-typing in two invasive parakeet species, the monk parakeet Myiopsitta monachus and ring-necked parakeet Psittacula krameri

  • Francesca S. E. Dawson PellEmail author
  • Ben J. Hatchwell
  • Alba Ortega-Segalerva
  • Deborah A. Dawson
  • Gavin J. Horsburgh
  • Juan Carlos Senar
Open Access
Short Communication

Abstract

Invasive species can have wide-ranging negative impacts, and an understanding of the process and success of invasions can be vital to determine management strategies, mitigate impacts and predict range expansions of such species. Monk parakeets (Myiopsitta monachus) and ring-necked parakeets (Psittacula krameri) are both widespread invasive species, but there has been little research into the genetic and social structure of these two species despite the potential links with invasion success. The aim of this study was to isolate novel microsatellite loci from the monk parakeet and characterise them in both monk and ring-necked parakeets in order to facilitate future investigations into their behaviour and population ecology. Sex-typing markers were also tested in both species. Of the 20 microsatellite loci assessed in 24 unrelated monk parakeets, 16 successfully amplified and were polymorphic displaying between 2 and 14 alleles (mean = 8.06). Expected heterozygosity ranged from 0.43 to 0.93 and observed heterozygosity ranged from 0.23 to 0.96. Nine of the 20 loci also successfully amplified and were polymorphic in the ring-necked parakeet, displaying between 2 and 10 alleles. Suitable markers to sex both species and a Z-linked microsatellite locus were identified. A multiplex marker set was validated for monk parakeets. These novel microsatellite loci will facilitate fine and broad-scale population genetic analyses of these two widespread invasive species.

Keywords

Population genetics Microsatellite loci Sex markers Invasive species Aves Psittacidae 

Abbreviations

PCR

Polymerase chain reaction

PIC

Polymorphic information content

HO

Observed heterozygosity

HE

Expected heterozygosity

HWE

Hardy–Weinberg equilibrium

LD

Linkage disequilibrium

EMBL-EBI

European Molecular Biology Laboratory-European Bioinformatics Institute

FDR

False discovery rate

Introduction

Invasive species are nonindigenous species that establish self-sustaining populations beyond their native range [1, 2]. The negative impacts of invasive species can be wide-ranging and include: extensive economic and environmental damage [3, 4], threats to biodiversity [5, 6] and damage to human health [7, 8]. Two such invasive species are the monk parakeet (Myiopsitta monachus) and the ring-necked parakeet (Psittacula krameri).

As a popular pet species, tens of thousands of monk parakeets have been exported from their native South America to meet the demands of the international pet trade [9, 10, 11]. Subsequent breaches in captivity during transit or from holding areas, together with accidental or deliberate release by owners facilitated multiple invasion events across four additional continents (e.g. [9, 10]). In Europe, monk parakeets are now among the invasive bird species with the potential to cause the most acute economic impacts [3]. For example, substantial crop damage caused by foraging monk parakeets has been identified in the agricultural belt surrounding the city of Barcelona, Spain [12]; while in North America, their communal nests built on power lines and in electricity substations cause power outages and safety concerns [13].

Ring-necked parakeets, native to Asia and Africa [9], are the world’s most widespread invasive parrot species, with populations reported in at least 35 different countries [e.g. [14, 15]. Considered one of Europe’s worst invasive species [3], ring-necked parakeets have wide-ranging negative impacts throughout their invasive range including outcompeting native cavity nesters for suitable nest-sites (e.g. nuthatches Sitta europea; [16]), killing native species through direct aggressive encounters (e.g. greater noctule bat Nyctalus lasiopterus; [17]), and causing severe economic damage [3].

Assessing the genetic structure of populations of invasive species can be key in understanding their origin and invasion history [18], investigating dispersal patterns [19], and determining eradication or management strategies [20]. Microsatellites are molecular markers that are regularly used in such studies, and polymorphic markers have already been published for both monk parakeets (12 markers) [21] and ring-necked parakeets (21 markers) [22]. Here we present the characterisation of novel polymorphic monk parakeet microsatellite loci and their cross-species utility in the ring-necked parakeet. These new microsatellites, when used in combination with the microsatellite markers previously published for use in these species [21, 22], will improve investigations into social and population genetic structure at a range of spatial scales, and help to examine the processes related to the invasion success of both species.

