Molecular Breeding

, Volume 28, Issue 2, pp 241–254 | Cite as

Mining and validating grape (Vitis L.) ESTs to develop EST-SSR markers for genotyping and mapping

  • Hong Huang
  • Jiang Lu
  • Zhongbo Ren
  • Wayne Hunter
  • Scot E. Dowd
  • Phat Dang
Open Access
Article

Abstract

Grape expressed sequence tags (ESTs) are a new resource for developing simple sequence repeat (SSR) functional markers for genotyping and genetic mapping. An integrated pipeline including several computational tools for SSR identification and functional annotation was developed to identify 6,447 EST-SSR sequences from a total collection of 215,609 grape ESTs retrieved from NCBI. The 6,447 EST-SSRs were further reduced to 1,701 non-redundant sequences via clustering analysis, and 1,037 of them were successfully designed with primer pairs flanking the SSR motifs. From them, 150 pairs of primers were randomly selected for PCR amplification, polymorphism and heterozygosity analysis in V. vinifera cvs. Riesling and Cabernet Sauvignon, and V. rotundifolia (muscadine grape) cvs. Summit and Noble, and 145 pairs of these primers yielded PCR products. Pairwise comparisons of loci between the parents Riesling and Cabernet Sauvignon showed that 72 were homozygous in both cultivars, while 70 loci were heterozygous in at least one cultivar of the two. Muscadine parents Noble and Summit had 90 homozygous SSR loci in both parents and contained 50 heterozygous loci in at least one of the two. These EST-SSR functional markers are a useful addition for grape genotyping and genome mapping.

Keywords

SSR EST Marker Genotyping Grape 

Introduction

Microsatellites, or simple sequence repeats (SSRs), are short (1–6 bp) repeat DNA motifs that are usually single locus markers with characteristics of hypervariability, abundance and reproducibility. The variation of the SSR repeat units can be easily differentiated by PCR products amplified with primers flanking the SSR motif. SSRs have been widely used for bacteria screening (Lin et al.2005), plant genotyping (Chen et al. 2006), linkage mapping (Zhang et al.2002), gene tagging (Roy et al. 2002), and map-based gene cloning (Tekeoglu et al.2002).

The availability of ESTs greatly accelerates the systematic identification of SSRs and corresponding marker development based on computer analytical approaches (Varshney et al.2002; Gao et al.2003; Thiel et al.2003; Chen et al.2006). EST-derived SSRs have been well documented in some plant species including Arabidopsis (Depeiges et al.1995), sugarcane (Cordeiro et al.2001), cereal species (Kantety et al.2002), cacao (Lima et al. 2008), and rubber tree (Feng et al.2009). Using homology searches, putative functions can be deduced for the SSRs and thereby provide a new resource that can further aid in genetic and evolutionary studies (Cho et al.2000; De Keyser et al.2009).

EST-SSR and genomic SSR markers should be considered as complementary to plant genome mapping, with EST-SSR being less polymorphic but concentrated in the gene-rich regions (Varshney et al. 2006). With hundreds of thousands of ESTs available in the public domain, the process of developing EST-SSR markers has been greatly accelerated by using optimized computational pipelines and high-throughput genotyping techniques.

SSR markers have been widely used in grape genotyping. The high polymorphism of Vitis-derived microsatellite loci has been reported extensively in the literature and used for fingerprinting (Thomas and Scott 1993; Bowers et al.1996, 1999a, b; Sefc et al.1998; Arroyo García et al. 2002; Di Gaspero et al.2005, 2007; Merdinoglu et al.2005; Lamoureux et al.2006; Costantini et al.2007; De Mattia et al.2007; Cipriani et al.2008; Bocharova et al.2009; Riaz et al.2009). Several publications have also demonstrated transferability of SSR markers across the Vitis genus (Lin and Walker 1998; Tessier et al.1999; Di Gaspero et al. 2000; Fernández et al.2008).

SSR markers have been used for construction of grape genetic maps (Dalbò et al.2000; Doligez et al. 2002; Grando et al.2003; Adam-Blondon et al.2004; Doucleff et al.2004; Riaz et al.2004, 2006; Lowe and Walker 2006; Di Gaspero et al.2007; Vezzulli et al.2008). While the majority of the loci in grape linkage maps are microsatellite markers developed from genomic DNA libraries, the availability of EST-SSRs will serve as new genetic markers to be included into the linkage map (Decroocq et al.2003; Akkak et al. 2006; Salmaso et al.2008). EST-SSRs have been reported to be less polymorphic but to have higher transferability than genomic SSRs in grape and other plants because of greater DNA sequence conservation in transcribed regions (Scott et al.2000; Cho et al.2000; Chabane et al.2005).

Traditionally, SSR PCR products are separated by polyacrylamide gels (Thiel et al.2003) or Metaphor Agarose gels (Chani et al.2002). The electrophoresis-based technology is low-throughput and comes with imprecise sizing at times. Automatic capillary sequencing using fluorescently-labeled primers (Eujayl et al. 2002) provides more accurate and high-throughput genotyping results but the cost of dye-labeling each forward primer is high. Using M13 universal labeled primers with automatic capillary sequencing can not only reduce the cost but also provide fast and precise genotyping results (Oetting et al. 1995, Chen et al. 2006).

Here we report the identification and characterization of 1,701 unique grape EST-SSRs derived from a total of 215,609 grape ESTs. A set of SSR markers was developed from this analysis and validated by using M13 universal primers and an automatic capillary sequencing system.

Materials and methods

Plant materials

For PCR amplification, genotyping and polymorphism analysis, we selected four genotypes which are parents of two mapping populations: V. vinifera cvs. Cabernet Sauvignon and Riesling, and V. rotundifolia cvs. Noble and Summit. Genomic DNA was extracted from young leaves/shoot tips of these grape cultivars using a modified CTAB protocol (Qu et al.1996).

Grape EST and genomic sequences retrieval from NCBI

All grape EST sequences available in the NCBI database on 10 February 2006 were retrieved. Among the total of 215,609 ESTs, 194,200 were from V. vinifera, 10,704 were V. shuttleworthii, 2,177 were V. aestivalis, 1,995 were V. riparia, and 6,533 were V. hybrids (V. rupestris A. de Serres × V. spp. b42-26).

A total of 31,910 genomics sequences were also retrieved from NCBI on 12 June 06. Among them, 30,832 were from a BAC library of V. vinifera cv. Pinot Noir, and 1,078 from V. vinifera cvs. Syrah and Maxxa.

Computer programs for mining SSRs from ESTs

A Perl script program named Microsatellite (MISA) developed by Thiel et al. (2003, http://pgrc.ipk-gatersleben.de/misa) was used to identify EST-SSRs. The SSRs are between 2 and 6 nucleotides in size. The minimal length of SSR repeats was defined as 2 × 9 = 18 bp for dinucleotides, 3 × 6 = 18 bp for trinucleotides, 4 × 5 = 20 bp for tetranucleotides, 5 × 4 = 20 bp for pentanucleotides, and 6 × 4 = 24 bp for hexanucleotides. ESTs containing SSRs were assembled in Sequencher® version 4.2 (Genecodes, Ann Arbor, Michigan, USA) under criteria of 40% minimum overlap and 90% minimum match percentage. A flow chart for mining and developing the grape EST-SSR markers is provided in Fig. 1.
Fig. 1

Flow chart of Vitis EST-SSR identification and validation

Functional annotation of EST-SSRs

HTGOFAT, a data mining and annotation tool kit developed in Microsoft NET 2003, was utilized to functionally annotate the assembled EST-SSRs sequences (Dowd and Zaragoza 2005). The putative functional genes were classified using the Munich Information Centre for Protein Sequences (MIPS) Arabidopsis thaliana functional catalogue (MATDB, http://mips.gsf.de).

PCR and fragment analysis

EST sequences flanking the microsatellite motifs were used to design PCR primers using the program Primer3®. A total of 150 primer pairs (Table 3) were screened for assessment of polymorphisms among the four parents using a CEQ Genetic Analyzer (Beckman Coulter, California, USA).

To save cost, a 20-bp long universal M13 forward primer sequence GTT GTAAAA CGA CGG CCA GT (Oetting et al. 1995) was added as a common tail to the 5′ end of all 180 SSR forward primers. All SSR primers, including regular and M13-tailed forward primers, were synthesized by Operon Technologies (Huntsville, Alabama, USA). The universal M13 primers were labeled by Sigma-Genosys (USA) and used for CEQ Genetic Analyzer Fragment Analysis.

