Prevalence of, and Factors Associated with Intestinal Parasites in Multinational Expatriate Workers in Al Ain City, United Arab Emirates: An Occupational Cross-Sectional Study
- 523 Downloads
Abstract
To estimate the prevalence of, and identify factors associated with intestinal parasites (IPs) in expatriate workers in the United Arab Emirates (UAE). All expatriate workers (N = 115) in a conveniently selected workplace in the industrial district of Al Ain city were invited to participate in a cross-sectional study. Consenting workers completed an interviewer-led questionnaire and self-collected stool samples. Stool samples were microscopically and molecularly screened for the presence of IPs. Univariate and multivariate analyses were conducted. Overall, 102 (88.7%) workers participated in the survey and 84.3% provided stool samples. Over three-quarters (79.4%) of workers were living in labour accommodation, 76.0% were sharing a bedroom with ≥ 4 workers, 80.2% were sharing a toilet with > 5 other people. Fifteen species of IPs were identified. Microscopically, 17.4% of the screened stool samples were positive for at least one parasite. Entamoeba species was the most common (8.1%) followed by Cryptosporidium species (3.5%). Thirty-six (41.8%) of the tested stool samples were positive for at least one parasite by molecular testing. The most prevalent parasite was Cryptosporidium species (16.3%) followed by Enterobius vermicularis (14.0%) and Ascaris lumbricoides (5.8%). Overall, 47.8% of the tested expatriate workers were positive for at least one IP, microscopically or molecularly. Educational attainment was negatively associated with being positive for at least one IP. IPs were very common amongst expatriate workers in Al Ain city. Efficacious and cost-effective public health interventions are required to reduce the burden of, and prevent the onward transmission of IPs in the UAE.
Keywords
Communicable diseases Infectious disease transmission One health Parasitic intestinal diseases Transients and migrants United Arabia EmiratesIntroduction
Infectious intestinal parasites (IPs) including helminths and protozoans represent a subset of neglected diseases, particularly in developing and tropical countries [1]. From 1991 to 2008, 11% of the worldwide waterborne outbreaks were caused by parasites [2]. In 2010, the global burden of diseases caused by the major intestinal nematodes (round worms) were estimated at 450 million infected people with hookworm, approximately 800 million with Ascaris lumbricoides, 460 million with Trichuris trichiura, and 300 million with Schistosoma species [3]. In 2018, the World Health Organization (WHO) estimated that approximately 25% of the world’s population were infected with soil-transmitted helminths [4]. Five million years lived with a disability, were attributed to soil transmitted helminths, of which 65% were attributed to hookworms, 22% to A. lumbricoides, and the remaining 13% to T. trichiura [3, 5]. Exposure to IPs have several potential unfavourable health outcomes including, but not limited to, physical development [6, 7] and growth retardation [8, 9], depression, reduced intellectual capacity and memory [10], cancer [11, 12], and decreased female fecundity and fertility [13, 14, 15].
Cryptosporidium and giardia are the two most common waterborne parasitic infections leading to diarrhoea [16, 17]. Other waterborne protozoan IPs that cause human complications are; Toxoplasma gondii, Entamoeba histolytica, Acanthamoeba spp., Cyclospora cayetanensis, Microsporidia, Isospora, Blastocystis hominis, Sarcocystis spp., Naegleria spp. and Balantidium coli [2, 18]. Waterborne outbreaks of protozoan cryptosporidium infection have been documented all over the world in contaminated swimming pools, recreational and public water supplies [17], drinking water reservoirs, and contaminated food [19].
A wide range of socioeconomic, environmental, and hygienic factors contribute to the increased risk of contracting IPs. In recent decades, most countries in the Arabian Gulf peninsula have experienced substantial improvements in living standards for city inhabitants, mostly facilitated by the income from oil and gas reserves. The six Gulf Cooperation Council (GCC) countries (Bahrain, Oman, Kuwait, Qatar, Saudi Arabia, and United Arab Emirates; UAE) are categorised as high-income developing countries. The six GCC countries have different tropical disease control programs and almost all of them have been declared successful by the WHO [1, 18, 20]. However, rapid socio-economic developments and sustained economic stability have resulted in a mass influx of expatriate workers to these countries, mainly from less affluent and developed countries [21].