Materials and methods

Sampling and DNA extraction

Monk parakeet blood samples were collected in Barcelona, Spain (permit code: EPI 7/2015 (01529/1498/2015)) in May–July 2016 and 2017. Blood samples (maximum 100 µl) were taken from either the brachial or jugular vein of each individual, stored in 98% ethanol and kept at − 20 °C before DNA extraction.

DNA was extracted overnight using an ammonium acetate extraction protocol [23, 24]. DNA quality was assessed by gel electrophoresis and its concentration quantified using a fluorimeter (FLUOstar Optima, BMG LABTECH Ltd., Aylesbury, UK). The library was constructed using genomic DNA extracted from a single female monk parakeet sampled in Barcelona, Spain. Genomic DNA was digested with MboI and enriched for dinucleotide (AG, AC) and tetranucleotide (CTAA, CTTT, GATA, GTAA) repeat motifs; magnetic beads were used in the enrichment hybridisation (modified from [25, 26]). An Illumina paired-end library was generated using 1 µg of this repeat-enriched DNA. The NEBNext DNA Library Prep Kit for Illumina (New England Biolabs Inc.) protocol was followed and the DNA was sequenced using a MiSeq Benchtop Sequencer (Illumina Inc., San Diego, CA, USA). A total of 162 sequences that contained at least five tandem repeats were extracted from the data (EMBL-EBI accession numbers LR700312-LR700620). Twenty of these were selected and used to design primer sets.

Primer design and microsatellite evaluation

Primer pairs were designed using Primer3 v. 0.4.0 [27, 28, 29] in microsatellite flanking regions with a product size range from 100 to 270 bp. Further specifications for selecting primer pairs were: a melting temperature of 59–61 °C (optimum 60 °C, difference 0.5 °C), a length of 18 to 36 base pairs (20 bp optimum) the presence of a G/C clamp, a maximum poly-X of 3 tandemly repeating nucleotides (e.g. TTT), and all other parameters set to default. Forward primers were 5′-labelled with a fluorescent dye (HEX or 6-FAM). BLAST software [30] was used to assess and select unique sequences for primer design.

DNA from 24 monk parakeets (12 male and 12 female) was amplified using polymerase chain reaction (PCR) to assess microsatellite variability. Monk parakeets are sexually monomorphic [9], therefore genetic sex-typing was used to determine the sex of individuals and to enable the identification of sex-linked microsatellite loci. Of nine bird sexing markers tested in monk parakeets, five were successful: P2-P8 [31], P2D-P8 [32], Z002B [33], Z43B [34] and 2550F-2718 [35]. Two of these sex markers were used in the present study (P2-P8 [31] and Z002B [33]) to avoid any potential errors in sexing caused by misidentification of the Z and W alleles due to Z/W-polymorphism or the presence of heteroduplexes [36, 37, 38]. PCR amplification was performed using a DNA Engine Tetrad ®Thermal Cycler (MJ Research, Bio-Rad, Herts, UK) in 2 µl reaction volumes containing 10–50 ng of air-dried DNA, 1 µl QIAGEN Multiplex PCR mix (containing PCR buffer, HotStarTaq DNA polymerase, 1.5 mM MgCl2 and 0.2 µm dNTPs; QIAGEN Inc.) and 0.2 µM of each primer. Initial denaturation stage was carried out at 95 °C for 15 min, followed by a PCR amplification of 35 cycles (94 °C for 30 s, 58 °C for 90 s and 72 °C for 60 s) and a final extension for 30 min at 60 °C. Sex-typing markers P2-P8 and Z002B were amplified using annealing temperatures 50 °C and 56 °C respectively. 1 µl of PCR product was diluted to a ratio of 1:2500–1:5000 (product:H2O) and these products were then separated on an ABI 3730 48-capillary DNA Analyser using formamide and GeneScan™-500 ROX size-standard (Applied Biosystems, Warrington, UK). Alleles were scored using GENEMAPPER v 5 software (Applied Biosystems, California, USA).