PCR reactions were performed in a 20-μl reaction mix including 30 ng of genomic DNA, 10 × PCR buffer (Promega), 2 μl of 2 mM dNTP (Promega), 1.0 U Taq DNA polymerase, 2.8 μl of 25 mM MgCl2 (Promega), and 0.3 μM primers. The PCR reactions were carried out in a PTC-200 thermal cycler (MJ Research) with the following thermal profile: 3 min at 94°C followed by 30 cycles of 1 min denaturation at 94°C, 1 min annealing at 48 to 58°C (based on the Tm of the different primer sets), and 2 min extension at 72°C, followed by a final step of 6 min extension at 72°C. The same conditions were also used for labeling the primers.

For fragment analysis using the CEQ Genetic Analyzer, 0.25 μl of each M13 labeled PCR product was mixed with 40 μl Sample Loading Solution (Beckman Coulter 608087) with 0.2 μl 400-bp DNA size standard (Beckman Coulter 608098) and overlaid with one drop of light mineral oil, then loaded into the 96-well sample microtiter plates (Beckman Coulter 609801). CEQ Sequencing Separation Buffer (Beckman Coulter 608012) were also loaded into the 96-well separation plate (Beckman Coulter 609844). Dye-labeled amplicons were automatically sized by running on “Frag-3” separation and the GenomeLab software (Beckman Coulter) and then visually examined.

Results and discussion

Identification and characterization of grape EST-SSRs

A total of 6,447 out of 215,609 (3%) grape ESTs retrieved from NCBI on 1 February 2006 contained SSRs (Table 1). With some of them having multiple SSR sites, a total of 6,815 SSR motifs were identified among these 6,447 EST sequences. The percentage of EST-SSRs varied slightly among different Vitis species, ranging from 2.98% for V. vinifera (5,782 of 194,200), 3.50% for V. aestivalis (74 of 2,116), 3.55% for V. shuttleworthii (389 of 10,933), to 5.43% for V. riparia (59 out of 1,087). The EST-SSRs accounted for 2.71% for a Vitis hybrid of (V. rupestris A. de Serres × V. spp. b42-26) (177 of 6,533; Electronic Supplementary Material 1).
Table 1

Characterization of grape redundant and non-redundant EST and genomic SSRs

 

Redundant SSR-ESTs

Non-redundant SSR-ESTs

Genomic SSR sequences

Total %

6,447

1,701

1,346

 Di-

1,835(28.5%)

664(39.0%)

699(51.9%)

 Tri-

3,235(50.2%)

710(41.7%)

341(25.3%)

 Tetra-

391(6.1%)

125(7.3%)

154(25.2%)

 Penta-

618(9.6%)

134(7.9%)

99 (7.4%)

 Hexa-

736(11.4%)

179(10.5%)

53 (3.9%)

Abundant type

 Di-

AG/CT(18.9%)

AG/CT(26.9%)

AT/AT (33.0%)

 Tri-

AGG/CCT(14.8%)

AAG/CTT (11.3%)

AAT/ATT (18.6%)

 Tetra-

AAGG/CCTT(1,7%)

AAAT/ATTT(2.4%)

AAAT/ATTT(7.0%)

 Penta-

AAAAT/ATTTT(2.8%)

AAAAT/ATTTT(2.1%)

AAAAT/ATTTT(3.8%)

 Hexa-

AGGGTC/AGTCCC(2.6%)

ACCCTG/ACTGGG(1.1%)

AAAAAT/TAAAAA(1.7%)

Among the redundant EST-derived SSR repeats, tri-nucleotide, which accounted for 50.2% of total SSRs, was the most abundant repeat unit followed by di (28.5%), hexa (11.4%), penta (9.6%), and tetranucleotide (6.1%; Table 1). These findings are in agreement with previous observations on abundance of SSR repeat units in barley, maize, rice, sorghum, and wheat (Kantety et al. 2002). The dominance of trinucleotide SSRs was viewed as the result of a frame shift in size of one amino acid read, or three nucleotides, a selection against possible frame shift mutations (Metzgar et al.2000; Toth et al.2000; Wren et al. 2000; Cordeiro et al.2001). For the same reason, a higher percentage was also observed in hexanucleotide SSRs than tetra- and penta-repeats. In both non-redundant and redundant EST-SSRs (Table 1), di- and tri-repeats were accounted for about 80% of the total EST-SSRs for each group (redundant: di-28.5%, tri-50.2%; non-redundant: di-39%, tri-41.7%). Interestingly, the proportion of tri repeats dropped from 50.2% in redundant to 41.7% in non-redundant ESTs while di repeats increased from 28.5 to 39.0% after eliminating the redundancy by contig assembling (Table 1). The result was interpreted to suggest that tri-repeat SSRs were mainly found in coding regions (Yu et al.2004) and many of these redundant EST-SSRs were eliminated because these sequences contain tri-repeats representing putative amino acid runs (Li et al. 2004) as overexpressed ESTs representing the same set of genes. Another explanation is the effect of gene duplication and paralogy. Depending on the parameters used for clustering, untranslated regions of paralogous genes, which are more divergent and contain all types of SSR, might have remained separated, while ESTs covering exons of paralogous genes, which are more conserved and highly enriched in tri-nucleotide SSR, might have collapsed more frequently into a “single” redundant EST.

Comparison between genomic and EST derived SSRs

Unlike the tri-nucleotide repeats as the dominant type in SSR-ESTs, the number of genome sequence-derived SSRs were dominated by di-nucleotide repeats that accounted for 51.9% of total genomic SSRs, followed by tri- (25.3%), tetra- (25.2%), penta- (7.4%), and hexa-SSRs (3.9%; Table 1). Similar patterns for EST-SSRs having a higher proportion in tri-repeats than genomic SSRs were reported in the literacture (Cardle et al.2000). Among the top 20 SSRs in ranking, the most abundant di-nucleotide repeat in non-redundant ESTs was AG/CT which accounted for 17.9% of total EST-SSRs, followed by AT/AT (8.4%; Table 2), while the most abundant di-nucleotide repeat in genomic sequences was AT/AT which accounted for 33.0%, followed by AG/CT (15.5%) and AC/GT (3.5%). The most common EST-derived tri-nucleotide repeat was AAG/CTT (14.0%), while AAT/ATT (18.6%) was the most abundant tri-nucleotide SSRs derived from genomic sequences. Among grape genomic sequences, around 67.1% of the SSRs belonged to three types of repeats: AT/AT (33.0%), AAT/ATT (18.6%), and AG/CT (15.5%; Tables 2 and 3).
Table 2

Top 20 SSR motifs in grape ESTs and genomic sequences

EST-SSR repeats

Total

%

Genomic SSR repeats

Total

%

AG/CT

1,217

17.9

AT/AT

444

33.0

AGG/CCT

957

14.0

AAT/ATT

251

18.6

AT/AT

575

8.4

AG/CT

208

15.5

AAG/CTT

547

8.0

AAAT/ATTT

94

7.0

AAT/ATT

403

5.9

AAAAT/ATTTT

51

3.8

ACC/GGT

326

4.8

AAG/CTT

48

3.6

AGC/CGT

237

3.5

AC/GT

47

3.5

ACG/CTG

201

2.9

AAAAAT/ATTTTT

21

1.6

AGT/ATC

201

2.9

AAAAG/CTTTT

17

1.3

AAAAT/ATTTT

195

2.9

AAAAAG/CTTTTT

15

1.1

ACT/ATG

168

2.5

AATT/AATT

14

1.0

AAC/GTT

163

2.4

AAAG/CTTT

13

1.0

AGGGTC/AGTCCC

144

2.1

AGT/ATC

12

0.9

AAAAG/CTTTT

98

1.4

ACAT/ATGT

10

0.7

AAAAC/GTTTT

97

1.4

ACT/ATG

9

0.7

AAAT/ATTT

89

1.3

AGAT/ATCT

8

0.6

AAGG/CCTT

88

1.3

AAC/GTT

7

0.5

AAAGG/CCTTT

88

1.3

AAAAC/GTTTT

6

0.4

ACCCTG/ACTGGG

81

1.2

AAATT/AATTT

6

0.4

AAAAAG/CTTTTT

78

1.1

AGG/CCT

5

0.4

Other motifs

862

12.6

Other motifs

60

4.5

Total

6,815

100.0

 

1,346

100.0

Table 3

Genotyping and allelic details of the 145 EST-SSRs in four grape cultivars

Marker ID

Accession no.