Patterns of parasitic infection vary within a population and are linked to countries of origin [22, 23, 24, 25], host gender [7], and annual fluctuations in parasite transmission rates within a population pool [24, 26, 27]. The UAE is a rapidly developing country, composed of multinational populations with varied educational backgrounds, religious beliefs, eating and recreational habits and behaviours, and cultural practices [28]. The annual population growth for the UAE is approximately 3.3% [21], which places it sixth in the world rankings. Expatriates to the UAE mainly originate from developing countries in Africa, Asia, and South Asia [29, 30]; where parasitic infections are often endemic [31, 32, 33]. In the UAE, expatriates from India, Bangladesh, and Pakistan comprise over 80% of the country’s workforce [34]. In 1982, the Abu Dhabi Public Health Preventative Medicine Laboratory found that 34% of all expatriate food handlers working in the country had helminths and protozoan infections [35]. A retrospective analysis of stool samples collected from a convenient sample of healthy expatriate workers for routine residency visa health screening between January and December 2013 reported that 3.3% of 21,347 tested expatriate workers of different occupations were positive for IPs in the emirate of Sharjah (UAE); however, the stool samples were only analyzed microscopically without molecular identification [36].
Currently, there is a scarcity of data on the burden of IPs and its associated factors among expatriate workers in the UAE. This study aimed to estimate the prevalence of, and identify sociodemographic and health-related factors associated with IPs, in expatriate workers in the UAE.
Materials and Methods
Study Design and Subjects
A cross-sectional survey was conducted between April and July 2017 in an industrial district (Senaiya) of Al Ain city, in the emirate of Abu Dhabi, UAE. All multinational expatriate workers in a conveniently selected workplace were invited to participate in this study. Workers with abdominal surgery or who had recently taken antibiotic or anti-parasitic medication were excluded.
Survey Instruments and Procedure
To our knowledge, there are no validated data collection instruments to assess potential factors that could be associated with exposure to IPs relevant for the contextual setting of our study in the UAE (i.e. multinational migrant workers with varying levels of education and different cultural practices). Hence, a structured questionnaire was developed by the study research team composed of a clinical microbiologist, epidemiologist, parasitologist, and a veterinarian. The questionnaire was specifically designed to collect information on socio-demographics, exposure to animals, living and accommodation conditions in the UAE, drinking and eating habits, travel history, self-rated stool type, and self-reported craving for sugar.
The questionnaire was repeatedly reviewed internally by the multilingual research team who were fluent in the spoken languages (Arabic, Hindi, Tagalog, and Urdu) of the target study population. However, to avoid any potential measurement bias and to ensure correct comprehension of the questions, the questionnaire was then piloted on a convenient sample of multinational workers who were employed in another workplace within the same industrial district. Minor modifications and re-wording were implemented following the piloting phase.
Native Arabic, Tagalog, and Urdu speaking interviewers and other research team members received 3 days of training to become conversant with the survey objectives and procedures. All face-to-face anonymous interviews collected information from the voluntary consenting workers. The quality of the data collection was standardized using repeated pretests until all research staff had achieved the required level of competency.
Survey and Anthropometric Data
Survey questionnaires collected data on socio-demographic and living characteristics. Socio-demographics included age, education level, gender, marital status, ethnicity, place of residence in the home country, and length of stay in the UAE. Living and behavioral characteristics covered type of accommodation, number of people sharing the same bed room, number of people sharing the same toilet, frequency of eating unwashed food, most frequent source of food, using the same cutting board for vegetables and meat, and last time traveled abroad outside of the UAE. Health-related characteristics collected information on type of stool using the Bristol stool chart [37], frequency of craving for sugar, hemoglobin (Hb) concentration, and nutritional status. The Hb concentration was measured using a non-invasive device (Pronto Pulse Co-Oximeter, Masimo). Following the WHO guidelines [38], anemia was defined as Hb concentration < 12.0 g/dl in women and < 13.0 g/dl in men. To assess nutritional status, we computed the body mass index (BMI) by measuring the standing body height in centimeters (cm) and body mass in kilograms (kg). Based on the WHO BMI criteria, nutritional status was categorized into underweight (BMI < 18.5 kg/m2), normal weight (BMI = 18.5–24.9 kg/m2), overweight (BMI = 25.0–29.9 kg/m2), and obese (BMI ≥ 30.0 kg/m2) [39].