Data analysis

Allele numbers, polymorphic information content (PIC), estimated null allele frequencies, and observed (Ho) and expected heterozygosities (HE) were calculated using CERVUS v3.0.7 [39]. Linkage disequilibrium and any departures from Hardy–Weinberg equilibrium were calculated using GENEPOP web version 4.2 [40]. In order to correct for multiple testing, a false discovery rate control (FDR) [41] was applied to p-values obtained for linkage disequilibrium. ML-RELATE was used to estimate maximum-likelihood coefficients of relatedness for each dyad [42], confirming that the individuals used to characterise the microsatellite loci were unrelated (r < 0.19, mean ± SD = 0.02 ± 0.04).

Cross-species utility

Ring-necked parakeet blood samples were collected in November–March 2015–2017 in Barcelona, Spain (permit code: EPI 7/2015 (01529/1498/2015)). Blood samples (maximum 100 µl) were extracted from the jugular or brachial vein and stored at − 20 °C in 98% ethanol. An ammonium acetate extraction protocol was used for DNA extraction (see above for details), PCR amplification was conducted on DNA extracted from 18 ring-necked parakeets (11 females and 7 males; sexed using P2–P8 [31] and Z002B [33]), and microsatellite variability was then assessed as described for monk parakeets.

Results and discussion

Microsatellite characterisation

Of the 20 microsatellite loci tested, 17 successfully amplified and 16 were polymorphic in monk parakeets with allele numbers ranging from 2 to 14 with a mean of 8.06 alleles per locus (Table 1). HO and HE ranged from 0.23 to 0.96 and 0.43 to 0.93, respectively. PIC values ranged from 0.33 to 0.90 with 15 of the 16 microsatellite loci being highly informative (PIC > 0.50) and the other locus being reasonably informative (0.50 > PIC > 0.25; following [43]). One locus, MmonZ12, was heterozygous in some males (ZZ) yet homozygous in all 12 females (ZW) indicating it is sex-linked (Z-linked; Fisher’s exact test, p = 0.004). All 15 other polymorphic loci amplified in both males and females, with no loci being homozygous in all females and all loci displaying heterozygotes in both males and females, and were therefore presumed to be located on the autosomes. For the Z-linked locus (MmonZ12), deviation from Hardy–Weinberg equilibrium was assessed in males only. Four loci (Mmon03, Mmon08, Mmon10 and Mmon13) exhibited significant deviations from Hardy–Weinberg equilibrium (p < 0.05), which may suggest the presence of null alleles. However, only one locus (Mmon08) possessed a high estimated null allele frequency (> 10%). Alternatively, deviations from Hardy–Weinberg equilibrium may result from population structure [44]. Following FDR control, no significant linkage disequilibrium was found between loci. Multiplex Manager 1.2 [45] was used to generate a multiplex marker set from these 16 loci, optimised in three plexes; these multiplexes were then validated by genotyping the same 24 individual monk parakeets that had been genotyped in single-plex (Table 1).
Table 1

Characterisation of novel monk parakeet (Myiopsitta monachus) microsatellite loci (Psittacidae, Aves)

Locus,

Accession no.

Primer sequences (5’–3’ ); forward (F); reverse (R)

Repeat motif

Multiplex

Observed allele size range (bp)