Repeat type

Forward primer

Reverse primer

Expected size (bp)

Riesling

Cabernet

Summit

Noble

R × C Allele

S × N Allele

FAM01

CA817092

(ga)9

TTACCCGACACTGGACAC

ACTTACCACCGAGATGAGG

310

967/983

967/983

989

989

ab × ab

 

FAM02

CB973719

(tc)10

GCCTTGGACCGAACTATC

CTAAGAAACACCATTCATCAG

199

218/236

208/216

218

218

ab × cd

 

FAM03

CF371950

(tca)6

CACCGAAAGAGCACAAGA

CACCGAAAGAGCACAAGA

232

239/266

243/251

262

252/280

ab × cd

aa × bc

FAM04

CF405747

(ct)10

GTGACTTACAATCCTTCCAAA

AGGGAGAGAGAGAGAGAGAGA

180

198

196

189/191

189/191

aa × bb

ab × ab

FAM05

CB035928

(tat)6

ATTTCACCACCTGTCAATAAA

CCACTTCCATACACACATACA

331

470

470/476

458

454

aa × ab

aa × bb

FAM06

CB915165

(aag)11

AGATAATGACCGCTATGTGAA

CAACAATCCCTACCCAAAC

296

313

313

304/335

316/322

 

ab × cd

FAM07

CV092730

(ctt)6

ACTTGTCTCCAAATCATCACA

CATCAGCAGGGTAGAAATAGA

236

360/369

369

362

362/365

ab × aa

aa × ab

FAM08

CV093018

(tcg)6

TCATCATCCACCACAACAC

AGTCTCTTCGCATTAGGGA

235

248

248

254

254

  

FAM09

BQ106736

(ga)9

TGAGGCCTACATCTTGTTCT

TCTGTGTGTCTCTCTGGTGA

277

282/310

286/294

306

296/324

ab × cd

aa × ab

FAM10

CA814604

(aat)13

TGAAGCACTGATGCTTATTG

ACAATGTCACACACAAGGTG

126

117

120/147

147

120/147

aa × bc

aa × bc

FAM11

CB348477

(cgat)11

TACTCTAGGTCCATTGTGGG

CGAATAACAATCTGGCTACC

367

568

566

570

570

aa × bb

 

FAM12

CB346585

(cct)6

GAGAGAAGAGTGGTGGTGAA

CTCCGTGTAGCACCTTAAAT

352

379

NA

356/371

356/368

 

ab × ac

FAM13

CB974681

(cag)6

CTCTTCAGGAAACACTGGAG

CCTGGAGTTCCTGGTAGATT

195

214

214

185/211

187/211

 

ab × ac

FAM14

CF208236

(ctt)8

AGACCACCATGGATCACTT

CTTGATATTCTTAATGGGCG

196

212

212/215

198/201

198/201

aa × ab

ab × ab

FAM15

CF208572

(tc)13

TCATCCTTTCCATACAGACC

CTCCATTGGAAGACACTCAT

113

123

125/131

133/139

NA

aa × bc

 

FAM16

CF214062

(tgc)6

GTTATGAAGCTGGAGGTGAG

AAACTGGAGGACATTGCTAA

325

333/342

342

330

330

ab × aa

 

FAM17

CF214143

(ttc)7

TTTGCTTCTCCATTTGATCT

CTTCAATCCTTGACAGGAAG

286

NA

NA

517

517

  

FAM18

CF211871

(aga)7

AGAGAGCAAAGGAACATGAA

ACAAACCCTAACCCTAGCTC

204

220

220

220/225

229

 

ab × cc

FAM19

CF211908

(caa)6

TTATCAGAGACGAGTCCACC

TAAGTTATGGACTTGGACGG

302

314

314/316

314

314

aa × ab

 

FAM21

CF403813

(ag)9

TTCCAGAGACCTGTTTGTTT

TGGAGGAGTAGGATGAGCTA

309

332

326

316/320

320

aa × bb

ab × aa

FAM22

CF415755

(ttc)11

CTTGCTTCTCATACTCGTCC

GAATCACCCATGGTTTCTAA

274

280/290

284/288

276

276

ab × cd

 

FAM23

DT026156

(aaaat)5

AGATCCTCCGAAACAAACTT

CAAGATCAAGGAGAAACTGC

371

388/392

NA

276

276

  

FAM24

CF512631

(tatg)7

TCCATCTTCTTCTCGTGTTT

TTTGAAGAAACAGGGACTTG

271

281/288

281/288

302

298/300

ab × ab

aa × bb

FAM25

CV095500

(acc)9

CCACTATCACCACTACCACC

CTTGTTCTTGGTCTGAGAGG

333

348

348

348/356

348

 

ab × aa

FAM26

CF515612

(gttt)5

CTCTCCACATTACGTCTTCC

ATCAGGGCAAGTCTCTTGTA

290

310/318

310/318

316

316

ab × ab

 

FAM28

CF516198

(tc)21

TGGCCTTATATGCAGTTTCT

AGGCTCAATTCCAACTGTTA

371

392

392

356

356/392

 

aa × ab

FAM29

BM437681

(att)6

TATAGTGGTCAATGCAACCA

GGTGAGTCCACATGGTAAAT

117

135

135

133

133

  

FAM30

CB003274

(tc)9

ACTCAGCCAAACCAAGTAAA

TTAGATCAAGCCCAGTCATT

277

294/302

298

298

298

ab × cc

 

FAM31

CD012233

(ta)10

CTTGGTGTCCTAAGGTTTCA

AGAATTGCTGTCAGCTTCAT

231

240

248

241

241

aa × bb

 

FAM32

BM437023

(cac)7

AAACTGGACTCCACTGTCTG

GTGGAGATGGCACTAATAGC

211

227

221/227

213

213

aa × ab

 

FAM33

CB912861

(ct)14

TACAGAAACCGAGTCACACA

AATTCAAACTTGCAATCCAT

142

148/152

148/150

166/168

NA

ab × ab

 

FAM34

CB914464

(cca)7

GTATGGGTTTGAGCAGAAAG

GTTGTGGTGGTCGTGAAG

145

153

153

153

153/163

 

aa × ab

FAM35

CB005343

(cag)7

CACTCTCCAACTCCAGATGT

ATGTTTCCCATATTCACAGC

156

160/182

172/182

180

180

ab × ac

 

FAM36

CB920562

(tct)6

TATCATTGTTTCCCTTCTGG

GAAGAATTCAAGAGTGTCCG

359

380/386

396

381

381

ab × aa

 

FAM37

CB915120

(ct)16

CTTTGATTTGGGATGTGTCT

TGGAAGCTCTTGATGAAGTT

121

139

139

138

138

  

FAM38

CB005457

(ct)10

GCTTCCATACGAGAAACTCA

TAGGGTAATCCACAGTTTGC

225

235/238

238/242

231/235

231/235

ab × cd

ab × ab

FAM39

CB915484

(ag)53

TACGTTCTGTTATCCAGGCT

CAATATTTCAGTAGGGCCAG

388

388/414

NA

388

388

  

FAM40

CB920839

(ctt)7

AAGGTACTCAGCTTCCCTTC

CACCATCTCTTCTCCACAAT

320

328/334

328/338

326

326

ab × ac

 

FAM41

CB922482

(agc)6

CAGAAGTTGAGAAGTCAGGG

ACTTTGGCATTCCTAACTGA

175

185/191

185/191

185

185/200

ab × ab

aa × ab

FAM42

CB916884

(gat)7

AAATTGATTTCATCAGTGCC

CTATCATTGTCGCTTTCCTC

292

412

397/412

402

402

aa × ab

 

FAM43

CB911681

(cag)6

AATAGGGAAAGAGAACAGGC

TCAATGTATGCACCCAAGTA

340

489

489

491

491

  

FAM44

CB922984

(aag)6

GAGGAGGTGGAAGGAGAA

TTTGATAAGGTTGATGGTCC

113

129/135

135

135/141

132/141

ab × aa

ab × ac

FAM45

CD801743

(ga)10

ATATAAGCCAAAGGTTCACA

CAAAGGATGGAAAGCATAAG

379

395

395

381/398

383

 

ab × cc

FAM46

CD801804

(aaagg)4

TAACCTCACATCACATCCCT

TATTAGGGTCTGCTGCAAAT

144

154/160

154/160

172/182

172/182

ab × ab

ab × ab

FAM47

CD798867

(aata)5

GGGATGATGCTACCAGTCT

CAAGTATAACAGGGTCCCAA

399

417

417

417

417

  

FAM48

CD798949

(cac)6

CTCAACAACGAATACCCACT

AAGCATCGTTTCAAGTGTTT

241

519

519

523

523

  

FAM49

CD799025

(aaaac)5

AGCCTGAACACAATTTCTTT

CAGCAAGAACTGAAGTGTGA

217

204/230

204/230

196

196

ab × ab

 