Stool Sample Collection and Processing
Stool samples were self-collected by participants using a standardised procedure. Commercial collection kits and instructions were provided and explained by the trained interviewers in the native language of the participant. We modified the self-collection stool sample instructions used by the National Health Services in the United Kingdom. Specifically, all study participants were provided with clingfilm, disposable gloves, a commercial collection kit, and a clean transparent plastic bag. Participants were instructed to stretch the clingfilm securely over the toilet to collect their stool sample and if possible, to keep the sample free from urine. Next, the participants were instructed to use the spatula inside the lid of the container and transfer a small sample of the stool (approximately the size of two large dates) into the container. The container was then placed in the plastic bag and then handed back to the research assistant. All containers and plastic bags were pre-barcoded with the participants unique study identification number. If participants self-collected samples outside the core working hours of the research team (i.e. late-night or early morning), then they were instructed to leave the plastic bag and sample container in the refrigerator (4 °C) provided so that it could be collected by the research team the following morning. All stool samples were either collected on the same day or the day after and transported for analysis to the Microbiology Laboratory at UAE University. Stool samples were stored at 4 °C and processed within one to 2 days, using a stool concentration technique for ova, cyst, and larvae microscopy detection. As for molecular analyses, two Eppendorf tubes were filled with stool and stored at − 20 °C. The remaining stool samples were kept at 4 °C, for 2 weeks for intestinal coccidian identification, using the modified Ziehl–Neelsen (mZN) stain technique (RAL Diagnostics, France).
IPs Identification
As previously mentioned, all samples were pre-barcoded with the participants unique study identification number and laboratory staff performed sample preparation and analysis blinded to participant details. Within 1 to 2 days before microscopic examination, all stool samples were examined macroscopically for consistency, colour, and presence of adult worms. Helminths and protozoans were investigated by microscopy and molecular techniques.
Microscopic Investigation: Stool Concentration Method
Stool samples were processed following the formol-ether concentration technique for the presence of ova or cysts using the stool Ova/Parasite Concentration Kit (Epitope Diagnostics lnc., FPC200, USA) according to the manufacturer’s instructions. Briefly, approximately 1 g of stool was emulsified with 3% formalin using a vortex. Then 1 ml of ethyl acetate was added and mixed for 10 s by vortex. The stool sample was filtered by a mesh provided with the kit, then centrifuged at 300–350×g for 5 min. Sediment was collected and supernatant was decanted. The sediment stool was mixed with three drops of iodine (Logul’s solution, Sigma-Aldrich; Switzerland). The iodine-stained sediment was examined microscopically (Olympus BX53; Germany), under × 10 and × 40 magnification objectives.
Modified Ziehl–Neelsen Stain
Cold Ziehl–Neelsen stain (RAL Diagnostics, France) was used for the detection of coccidian species. All slides were examined by an expert microbiologist from the University as well as by a clinical microbiologist from Tawam hospital in Al Ain. Cryptosporidium infected slides were used as positive controls.
All tests were repeated three times for quality assurance by two independent microbiologists.