n

No. of alleles

HO/HE

Est. null allele freq

PIC

Mmon01

LR700312

F: [HEX] CCCACATGCTATGGTCCAG

R: CTTCCAAGGATGAGGCAGAG

(TTAG)9

3

177–201

23

7

0.70/0.72

0.001

0.67

Mmon02

LR700313

F: [6-FAM] AATCTCTAAAGAGGTCCACACTGC

R: TGGATGTCTGAGGTGAACTCC

(AC)16

1

141–173

24

10

0.96/0.89

− 0.05

0.85

Mmon03

LR700314

F: [6-FAM] TTTGCAGTGACCTTCATTCTG

R: CTACAGCCAGCCTACTGTGC

(TG)18

1

227–268

24

11

0.71/0.86**

0.09

0.83

Mmon04

LR700315

F: [HEX] ATCCTGCCTGTGAACTCTGG

R: CCTCCCTCACCATTCCAAG

(GT)20

1

220–243

24

10

0.75/0.85

0.06

0.81

Mmon05

LR700316

F: [HEX] TCCTGTCAAGGTGATGCTTG

R: CTGTAGAAGATGGGAGGTTAGAGTG

(CTAT)18

1

166–202

24

11

0.67/0.80

0.09

0.76

Mmon06

LR700317

F: [HEX] GGGAATTCAGTGGAAAGAGG

R: CCCAAATCAGATTCTTGCTTC

(CA)17

2

191–219

24

10

0.83/0.84

− 0.002

0.80

Mmon07

LR700318

F: [6-FAM] TGGCAGTATGAAACATACACACAG

R: GGAAGCCACCAAGATTTCAG

(ATCT)16

2

197–229

24

14

0.88/0.93

0.02

0.90

Mmon08

LR700319

F: [6-FAM] AAACCCAATGGCAGTGTTTC

R: ACCATGGAGCTGAGGAACAG

(TGGA)7

3

240–250

22

4

0.23/0.61**

0.44***

0.54

Mmon09

LR700320

F: [HEX] ATCCACAATCGTCAGATGGAG

R: AAATGGGAAGTGAACCCAGAG

(AC)13

3

136–148

24

6

0.71/0.70

− 0.01

0.64

Mmon10

LR700321

F: [6-FAM] TCAGTCAAGATGTTCCCTTGG

R: GAGACAACAGCTCATCTTCCTCTAC

(TG)14

3

90–101

24

7

0.75/0.81**

0.03

0.77

Mmon11

LR700322

F: [6-FAM] TGCAGTAATGATTTGATGCATTG

R: ACAAGCACACCTCGCAAAC

(TATC)11

3

153–173

24

6

0.71/0.72

0.01

0.67

MmonZ12

LR700323

F: [6-FAM] GCTTTCTCTGTGAAATCCATCC

R: AACATCATCTTAAGAACCATCCAAG

(ATCT)6

1

103–107

12M

2

0.58/0.43

− 0.17

0.33

   

1

103–107

12F

2

0/0

NA

NA

Mmon13

LR700324

F: [6-FAM] CAGTATACCTATGGTTAAGGTTTCAGC

R: CCTTGATTCAGATGGTAATTAGAGAAG

(TCTA)14

3

122–144

24

6

0.88/0.79**

− 0.07

0.74

Mmon14

LR700325

F: [HEX] CTTTCTAACTCATTCCTAAGTGAGAGC

R: GACTCTGTCTGACTCCTATTGCTG

(GT)16

1

142–164

24

9

0.83/0.82

− 0.02

0.77

Mmon15

LR700326

F: [HEX] TTAAACAACAGTATTTGTGAGACCAAG

R: TCCTTTCCAACCCTAACTATTCTG

(AGAT)14

2

130–176

24

11

0.83/0.88

0.02

0.85

Mmon16

LR700327

F: [6-FAM] CAAACAGTCTTCCCTTTGTGG

R: AAACACAGGCCCATCTGC

(AC)12

2

141–167

24

5

0.67/0.65

− 0.03

0.57

Mmon17*

LR700328

F: [HEX] AGGTCCTTTACAGCCCTAACTG

R: GTTGAACTTCCCAGCTTTCC

(TG)26

NA

254

22

1

NA

NA

NA

EMBL-EBI sequence accession numbers LR700312-LR700328, number of individuals results are based on (n), observed and expected heterozygosities (HO and HE respectively)

**Loci with significant departures from Hardy–Weinberg equilibrium; estimated null allele frequency (Est. null allele freq.)