FAM50

BQ794329

(ag)14

CACAAAGCATGTCCATAAAC

GGCTTATGCATTACTGGACT

178

185

185

197

185

 

aa × bb

FAM51

BQ798187

(ct)9

CTTGAGTCCTCACTCCAAAG

TGTGACCATGGTGGACTT

101

129/130

129/130

126

126

ab × ab

 

FAM52

BQ800590

(ta)21

AAATCACACCCTACCATATACT

AGGTGCACTAGCTTGAGTTC

142

133

NA

134

NA

  

FAM53

CF603660

(aacaag)4

AACCTCTGCCACCACAAC

CCACACCTCATCGAATATCT

385

394/400

394/400

390

390

ab × ab

 

FAM54

CF605507

(cca)7

ATCTCAAGCCTCTTCTTTCC

ATCAAGAATATCATCCACGC

319

326/335

326/335

326

326

ab × ab

 

FAM55

CF605791

(acc)6

GCACCCACTCACAATGTT

AGGGAAGGAGTAGTAGGTGG

271

284/290

290

293

287/293

ab × aa

aa × ab

FAM56

DT019642

(ttc)6

GCAGAACCCAAGTCTCATAC

CAGGTATGAGAGGACTGAGC

356

368

368

368

368

  

FAM57

CB968692

(ct)16

CCATCTACCATCACCTTTGT

GGAGAAGTGGTATTTGGTGA

152

155

173

158/163

171

aa × bb

ab × cc

FAM58

CF403802

(at)18

TAGACGTTTGCCCTATTTGT

CCTCTAACATGTCCCATTTC

158

154

154

NA

154

  

FAM59

CB917857

(gca)7

GATGGTATACGACGGAGAAA

AGAGTACGACCCTTCGATCT

175

186/192

192

180

180

ab × aa

 

FAM60

CB916170

(caa)6

CCTCATCTGGCTTTCATAAC

CTGGACAGAACTTGGATCAT

143

152/158

132/152

155

155

ab × cd

 

FAM61

CF608950

(ct)9

GCTACTTCTGGGAATGTTCA

AGTCCTCATAAATTCTCAAACA

375

395

395

406

406

  

FAM62

CB342303

(gca)6

CTAATCTCCAGCGAAACAAC

GTCAGCAATGTTGTCATTTG

274

257/289

NA

253/286

286

 

ab × aa

FAM63

CB346557

(tca)6

AAATGCACTCGTCTCTTCAT

CGCTTGACCTTACATACTCC

334

350

350

348/360

348/360

 

ab × ab

FAM64

CN007369

(aag)8

TATACTTCACCGCAATTCCT

TGATCAGCTCCTCGATATTT

261

277

274/286

291

NA

aa × bc

 

FAM65

DT019756

(gca)6

CCCTATCCAGCAGACACTAC

TTCATCTGGCTATACATCCC

129

145/148

145

142

142

ab × aa

 

FAM66

BQ794995

(at)10

TTTATCTCAAACCTTCACATCT

GTTGTTAGGAGTGACTTCCG

200

210

210

210

207/212

 

aa × bc

FAM67

CB977433

(atttt)4

GGACTTCATCCTGGAGTACA

CTTGCAGGACACCTAAATTC

376

395

395

387

387

  

FAM68

CF607255

(aga)6

AAACCCTACCGAAGTCTCTC

CTTCTTCTTCGCCTCTGTTA

307

321

321

321

321

  

FAM69

CF608166

(gaa)6

GATACATAAGATGCCAAGGG

CATCCTCGTCTTCAATCTTC

335

352

352

352

352

  

FAM70

CN545596

(ga)10

TGGCAATAGAAGAGGAGTGT

AACAACACTTCCAGTATGGG

281

389/392

NA

380/397

397/403

 

ab × ac

FAM71

CN548152

(at)9

AGTCTCTTCAAGTGCCTCAG

CTGCATAGACTGACGAAACA

180

202

195

195

197

aa × bb

aa × bb

FAM72

CN549034

(ct)14

TCAGTCCAGATTTACCTTGC

TCATGTGGTTCTGCAATAGA

171

172/188

172/188

180

170/180

ab × ab

aa × ab

FAM73

CO818811

(tttc)5

GGCATATGGAAAGGGATAA

ATTTGGTCAGATGGATCAAG

359

390/399

377/399

369

369

ab × ac

 

FAM74

CO819364

(ag)8

GGCCTCCAGATCAACTAGTAA

GCGCCTCTGTCATAGAATAC

289

307

307

234/318

309

 

ab × cc

FAM75

DT004860

(ctt)11

CCTGTAAACGCTTCAAATCT

ATGGCTGAGTCATAGAGAGG

169

184/187

187

172/175

172/175

ab × aa

ab × ab

FAM76

DT009858

(cag)6

ATTAACGAGGATGTGTTTGG

AAGGATCCATTTCACATACG

394

409

409

427

433

 

aa × bb

FAM78

DT010742

(tgaag)5

TTCATGACAATTGTGTTTGG

CGGACTCATCAGAGAAGAAG

303

322

322

339

339

  

FAM79

DT011109

(ag)12

GCAGAAGCAAGAAGTGAAGT

AGATTCAAAGCCACTGAAGA

147

162/172

162/172

153/157

153/157

ab × ab

ab × ab

FAM80

DT011686

(ct)9

AACTCATTCAGACAGACCCA

ATGATTTCCTCAGCTTTCAA

316

424

424

428

428

  

FAM81

DT011972

(gcc)8

TTCTCTCAACATACATGGCA

GCACTGAATACACTTGGGTT

203

218

218

226

226

  

FAM82

DT012098

(tc)8

AGAAGCACTCCATCTGAGAA

GAAGGCATAATCATCCTGAA

344

357/361

361

348

348

ab × aa

 

FAM83

DT012268

(gagagg)4

CTCCGTGAGAGAAGGTTATG

CATTCCTGACAACCATGC

249

251/275

255

244/255

244/255

ab × cc

ab × ab

FAM84

DT014885

(ga)18

CCCATATTCTCAACCAAG

TCCCAATATGTAGAACCTGG

177

195

195/210

184

184

aa × ab

 

FAM85

DT015345

(ta)10

GAATTCAAGGAGAGGACACA

TATATATTGCGAGGCAACAA

283

300

300/304

308

308

aa × ab

 

FAM86

DT016122

(at)11

AGAAACCAGCTGCCAATA

GGAGGAGACCATAGACATGA

267

276

284

277

NA

aa × bb

 

FAM87

DT026426

(gat)6

TCCGAAGAAGAAGAAGAAGA

CTGGCCATACTGTTTAAAGG

375

388/400

388

421/436

421/433

ab × aa

ab × ac

FAM88

DV220116

(at)14

AATGTCAAAGATTCACCAGG

CAGTTGCAGCTCATAGAACA

237

230/242

254/256

223

226

ab × cd

aa × bb

FAM89

DV220950

(ag)9

CCTTGTTTGGACTTTGGAG

CTAATGGCTTCTGATATGGC

193

211

211

211

211

  

FAM90

DV221456

(ct)10

GATCAAAGATTATTGCGAGG

AACAAGCAAACAGAGGGTTA

368

358/387

387

392/400

400

ab × cd

 

FAM91

DV222762

(tct)8

ATTATCGCAACCAAGATGTC

ATCAGCCTCTGTAACTGGAA

159

176

173/176

161

161

aa × bc

 

FAM92

DV939679

(ta)9

TTGTACTTTGGTGCACCTTT

ACCTTTGATAACCATTGGG

388

405

405

417

417

  

FAM93

DV940288

(ag)12

ATTACATCTCATCCCGGTAA

ATGCTCTCAGAGGAGTCTCA

242

258

244/258

238/243

238/243

aa × ab

ab × ab

FAM94

CF206303

(ttc)6

GGCAATGCAAGGCTATTT

ATCTTCATATGCAGCACCTT

190

277

277

277

277

  

FAM95

CF205720

(ga)10

ATCATCTTCTGCCTCGAATA

TGAAACTGTGCATTCATCAT

176

191

191

191

191

  

FAM96

CF205720

(ga)10

ATCATCTTCTGCCTCGAATA

TGGTGAAGGTTAGTGTGATCT

302

300

300

304

304

  

FAM97

CF205251

(aat)6

AGGTCTCCAGCTTGTACTCA

ATATGTAGCCAGACGTGTCC

301

326

318/326

320

320/324

aa × ab

aa × ab

FAM98

CF205081

(acc)6

AAAGGGTCTTCTGAACTTCC

TCCTAACTGAAACGAAAGGA

382

395

395

395

395

  