***Mmon08 possessed high estimated null allele frequency (> 10%), not applicable (NA); polymorphic information content (PIC)

Mmon17* was monomorphic in monk parakeets and not included in the multiplex set

Cross-species utility

Nine of the 20 microsatellite loci also amplified and were polymorphic in the ring-necked parakeet (Table 2). One of the nine loci polymorphic in ring-necked parakeets (Mmon17, Table 2) was monomorphic in monk parakeets and therefore was not included in the multiplex set for monk parakeets (Table 1). Allele numbers in ring-necked parakeets ranged from 2 to 10 (mean 5.22), HO and HE ranged from 0.12 to 0.89 and 0.11 to 0.89, respectively, and PIC values ranged from 0.11 to 0.85 (Table 2), with five loci being highly informative (PIC > 0.50), and one locus being reasonably informative (0.50 > PIC > 0.25; [43]). MmonZ12 was also sex-linked in ring-necked parakeets (Fisher’s exact test; p < 0.001), as in monk parakeets, but was more variable in ring-necked parakeets displaying a total of 10 different alleles in 18 individuals (Table 2). Z chromosome polymorphism was observed for both sex markers (P2-P8 and Z002B) in two out of 18 ring-necked parakeets (allele sizes: P2-P8 Z alleles 369 and 375 bp, W allele 403 bp; Z002B Z alleles 250 and 252 bp, W allele 234 bp) and was accounted for when assigning sex. Four loci (Mmon01, Mmon05, Mmon15 and MmonZ12) deviated significantly from Hardy–Weinberg equilibrium (p < 0.05) and two loci (Mmon03 and Mmon15) possessed a high estimated null allele frequency (> 10%) in ring-necked parakeets. Linkage disequilibrium was significant between three pairs of alleles (p < 0.05; Mmon03 and Mmon04, Mmon04 and Mmon15, Mmon05 and Mmon15). However, this may be due to the presence of relatives in the sample of ring-necked parakeets used to characterise these microsatellite loci. ML-Relate [42] indicated the presence of possible half-sibling (19/153) and full-sibling relationships (6/153) and one potential parent–offspring relationship among the 18 ring-necked parakeets sampled.
Table 2

Cross-species utility of monk parakeet (Myiopsitta monachus) microsatellite loci in the ring-necked parakeet (Psittacula krameri)

Locus

n

No. of alleles

Observed allele size range (bp)

HO/HE

Est. null allele freq.

PIC

Mmon01

17

6

165–193

0.71/0.78**

0.003

0.72

Mmon03

18

2

216–218

0.22/0.29

0.11***

0.24

Mmon04

18

3

204–207

0.39/0.48

0.07

0.41

Mmon05

18

10

127–176

0.83/0.89**

0.02

0.85

Mmon07

18

8

189–217

0.89/0.84

− 0.04

0.79

Mmon09

17

3

142–148

0.18/0.17

− 0.04

0.16

MmonZ12

7 M

7*

201–245

1.00/0.88**

0

0.79

 

11F

8*

205–245

0/0

NA

NA

Mmon15

17

6

138–155

0.35/0.80**

0.38***

0.74

Mmon17

17

2

218–226

0.12/0.11

− 0.02

0.11

Tested in 18 ring-necked parakeets; number of individuals results are based on (n)

*A total of ten different alleles were observed for MmonZ12, observed and expected heterozygosities (HO and HE respectively)

**Loci with significant departures from Hardy–Weinberg equilibrium; estimated null allele frequency (Est. null allele freq.)

***Mmon03 and Mmon15 possessed high null allele frequencies (> 10%), not applicable (NA); polymorphic information content (PIC)

Limitations

DNA samples from monk parakeets and ring-necked parakeets used to characterise these microsatellite loci were taken from invasive populations for which there is no detailed knowledge of introduction events. Therefore, it is possible that these individuals are descendants from small founding populations which may have had limited genetic variation. On the other hand, both species have very extensive native ranges across South America (monk parakeet) and Africa and Asia (ring-necked parakeet) [9] and if founders were drawn from across these ranges, genetic variation of invasive populations may be greater than in local populations within their native range.

Conclusions

These novel microsatellite loci, optimised in three multiplexes, provide a powerful tool for analyses of both fine and broad-scale population genetic structure, as well as for analyses of parentage and dyadic relatedness. Combining these markers with those previously published for use in both monk parakeets [21] and ring-necked parakeets [22] will facilitate detailed investigations into behavioural and population processes related to invasion success in these two widespread avian invaders. Such studies are likely to be particularly interesting in the case of monk parakeets given that they are highly social parrots, with unique compound nests made of sticks that may house many breeding pairs, often built in close proximity to other nests to form loose colonies [9, 46]. Furthermore, examination of population genetic structure at a range of spatial scales may aid in the design of effective management strategies, help to understand the history of invasive populations and to predict future range expansions in these species.

Notes

Acknowledgements

MiSeq sequencing was performed by Dr Rebecca Thomas at the Sheffield Diagnostics Genetics Service at The Children’s Hospital Sheffield supported by the Sheffield Children’s NHS Trust, UK. Dr Natalie dos Remedios provided training in the lab techniques.

Author contributions

BJH, JCS and FSEDP designed the study. JCS supervised the field study and JCS and AOS collected the blood samples. BJH and JCS supervised the project. FSEDP and GJH conducted laboratory work at the NERC Biomolecular Analysis Facility, Sheffield, UK. FSEDP and DAD analysed the data. FSEDP wrote the paper with input from co-authors. All authors read and approved the final manuscript.

Funding

The study was funded by a UK Natural Environment Research Council (NERC) Biomolecular Analysis Facility (NBAF) grant (NBAF1078) to BJH, JCS and Daniel Franks (University of York) for laboratory work conducted at the University of Sheffield, UK, and by a NERC studentship to FSEDP through the ACCE Doctoral Training Partnership at the University of Sheffield, UK. Sample collection was funded by a grant (CGL-2016-79568-C3-3-P) to JCS from the Spanish Research council (Ministry of Economics and Enterprise).

Compliance with ethical standards

Conflict of interest

The authors declare they have no conflict of interest.

Ethical approval

Birds were handled and blood samples taken with special permission EPI 7/2015 (01529/1498/2015) from Direcció General del Medi Natural i Biodiversitat, Generalitat de Catalunya, following Catalan regional ethical guidelines for the handling of birds. JCS received special authorization (001501-0402.2009) for the handling of animals in research from Servei de Protecció de la Fauna, Flora i Animal de Companyia, according to Decree 214/1997/30.07, Generalitat de Catalunya.

Informed consent

All authors consent to publication.