FAM99

CF204388

(aaaat)6

ATTCCAAACAAAGCAGGTAA

GGATTGTGAATAAGCCCATA

247

261/266

261

NA

NA

ab × aa

 

FAM100

CF203674

(tc)13

CATTTCACGAGCTCTAAACC

GGATGAGACCAAATTCAAGA

185

186

186

182/191

182

 

ab × aa

FAM101

CF202410

(tatg)5

TGTGACTATGTTTCTTTGTATGT

CAAATCTGATTGTTCCAGGT

251

283/286

283

292/294

292/298

ab × aa

ab × ac

FAM102

CF201608

(tatg)5

ACCCATGTTCTCTTCAACAC

CGAGAGATTGGAGAGTATCG

147

145

145

125

125

  

FAM103

CV092439

(gga)7

GGAGCTTCTTGACATCATTC

CGAATTTCATCATTCTCACA

245

347

347

350

344/350

 

aa × ab

FAM104

CV092870

(agc)7

TGGATCCTATTCTCTCCTCA

AAATATTTCCTAATACCCGACT

113

132

132

132

132

  

FAM105

CV092969

(atc)8

CCCTCTCACTCTTTGAAATC

ATGATTGGATGGTCATGTCT

279

291

291

285

285

  

FAM106

CV093018

(tcg)6

TCATCAACATCATCATCCAC

GCACTCTTCTCACCTTTGTT

202

216

216

222

219/225

 

aa × bc

FAM107

CV094376

(cag)11

ATCAGGTCGAAATAATGGTG

GACCATTGTTAACCGTAGGA

302

301

301

304

304

  

FAM108

CV094448

(ctt)8

CTCTTCTCAAACTCCAATGC

AGGAGTCACCAATGATGAAG

151

156

156

156

156

  

FAM109

CV094765

(at)9

GTTAACATCTAGGCGGTTTG

GCTTGCACATGTTAACAGAA

321

333

333

333

333

  

FAM110

CV095258

(gct)6

GGCTATTGATTCAGCTCCTA

TACAAGCCGTTCTATCCATT

192

287/303

303

290

290

ab × aa

 

FAM112

CV097295

(gaa)8

AGTTTCGTATTCGAAGTCCC

TCTTGAAATCGACTGAGGTT

205

206

206

199

199

  

FAM113

CV098232

(gga)6

ACTTCCATCTACCGTCCTCT

GACTTCCTTCCAGTCCTTCT

246

275

275/291

260

260

aa × ab

 

FAM115

CV098402

(agg)6

AACTAACTCAGCCAAGGACA

CACAGCCTTGTACATTATGC

318

345

345

333

330

  

FAM116

CV099053

(ag)16

CTTCTATTTCTGGCACCCTT

CTTCTGTGGAGGAAGAGTTG

330

333

333/341

333

333

aa × ab

 

FAM117

CV099069

(tga)7

TAGTGGAATACCAGAGTGGG

AGTCGTTCAGATTGATCACC

225

229

229

229

229

  

FAM118

CV100438

(aag)11

AAAGCTTAAGCAACACCTTG

AACAAATCACACGTTATCCC

301

300

305/325

312

NA

aa × bc

 

FAM119

CA810326

(cca)7

GCAAATGAGTTACCAGAAAG

GTAGAAAGGAGGAAGGACCA

311

428/444

424/444

420

420

ab × ac

 

FAM120

CA810919

(agg)7

CGCATCAGAAGTCATCAAC

ACCCTCACTCTCACACTCAC

324

430

426/430

432

432

aa × ab

 

FAM121

CA816978

(gat)6

CCCTTCCATACTCCAACATAC

CCTCAATCTTAGTCGCTCC

348

348

348

348/351

348/351

 

ab × ab

FAM122

CB343602

(ct)9

AGAGGAAGAAGCACAAATCTC

AAAGAGTGGAGGAATCGG

354

370

370

385

385/391

 

aa × ab

FAM123

CB343426

(ga)9

GTAGCCAACAGAACCAGAGA

CAAACACATCCTCACCCTT

516

534

530/534

492

NA

aa × ab

 

FAM124

CB349648

(tga)6

TAAGGAAGCATTAGAAACAAG

AACCAAGAAGGAAGAAGAGAA

312

308/315

315

313

313

ab × aa

 

FAM125

CB969938

(cag)6

TCTTGTCATCTACCTCATCTTG

CACAGTCCCTCCTCCTCT

215

238

238

238

238

  

FAM126

CB973643

(ag)10

CGACCTAAGAAACACCATTC

CCTTGGACCGAACTATCTG

202

220/236

208/218

218

218

ab × cd

 

FAM127

CB982007

(gga)6

ACGGAAGAAGAGAAGAAAGAG

ATCCACCGAAACAAACTTAC

197

216/222

216

NA

NA

ab × aa

 

FAM128

CF214574

(act)6

TACAAGAGCCAAGAGGGATT

GGATAACGAAGGAGACAGAGT

315

784

786

782

782

aa × bb

 

FAM129

CF212154

(aaagg)4

ACATCCCTTTGTTGTCTTCTT

ATTTGTGCTGTTGTCTGTTGT

119

130

130

141

141

  

FAM130

CF405979

(ctc)6

ACAAAGCAGGTAAGTAGCAAA

AAGACGGAAGAAGAGAAGAAA

272

286

286

378

378

  

FAM131

CF514744

(atg)6

TGACTGGCATACTGATTTACC

CCCAATGAACTACCTTTACCT

259

272/275

275

272/275

272/275

ab × aa

ab × ab

FAM132

CF518394

(tca)6

ACCCAATGAACTACCTTTACC

AGGAACAAGACAAACAATACACT

133

149

149

146/149

146/149

 

ab × ab

FAM133

CA812979

(ga)13

GGGAGATTGAAAGGAAGTG

GGAGACCGACGAGGATAA

373

385

385

388

388

  

FAM134

CA813367

(cct)7

GTAGCCAACAGAACCAGAGA

AAACACATCCTCACCTTCC

514

533

529/533

493

493

aa × ab

 

FAM135

CB004296

(cat)6

AGGGTTGTGTCTCTTCTCAA

GATACTTCATCTGTTGCTTCTG

400

413

417/419

413

413

aa × bc

 

FAM136

CB919516

(ctt)14

AGGGAGATGACAAAGATGAAG

CCAAACACCGTAGGAGAGA

245

249/264

NA

261/264

234/261

 

ab × ac

FAm137

CB920177

(tc)9

CAAACTGTCCAATCCTCATAGT

AGTAGAGCCAAGTGTCAAACC

146

157

155

157

157

  

FAM138

CB005751

(gca)9

CGAGTGGTAGAGAGGAGAGAG

GTTGAGGGTGATGGTAAGG

208

223

223/237

237

237

aa × ab

 

FAM139

CD013208

(atttt)4

GGCAGAAAGGCATAAATAGTC

TGGGCACTCTCCAACCTG

377

395

395

395

395

  

FAM140

CB916384

(tttc)6

AAGGGAAGAGAGGTATCGG

CCATAAACGAGAAGAAACAAA

253

274

265/279

269

269

aa × bc

 

FAM141

CD711290

(ttc)6

GAACCATAGACAAGACAAACAA

AAGAGAGAAGCAACGAAGAAC

182

192

186/198

192

192

aa × bc

 

FAM142

CN603827

(aga)5

AAGACCGAAGAAGAGAAGAAA

TAATACCGTGGAAATCACAAA

246

271

267

263

263/267

aa × bb

aa × ab

FAM143

CV099313

(ctc)6

CTCTTTGACCGTTTCCAG

CCCACTACCTCTTACCTTCTT

199

217

217

217

217

  

FAM144

CV092545

(acc)9

CACCACTATCACCACTACCAC

AGGAGGCGAATGAAGGTC

193

211

NA

211/220

211/220

 

ab × ab

FAM145

CV093192

(caa)7

TCCAACAACAACAACTACTAC

AGGAATCTCGTGTCGCTC

215

238/247

238/241

230/236

230/236

ab × ac

ab × ab

FAM146

CB920177

(tc)9

CAAACTGTCCAATCCTCATAGT

AGTAGAGCCAAGTGTCAAACC

146

157/160

155

157

157

ab × aa

 

FAM147

CV092326

(gat)6

TACAACCACATAGAGGCACTT

TCTTCTTCAGTTTCTTCACCA

185

606/612

606

602

606

ab × aa

aa × bb

FAM148

CV099379

(caa)7

TCCTCCTTGTTATCCTCTTCT

TAGTAGTTGTTTCGGTTGGAC

400

413

413

410

410

  