References

  1. 1.
    Kolar CS, Lodge DM (2001) Progress in invasion biology: predicting invaders. Trends Ecol Evol 16:199–204PubMedGoogle Scholar
  2. 2.
    Duncan RP, Blackburn TM, Sol D (2003) The ecology of bird introductions. Annu Rev Ecol Evol Syst 34:71–98Google Scholar
  3. 3.
    Kumschick S, Nentwig W (2010) Some alien birds have as severe an impact as the most effectual alien mammals in Europe. Biol Conserv 143:2757–2762Google Scholar
  4. 4.
    Pimentel D (2002) Biological invasions: economic and environmental costs of alien plant, animal, and microbe species. CRC Press, FloridaGoogle Scholar
  5. 5.
    Bax N, Williamson A, Aguero M, Gonzalez E, Geeves W (2003) Marine invasive alien species: a threat to global biodiversity. Mar Policy 27:313–323Google Scholar
  6. 6.
    Clavero M, Garcia-Berthou E (2005) Invasive species are a leading cause of animal extinctions. Trends Ecol Evol 20:110PubMedGoogle Scholar
  7. 7.
    Juliano SA, Lounibos LP (2005) Ecology of invasive mosquitoes: effects on resident species and on human health. Ecol Lett 8:558–574PubMedPubMedCentralGoogle Scholar
  8. 8.
    Pyšek P, Richardson DM (2010) Invasive species, environmental change and management, and health. Annu Rev Environ Resour 35:25–55Google Scholar
  9. 9.
    Forshaw JM (1989) Parrots of the world, 3rd edn. David and Charles, LondonGoogle Scholar
  10. 10.
    Russello MA, Avery ML, Wright TF (2008) Genetic evidence links invasive monk parakeet populations in the United States to the international pet trade. BMC Evol Biol 8:217PubMedPubMedCentralGoogle Scholar
  11. 11.
    CITES: Trade Database. Myiopsitta monachus. https://trade.cites.org. Accessed 30 Jul 2019
  12. 12.
    Senar JC, Domènech J, Arroyo L, Torre I, Gordo O (2016) An evaluation of monk parakeet damage to crops in the metropolitan area of Barcelona. Anim Biodivers Conserv 39:141–145Google Scholar
  13. 13.
    Newman JR, Newman CM, Lindsay JR, Merchant B, Avery ML, Pruett-Jones S (2008) Monk parakeets: an expanding problem on power lines and other electrical utility structures. In: Environment concerns rights-of-way management 8th international symposium, pp 355-363Google Scholar
  14. 14.
    Butler CJ (2003) Population Biology of the Introduced Rose-ringed Parakeet Psittacula krameri in the UK. PhD Thesis, Department of Zoology Edward Grey Institute of Field Ornithology, Oxford, UKGoogle Scholar
  15. 15.
    Lever C (2005) Naturalised birds of the world. T & A.D. Poyser, LondonGoogle Scholar
  16. 16.
    Strubbe D, Matthysen E (2009) Experimental evidence for nest-site competition between invasive ring-necked parakeets (Psittacula krameri) and native nuthatches (Sitta europaea). Biol Conserv 142:1588–1594Google Scholar
  17. 17.
    Hernández-Brito D, Carrete M, Ibáñez C, Juste J, Tella JL (2018) Nest-site competition and killing by invasive parakeets cause the decline of a threatened bat population. R Soc Open Sci 5:172477PubMedPubMedCentralGoogle Scholar
  18. 18.
    Prentis PJ, Sigg DP, Raghu S, Dhileepan K, Pavasovic A, Lowe AJ (2009) Understanding invasion history: genetic structure and diversity of two globally invasive plants and implications for their management. Divers Distrib 15:822–830Google Scholar
  19. 19.
    LaRue EA, Ruetz CR, Stacey MB, Thum RA (2011) Population genetic structure of the round goby in Lake Michigan: implications for dispersal of invasive species. Hydrobiologia 663:71–82Google Scholar
  20. 20.
    Abdelkrim J, Pascal M, Calmet C, Samadi S (2005) Importance of assessing population genetic structure before eradication of invasive species: examples from insular Norway rat populations. Conserv Biol 19:1509–1518Google Scholar
  21. 21.
    Russello MA, Saranathan V, Buhrman-Deever S, Eberhard J, Caccone A (2007) Characterization of polymorphic microsatellite loci for the invasive monk parakeet (Myiopsitta monachus). Mol Ecol Notes 7:990–992Google Scholar
  22. 22.
    Raisin C, Dawson DA, Greenwood AG, Jones CG, Groombridge JJ (2009) Characterization of Mauritius parakeet (Psittacula eques) microsatellite loci and their cross-utility in other parrots (Psittacidae, Aves). Mol Ecol Resour 9:1231–1235PubMedGoogle Scholar
  23. 23.
    Nicholls JA, Double MC, Rowell DM, Magrath RD (2000) The evolution of cooperative and pair breeding in thornbills Acanthiza (Pardalotidae). J Avian Biol 31:165–176Google Scholar
  24. 24.
    Richardson DS, Jury FL, Blaakmeer K, Komdeur J, Burke T (2001) Parentage assignment and extra-group paternity in a cooperative breeder: the Seychelles warbler (Acrocephalus sechellensis). Mol Ecol 10:2263–2273PubMedGoogle Scholar
  25. 25.
    Armour JAL, Neumann R, Gobert S, Jeffreys AJ (1994) Isolation of human simple repeat loci by hybridization selection. Hum Mol Genet 3:599–605PubMedGoogle Scholar
  26. 26.
    Glenn TC, Schable NA (2005) Isolating microsatellite DNA loci. In: Zimmer EA, Roalson EH (eds) Methods in enzymology, vol 395. Academic Press, San Diego, pp 202–222Google Scholar
  27. 27.
    Rozen S, Skaletsky H (2000) Primer3 on the WWW for general users and for biologist programmers. In: Misener S, Krawetz SA (eds) Bioinformatics methods and protocols. Humana Press, Totowa, pp 365–386Google Scholar
  28. 28.
    Koressaar T, Remm M (2007) Enhancements and modifications of primer design program Primer3. Bioinformatics 23:1289–1291PubMedPubMedCentralGoogle Scholar
  29. 29.
    Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M, Rozen SG (2012) Primer3-new capabilities and interfaces. Nucleic Acids Res 40:e115PubMedPubMedCentralGoogle Scholar
  30. 30.
    Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25:3389–3402PubMedPubMedCentralGoogle Scholar
  31. 31.
    Griffiths R, Double MC, Orr K, Dawson RJG (1998) A DNA test to sex most birds. Mol Ecol 7:1071–1075PubMedGoogle Scholar
  32. 32.
    Dawson DA, Horsburgh GJ, Krupa AP, Stewart IRK, Skjelseth S, Jensen H, Ball AD, Spurgin LG, Mannarelli M-E, Nakagawa S, Schroeder S, Vangestel C, Hinten GN, Burke T (2012) Microsatellite resources for Passeridae species: a predicted microsatellite map of the house sparrow Passer domesticus. Mol Ecol Resour 12:501–523PubMedGoogle Scholar
  33. 33.
    Dawson DA (2007) Genomic analysis of passerine birds using conserved microsatellite loci. PhD Thesis, University of Sheffield, UKGoogle Scholar
  34. 34.
    Dawson DA, dos Remedios N, Horsburgh GJ (2016) A new marker based on the avian spindlin gene that is able to sex most birds, including species problematic to sex with CHD markers. Zoo Biol 35:533–545PubMedGoogle Scholar
  35. 35.
    Fridolfsson AK, Ellegren H (1999) A simple and universal method for molecular sexing of non-ratite birds. J Avian Biol 30:116–121Google Scholar
  36. 36.
    Dawson DA, Darby S, Hunter FM, Krupa AP, Jones IL, Burke T (2001) A critique of avian CHD-based molecular sexing protocols illustrated by a Z-chromosome polymorphism detected in auklets. Mol Ecol Notes 1:201–204Google Scholar
  37. 37.
    Robertson BC, Gemmell NJ (2006) PCR-based sexing in conservation biology: wrong answers from an accurate methodology? Conserv Genet 7:267–271Google Scholar
  38. 38.
    Casey AE, Jones KL, Sandercock BK, Wisely SM (2009) Heteroduplex molecules cause sexing errors in a standard molecular protocol for avian sexing. Mol Ecol Resour 9:61–65PubMedGoogle Scholar
  39. 39.
    Kalinowski ST, Taper ML, Marshall TC (2007) Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Mol Ecol 16:1099–110640PubMedGoogle Scholar
  40. 40.
    Rousset F (2008) GENEPOP’007: a complete re-implementation of the GENEPOP software for Windows and Linux. Mol Ecol Resour 8:103–106PubMedPubMedCentralGoogle Scholar
  41. 41.
    Verhoeven KJ, Simonsen KL, McIntyre LM (2005) Implementing false discovery rate control: increasing your power. Oikos 108:643–647Google Scholar
  42. 42.
    Kalinowski ST, Wagner AP, Taper ML (2006) ML-relate: a computer program for maximum likelihood estimation of relatedness and relationship. Mol Ecol Notes 6:576–579Google Scholar
  43. 43.
    Botstein D, White RL, Skolnick M, Davis RW (1980) Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am J Hum Genet 32:314–331PubMedPubMedCentralGoogle Scholar
  44. 44.
    Waples RS (2014) Testing for Hardy–Weinberg proportions: have we lost the plot? J Hered 106:1–19PubMedGoogle Scholar
  45. 45.
    Holleley CE, Geerts PG (2009) Multiplex Manager 1.0: a cross-platform computer program that plans and optimizes multiplex PCR. Biotechniques 46:511–517Google Scholar
  46. 46.
    Bucher EH, Martin LF, Martella MB, Navarro JL (1990) Social behaviour and population dynamics of the Monk Parakeet. Proc Int Ornithol Congr 20:681–689Google Scholar

Copyright information

© The Author(s) 2019

Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Authors and Affiliations

  1. 1.Department of Animal and Plant SciencesUniversity of SheffieldSheffieldUK
  2. 2.Museu de Ciències Naturals de BarcelonaBarcelonaSpain

Personalised recommendations