FAM149

CV094327

(ctt)9

TAGACCTCCACCACTCTCTC

GTCATCAGCGAAAGCATC

343

362/365

359/365

335/353

332/335

ab × ac

ab × ac

FAM150

CF519163

(gct)6

ATCTGACAAAGGAAAGGAGAA

GTAACATACCGAGGAAGGCA

235

244

NA

237

237/244

 

aa × ab

NA not available

Functional analysis of EST-SSR sequences

The 1,701 assembled non-redundant EST-SSRs were functionally annotated using the HTGOFAT program (Dowd and Zaragoza 2005). Fifty-eight percent (994 out of 1,701) of the EST-SSRs were annotated and grouped by the Biological Process Classification using the MIPS MATDB Arabidopsis Scheme. The most abundant EST-SSRs belonged to the categories of protein-binding (22%) and subcellular localization (18%; Fig. 2), which demonstrated a similar pattern to wheat, rice, maize and barley (Tang et al. 2006). The 150 validated markers were further functionally annotated (Electronic Supplementary Material 2) and estimation of their genomic/chromosome locations by comparison to grapevine genome assembly (Jaillon et al.2007; Velasco et al.2007) is given in Electronic Supplementary Material 3.
Fig. 2

Functional prediction of 994 grape SSR-EST based on the MIP MATDB classification scheme

SSR marker development and validation

The Beckman CEQ8800 Genetic Analyzer was used for the SSR validation and analysis. This system can detect DNA fragment length polymorphism in a “single base pair”. A set of 150 primer pairs was initially screened for SSR marker development and validation. Parents of two mapping populations, V. vinifera Riesling × Cabernet Sauvignon (Riaz et al.2004) and V. rotundifolia Summit × Noble (Ren et al. 2000) were used for the screening. Results showed that 145 out of 150 primers had well-amplified fragments among the four cultivars (Table 3). Some of the fragment sizes exceeded expected sizes possibly due to their having introns within the flanking regions or the length of the repeat being shorter than the source species, and less prone to polymerase slippage. Polymorphisms were found in 66 primer pairs between Riesling and Cabernet Sauvignon, and 40 between Summit and Noble. Only 16 of the polymorphic primers shared the same polymorphic lengths between these two parent pairs, reflecting the fact that the alleles between V. vinifera and V. rotundifolia grape are distinct (Riaz et al.2008).

The homo and heterozygosity of these 145 loci were screened in the four testing cultivars; 92 of 144 were identified as homozygous and 52 were heterozygous loci in Riesling, while 86 of 136 were homozygous and 49 were heterozygous loci in Cabernet Sauvignon. Among the 92 Riesling and 86 Cabernet Sauvignon homozygous loci, 68 are common in both parents (Table 4). As for the muscadine grapes Noble and Summit, Noble showed 97 homozygous and 39 heterozygous loci and the respective number for Summit was 108 and 34 (Table 4). Some of those microsatellite loci were selected for having long stretches in V. vinifera grapes, and thus may show more polymorphisms than in muscadines. From this screening of 145 loci, muscadine grapes demonstrated a higher homozygosity compared to V. vinifera grapes.
Table 4

Level of heterozygosity in two Vitis vinifera and two Muscadinia rotundifolia genotypes for a set of 145 SSR markers

Genotype

Riesling

Cabernet Sauvignon

Summit

Noble

Riesling vs Cabernet Sauvignon

Summit vs Noble

Homozygous

92

86

108

96

66(9)a

86(6)b

Heterozygous

52

49

34

40

  

Failed

1

10

3

9

  

a9 primers are homozygous in both Riesling and Cabernet Sauvignon, but are polymorphic between two cultivars

b6 primers are homozygous in both Submit and Noble, but are polymorphic between two cultivars

Pairwise comparison between Riesling and Cabernet Sauvignon showed that 72 loci were monomorphic with either one allele (60) or two (12). Seventy loci were heterozygous in at least one cultivar with either two (53), three (10), or four alleles (7; Table 5). The muscadine Noble and Summit showed 50 heterozygous loci in at least one parent with either two (31), three (17), or four alleles (2). Ninety homozygous loci were found in both cultivars with either one (84) or two alleles (6; Table 5). According to the results from these 145 EST-SSR loci, the percentage of polymorphisms is about 49% between Riesling and Cabernet Sauvignon, and 29% between Summit and Noble. However, those polymorphic SSRs that are homozygous (e.g. aa × bb) in both parents cannot be mapped in F1 populations although they are useful for mapping in F2 or backcross populations (Chen et al.2006). The heterozygous monomorphic SSRs (e.g. ab × ab) can be used for mapping in F1 populations (Table 5). As a result, the estimated number of SSRs that can be mapped in the F1 populations between Riesling and Cabernet Sauvignon is about 46%, which means that out of the total 1,037 SSRs with successful primers designed, around 477 EST-SSR putative markers can be mapped in the F1 population, and about 33% of the total SSRs (342 EST-SSR loci) can be mapped in the F1 of Summit × Noble.
Table 5

Distribution of the segregation types expected for the two mapping populations

Alleles

R × Ca

Number

S × Nb

Number

Mappable in F1

1

aa × aa

57

aa × aa

80

No

2

aa × bb

9

aa × bb

6

No

2

aa × ab

15

aa × ab

13

Yes

2

ab × aa

18

ab × aa

4

Yes

2

ab × ab

12

ab × ab

13

Yes

3

aa × bc

8

aa × bc

4

Yes

3

ab × cc

2

ab × cc

4

Yes

3

ab × ac

6

ab × ac

8

Yes

4

ab × cd

9

ab × cd

1

Yes

Total mappable

 

70

 

47

 

aR × C: Riesling × Cabernet Sauvignon

bS × N: Summit × Noble

EST-SSR marker transferability was evaluated and the current research showed a high transferability across species. All but two of the 145 EST-SSR markers in Vitis vinifera appeared in the muscadine as well. This result indicated that development of EST-SSR markers is a cost-effective method for obtaining additional markers for grape genome typing and gene mapping.

EST-SSRs provided sources of additional markers for marker development. Compared to genomic-derived markers, EST-SSRs are highly transferable for detecting the gene-rich areas within the genome. We can utilize these markers to evaluate marker transferability across taxa, and conduct analysis in comparative mapping and gene functional diversity analysis, in addition to genotyping. The functional EST-SSR markers should be even more useful for developing a linkage map or tagging a viticulturally important trait. In addition, the polymorphic EST-SSR markers are much needed for genotyping, cultivar identification and development of a linkage map in muscadine grapes since they are genetically much less diversified than Vitis species.

Notes

Acknowledgments

This work was supported by USDA Capacity Building Grant (#0205031) and FAMU-ARS Science Center for Excellence. The authors thank two anonymous reviewers for invaluable comments on the manuscript. Special thanks go to Ms. Elisa Scott for helping us to prepare the DNA and PCR samples.

Open Access

This article is distributed under the terms of the Creative Commons Attribution Noncommercial License which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited.

Supplementary material

References

  1. Adam-Blondon AF, Roux C, Claux D, Butterlin G, Merdinoglu D, This P (2004) Mapping 245 SSR markers on the Vitis vinifera genome: a tool for grape genetics. Theor Appl Genet 109(5):1017–1027PubMedCrossRefGoogle Scholar
  2. Akkak A, Lembo A, Torello Marinoni D, Gribaudo I, Botta R (2006) Analysis and transferability of EST-SSR markers in grape. Acta Hort (ISHS) 827:59–62Google Scholar
  3. Arroyo García R, Lefort F, de Andrés M, Ibañez J, Borrego J, Jouve N, Cabello F, Martínez Zapater J (2002) Chloroplast microsatellite polymorphisms in Vitis species. Genome 45(6):1142–1149PubMedCrossRefGoogle Scholar
  4. Bocharova B, Kovaliova I, Mazurenko L (2009) Identification of grapevine clone genotypes by use of microsatellite markers. Cytol Genet 43(6):371–378CrossRefGoogle Scholar
  5. Bowers J, Dangl G, Vignani R, Meredith C (1996) Isolation and characterization of new polymorphic simple sequence repeat loci in grape (Vitis vinifera L.). Genome 39(4):628–633Google Scholar
  6. Bowers J, Boursiquot J, This P, Chu K, Johansson H, Meredith C (1999a) Historical genetics: the parentage of Chardonnay, Gamay and other wine grapes of northeastern France. Science 285(3433):1562–1565PubMedCrossRefGoogle Scholar
  7. Bowers J, Dangl G, Meredith C (1999b) Development and characterization of additional microsatellite DNA markers for grape. Am J Enol Vitic 50(3):243–246Google Scholar
  8. Cardle L, Ramsay L, Milbourne D, Macaulay M, Marshall D, Waugh R (2000) Computational and experimental characterization of physically clustered simple sequence repeats in plants. Genetics 156:847–854PubMedGoogle Scholar
  9. Chabane K, Ablett G, Cordeiro G, Valkoun J, Henry R (2005) EST versus genomic derived microsatellite markers for genotyping wild and cultivated barley. Genet Res Crop Evol 52:903–909CrossRefGoogle Scholar
  10. Chani E, Ashkeni V, Hillel J, Veilleux R (2002) Microsatellite marker analysis of an anther-derived potato family: skewed segregation and gene-centromere mapping. Genome 45(2):236–242PubMedCrossRefGoogle Scholar
  11. Chen C, Zhou P, Choi Y, Huang S, Gmitter F (2006) Mining and characterizing microsatellites from citrus ESTs. Theor Appl Genet 112(7):1248–1257PubMedCrossRefGoogle Scholar
  12. Cho Y, Ishii T, Temnykh S, Chen X, Lipovich L, Park W, Ayres N, Cartinhour S, McCouch S (2000) Diversity of microsatellites derived from genomic libraries and GenBank sequences in rice (Oryza sativa L.) Theor Appl Genet 100(5):713–722Google Scholar
  13. Cipriani G, Marrazzo M, Di Gaspero G, Pfeiffer A, Morgante M, Testolin R (2008) A set of microsatellite markers with long core repeat optimized for grape (Vitis spp.) genotyping. BMC Plant Biol 8:127Google Scholar
  14. Cordeiro M, Casu R, McIntyre C, Manners J, Henry R (2001) Microsatellite markers from sugarcane (Saccharum spp) ESTs across transferable to erianthus and sorghum. Plant Sci 160(6):1115–1123PubMedCrossRefGoogle Scholar
  15. Costantini L, Grando M, Feingold S, Ulanovsky S, Mejía N, Hinrichsen P, Doligez A, This P, Cabezas J, Martínez-Zapater J (2007) Generation of a common set of mapping markers to assist table grape breeding. Am J Enol Vitic 58:102–111Google Scholar
  16. Dalbò M, Ye G, Weeden N, Steinkellner H, Sefc K, Reisch B (2000) Gene controlling sex in grapevines placed on a molecular marker-based genetic map. Genome 43:333–340PubMedCrossRefGoogle Scholar
  17. De Keyser E, De Riek J, Van Bockstaele E (2009) Discovery of species-wide EST-derived markers in Rhododendron by intron-flanking primer design. Mol Breed 23(1):171–178CrossRefGoogle Scholar
  18. De Mattia F, Imazio S, Grassi F, Lovicu G, Tardaguila J, Maitti C, Scienza A, Labra M (2007) Genetic characterization of Sardinia grapevine cultivars by SSR markers analysis. Int J Vine Wine Sci 41:175–184Google Scholar
  19. Decroocq V, Favé M, Hagen L, Bordenave L, Decroocq S (2003) Development and transferability of apricot and grape EST microsatellite markers across taxa. Theor Appl Genet 106:912–922PubMedGoogle Scholar
  20. Depeiges A, Goubely C, Lenoir A, Cocherel S, Picard G, Raynal M, Grellet F, Delseny M (1995) Identification of the most represented repeated motifs in Arabidopsis thaliana microsatellite loci. Theor Appl Genet 91(1):160–168CrossRefGoogle Scholar
  21. Di Gaspero G, Peterlunger E, Testolin R, Edwards K, Cipriani G (2000) Conservation of microsatellite loci within the genus Vitis. Theor Appl Genet 101(1):301–308CrossRefGoogle Scholar
  22. Di Gaspero G, Cipriani G, Marrazzo M, Andreetta D, Prado Castro M, Peterlunger E, Testolin R (2005) Isolation of (AC)n-microsatellites in Vitis vinifera L. and analysis of genetic background in grapevines under marker assisted selection. Mol Breed 15(1):11–20Google Scholar
  23. Di Gaspero G, Cipriani G, Adam-Blondon A-F, Testolin R (2007) Linkage maps of grapevine displaying the chromosomal locations of 420 microsatellite markers and 82 markers for R-gene candidates. Theor Appl Genet 114(7):1249–1263PubMedCrossRefGoogle Scholar
  24. Doligez A, Bouquet A, Danglot Y, Lahogue F, Riaz S, Meredith C, Edwards K, This P (2002) Genetic mapping of grapevine (Vitis vinifera L.) applied to the detection of QTLs for seedlessness and berry weight. Theor Appl Genet 105:780–795PubMedCrossRefGoogle Scholar
  25. Doucleff M, Jin Y, Gao F, Riaz S, Krivanek A (2004) A genetic linkage map of grape, utilizing Vitis rupestris and Vitis arizonica. Theor Appl Genet 109:1178–1187PubMedCrossRefGoogle Scholar
  26. Dowd S, Zaragoza J (2005) High throughput gene ontology functional annotation toolkit (Hit-Go-Fat) utilized for animal and plant. Plant and Animal Genome XIII Conference, San Diego, CAGoogle Scholar
  27. Eujayl I, Sorrells M, Baum M, Wolters P, Powell W (2002) Isolation of EST-derived microsatellite markers for genotyping the A and B genomes of wheat. Theor Appl Genet 104(2):399–407PubMedCrossRefGoogle Scholar
  28. Feng S, Li W, Huang H, Wang J, Wu Y (2009) Development, characterization and cross-species/genera transferability of EST-SSR markers for rubber tree (Hevea brasiliensis). Mol Breed 23(1):85–97CrossRefGoogle Scholar
  29. Fernández M, Núñez Y, Ponz P, Hernáiz S, Gallego F, Ibáñez J (2008) Characterization of sequence polymorphisms from microsatellite flanking regions in Vitis spp. Mol Breed 22(3):455–465CrossRefGoogle Scholar
  30. Gao L, Tang J, Li H, Jia J (2003) Analysis of microsatellites in major crops assessed by computational and experimental approaches. Mol Breed 113(3):163–185Google Scholar
  31. Grando MS, Bellin D, Edwards KJ, Pozzi C, Stefanini M, Velasco R (2003) Molecular linkage maps of Vitis vinifera L. and Vitis riparia Mchx. Theor Appl Genet 106:1213–1224PubMedGoogle Scholar
  32. Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyère C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro F, Anthouard V, Vico V, Del Fabbro C, Alaux M, Di Gaspero G, Dumas V, Felice N, Paillard S, Juman I, Moroldo M, Scalabrin S, Canaguier A, Le Clainche I, Malacrida G, Durand E, Pesole G, Laucou V, Chatelet P, Merdinoglu D, Delledonne M, Pezzotti M, Lecharny A, Scarpelli C, Artiguenave F, Pè ME, Valle G, Morgante M, Caboche M, Adam-Blondon A-F, Weissenbach J, Quétier F, Wincker P (2007) The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla. Nature 449:463–467PubMedCrossRefGoogle Scholar
  33. Kantety R, La Rota M, Matthews D, Sorrells M (2002) Data mining for simple sequence repeats in expressed sequence tags from barley, maize, rice, sorghum and wheat. Plant Mol Biol 48(5):501–510PubMedCrossRefGoogle Scholar
  34. Lamoureux D, Bernole A, Le Clainche I, Tual S, Thareau V, Paillard S, Legeai F, Dossat C, Wincker P, Oswald M, Merdinoglu D, Vignault C, Delrot S, Caboche M, Chalhoub B, Adam-Blondon AF (2006) Anchoring of a large set of markers onto a BAC library for the development of a draft physical map of the grapevine genome. Theor Appl Genet 113:344–356PubMedCrossRefGoogle Scholar
  35. Li Y, Korol A, Fahima T, Nevo E (2004) Microsatellites within genes: structure, function, and evolution. Mol Bio Evol 21(6):991–1007CrossRefGoogle Scholar
  36. Lima L, Gramacho K, Gesteira A, Lopes U, Gaiotto F, Zaidan H, Pires J, Cascardo J, Micheli F (2008) Characterization of microsatellites from cacao—Moniliophthora perniciosa interaction expressed sequence tags. Mol Breed 22(2):315–318Google Scholar
  37. Lin H, Walker A (1998) Identifying grape rootstocks with simple sequence repeat (SSR) DNA markers. Am J Enol Vitic 49(4):403–407Google Scholar
  38. Lin H, Civerolo E, Hu R, Barros S, Francis M, Walker M (2005) Multilocus simple sequence repeat markers for differentiating strains and evaluating genetic diversity of Xylella fastidiosa. Appl Environ Microbiol 71(8):4888–4892PubMedCrossRefGoogle Scholar
  39. Lowe KM, Walker MA (2006) Genetic linkage map of the interspecic grape rootstock cross Ramsey (Vitis champinii) × Riparia Gloire (Vitis riparia). Theor Appl Genet 112:1582–1592PubMedCrossRefGoogle Scholar
  40. Merdinoglu D, Butterlin G, Bevilacqua L, Chiquet V, Adam-Blondon AF, Decroocq S (2005) Development and characterization of a large set of microsatellite markers in grapevine ( Vitis vinifera L.) suitable for multiplex. Mol Breed 15(4):349–366Google Scholar
  41. Metzgar D, Bytof J, Wills C (2000) Selection against frame shift mutations limits microsatellite expansion in coding DNA. Genome Res 10(1):72–80PubMedGoogle Scholar
  42. Oetting W, Lee H, Flanders D, Wiesner G, Sellers T, King R (1995) Linkage analysis with multiplexed short tandem repeat polymorphisms using infrared fluorescence and M13 tailed primers. Genomics 30(3):450–458PubMedCrossRefGoogle Scholar
  43. Qu X, Lu J, Lamikanra O (1996) Genetic diversity in Muscadine and American bunch grapes based on randomly amplified polymorphic DNA (RAPD) analysis. J Am Soc Hort Sci 121(6):1020–1023Google Scholar
  44. Ren Z, Lamikanra O, Lu J (2000) Identification of a RAPD marker closely linked to the fruit color in muscadine grape (Vitis rotundifolial). Acta Hort 528:263–266Google Scholar
  45. Riaz S, Dangl G, Edwards K, Meredith C (2004) A microsatellite marker based framework linkage map of Vitis vinifera L. Theor Appl Genet 108(5):864–872PubMedCrossRefGoogle Scholar
  46. Riaz S, Krivanek AF, Xu K, Walker MA (2006) ReWned mapping of the Pierce’s disease resistance locus, PdR1, and sex on an extended genetic linkage map of Vitis rupestris x V. arizonica. Theor Appl Genet 113:1317–1329PubMedCrossRefGoogle Scholar
  47. Riaz S, Tenscher A, Smith B, Ng D, Walker M (2008) Use of SSR markers to assess identity, pedigree, and diversity of cultivated Muscadinia rotundifolia. J Am Soc Hort Sci 133:559–568Google Scholar
  48. Riaz S, Tenscher A, Graziani R, Krivanek A, Ramming D, Walker A (2009) Using marker-assisted selection to breed Pierce’s disease-resistant grapes. Am J Enol Vitic 60:199–207Google Scholar
  49. Roy J, Balyan H, Prasad M, Gupta P (2002) Use of SAMPL for a study of DNA polymorphism, genetic diversity and possible gene tagging in bread wheat. Theor Appl Genet 104(2):465–472PubMedCrossRefGoogle Scholar
  50. Salmaso M, Malacarne G, Troggio M, Faes G, Stefanini M, Grando M, Velasco R (2008) A grapevine (Vitis vinifera L.) genetic map integrating the position of 139 expressed genes. Theor Appl Genet 116:1129–1143PubMedCrossRefGoogle Scholar
  51. Scott K, Eggler P, Seaton G, Rossetto M, Ablet E, Lee L, Henry R (2000) Analysis of SSRs derived from grape ESTs. Theor Appl Genet 100(5):723–726CrossRefGoogle Scholar
  52. Sefc K, Steinkellner H, Glössl J, Kampfer S, Regner F (1998) Reconstruction of a grapevine pedigree by microsatellite analysis. Theor Appl Genet 97(2):227–231CrossRefGoogle Scholar
  53. Tang J, Gao L, Cao Y, Jia J (2006) Homologous analysis of SSR-ESTs and transferability of wheat SSR-EST markers across barley, rice and maize. Euphytica 151:1–87Google Scholar
  54. Tekeoglu M, Rajesh N, Muehlbauer J (2002) Integration of sequence tagged microsatellite sites to the chickpea genetic map. Theor Appl Genet 105(6):847–854PubMedCrossRefGoogle Scholar
  55. Tessier C, David J, This P, Boursiquot J, Charrier A (1999) Optimization of the choice of mocular markers for varietal identification in Vitis vinifera L. Theor Appl Genet 98(1):171–177CrossRefGoogle Scholar
  56. Thiel T, Michalek W, Varshney R, Graner A (2003) Exploiting EST databases for the development and characterization of gene-derived SSR-markers in barley (Hordeum vulgare L.). Theor Appl Genet 106(3):411–422Google Scholar
  57. Thomas M, Scott N (1993) Microsatellite repeats in grapevine reveal DNA polymorphisms when analyzed as sequence-tagged sites (STSs). Theor Appl Genet 86(8):985–990CrossRefGoogle Scholar
  58. Toth G, Gaspari Z, Jurka J (2000) Microsatellites in different eukaryotic genomes: survey and analysis. Genome Res 10(7):967–981PubMedCrossRefGoogle Scholar
  59. Varshney R, Thiel T, Stein N, Langridge P, Graner A (2002) In silico analysis on frequency and distribution of microsatellites in ESTs of some cereal species. Cell Mol Biol Lett 7(2A):537–546Google Scholar
  60. Varshney R, Granner A, Sorrells M (2006) Genic microsatellite markers in plants: features and applications. Trends Biotech 23(1):48–55CrossRefGoogle Scholar
  61. Velasco R, Zharkikh A, Troggio M, Cartwright D, Cestaro A, Pruss D, Pindo M, FitzGerald L, Vezzulli S, Reid J, Malacarne G, Iliev D, Coppola G, Wardell B, Micheletti D, Macalma T, Facci M, Mitchell J, Perazzolli M, Eldredge G, Gatto P, Oyzerski R, Moretto M, Gutin N, Stefanini M, Chen Y, Segala C, Davenport C, Demattè L, Mraz A, Battilana J, Stormo K, Costa F, Tao Q, Si-Ammour A, Harkins T, Lackey A, Perbost C, Taillon B, Stella A, Solovyev V, Fawcett J, Sterck L, Vandepoele K, Grando M, Toppo S, Moser C, Lanchbury J, Bogden R, Skolnick M, Sgaramella V, Bhatnagar S, Fontana P, Gutin A, Van de Peer Y, Salamini F, Viola R (2007) High quality draft consensus sequence of the genome of a heterozygous grapevine variety. PLoS ONE 2:e1326PubMedCrossRefGoogle Scholar
  62. Vezzulli S, Troggio M, Coppola G, Jermakow A, Cartwright D, Zharkikh A, Stefanini M, Grando M, Viola R, Adam-Blondon AF, Thomas M, This P, Velasco R (2008) A reference integrated map for cultivated grapevine (Vitis vinifera L.) from three crosses, based on 283 SSR and 501 SNP-based markers. Theor Appl Genet 117:499–511PubMedCrossRefGoogle Scholar
  63. Wren J, Forgacs E, Fondon J, Pertsemlidis A, Cheng S, Gallardo T, Williams R, Shohet R, Minna J, Garner H (2000) Repeat polymorphisms within gene regions: phenotypic and evolutionary implications. Am J Hum Genet 67(2):345–356PubMedCrossRefGoogle Scholar
  64. Yu J, Dake T, Singh S, Benscher D, Li W, Gill B, Sorrells M (2004) Development and mapping of EST-derived simple sequence repeat markers for hexaploid wheat. Genome 47(5):805–818PubMedCrossRefGoogle Scholar
  65. Zhang J, Guo W, Zhang T (2002) Molecular linkage map of allotetraploid cotton (Gossypium hirsutum L. × Gossypium barbadense L.) with a haploid population. Theor Appl Genet 105(8):1166–1174Google Scholar

Copyright information

© The Author(s) 2010

Authors and Affiliations

  • Hong Huang
    • 1
    • 2
  • Jiang Lu
    • 1
  • Zhongbo Ren
    • 1
  • Wayne Hunter
    • 3
  • Scot E. Dowd
    • 4
  • Phat Dang
    • 5
  1. 1.Center for Viticulture and Small Fruits ResearchFlorida A&M UniversityTallahasseeUSA
  2. 2.School of Library and Information ScienceUniversity of South FloridaTampaUSA
  3. 3.United States Department of Agriculture, Agriculture Research ServiceUnited States Horticultural Research LaboratoryFort PierceUSA
  4. 4.Research and Testing LaboratoryLubbockUSA
  5. 5.United States Department of Agriculture, Agricultural Research ServiceNational Peanut Research LaboratoryDawsonUSA

Personalised recommendations