Molecular Investigation
DNA Extraction
The QIAamp DNA Stool Mini Kit (Qiagen, GmbH, Germany) was used for DNA extraction according to manufacturer’s instructions. Briefly, approximately 200 mg of stool was weighed in a two ml microcentrifuge tube. Stool lysing buffer was added to each sample. All samples were heated for 5 min at 70 °C then centrifuged at 14,000 rpm. The supernatant was pipetted into a two ml microcentrifuge tube. An inhibitEX tablet was added to each sample, after which they were centrifuged to pellet inhibitors bound to the InhibitEX matrix. Next, 200 µl of the supernatant was mixed with 15 µl proteinase-K in a 1.5 ml microcentrifuge tube. After this, 200 µl protein precipitating AL buffer was added and vortexed for 15 s. Samples were incubated at 70 °C for 10 min and 200 µl of 100% ethanol was added to the lysate and mixed well. Then, lysate was transferred to a QIAamp spin column and centrifuged for 1 min. Washing buffers AW1 and AW2 were added sequentially to remove salts. Finally, 200 µl of Elution buffer AE was added directly to the QIAamp membrane and incubated for 1 min at room temperature. Extracted DNA was stored at − 20 °C for genome amplification.
DNA Amplification
List of conventional–PCR primer sequences
| Target organism | Target gene | Oligonucleotide sequence 5′–3′ | Annealing tem. (°C) | Expected bp | Observed bp | Source | |
|---|---|---|---|---|---|---|---|
| Cryptosporidium spp. | 18S rRNA | F | ATGACGGGTAACGGGGAAT | 55 | 158 | 170 | [54] |
| R | CCAATTACAAAACCAAAAAGTCC | ||||||
| Entamoeba spp. | 18S rRNA | F | AAACGATGTCAACCAAGGATTG | 56 | 134 | 140 | [53] |
| R | TCCCCCTGAAGTCCATAAACTC | ||||||
| Taenia saginata | COX1 | F | GGTCATCCAGAGGTTTATG | 55 | 130 | 140 | [55] |
| R | CACACTATTGAAAACATAGCAAA | ||||||
| Taenia solium | pTsol9 repetitive element | F | CAGGGTGTGACGTCATGG | 55 | 120 | 150 | [56] |
| R | AGGAGGCCAGTTGCCTAGC | ||||||
| Trichuris trichuria | 18S | F | TTGAAACGACTTGCTCATCAACTT | 58 | 75 | 70 | [57] |
| R | CTGATTCTCCGTTAACCGTTGTC | ||||||
| Gardia lamblia | (16S-like) RNA | F | GACGGCTCAGGACAACGGTT | 55 | 62 | 70 | |
| R | TTGCCAGCGGTGTCCG | ||||||
| Ascaris lumbricoides | ITS1 | F | GCCACATAGTAAATTGCACACAAAT | 56 | 133 | 160 | [53] |
| R | GCCTTTCTAACAAGCCCAACAT | ||||||
| Enterobius vermicularis | 5S rRNA gene-IGS region | F | ACAACACTTGCACGTCTCTTC | 55 | 126 | 130 | [59] |
| R | TAATTTCTCGTTCCGGCTCA | ||||||
| Ancylostoma duodenale | ITS2 | F | GAATGACAGCAAACTCGTTGTTG | 57 | 70 | – | [60] |
| R | ATACTAGCCACTGCCGAAACGT | ||||||
| Necator americanus | ITS2 | F | CTGTTTGTCGAACGGTACTTGC | 57 | 100 | – | [60] |
| R | ATAACAGCGTGCACATGTTGC | ||||||
| Strongyloides stercoralis | Dispersed repetitive sequence | F | TCCAGAAAAGTCTTCACTCTCCAG | 58 | 85 | – | [53] |
| R | TGCGTTAGAATTTAGATATTATTGTTGCT | ||||||
| Cyclospora cayetanensis | 18S rRNA | F | TAGTAACCGAACGGATCGCATT | 55 | 100 | – | |
| R | AATGCCACGGTAGGCCAATA | ||||||
| Isospora belli | ITS2 | F | ATATTCCCTGCAGCATGTCTGTTT | 57 | 89 | – | [63] |
| R | CCACACGCGTATTCCAGAGA | ||||||
| Fasciola spp. | ITS2 | F | TTGGTACTCAGTTGTCAGTGTG | 57 | 139 | – | [64] |
| R | AGCATCAGACACATGACCAAG | ||||||
| Hymenolepis spp. | CO1 | F | TGGTTTTTTGTGCATCCTGAGGTTTA | 42 | 391 | – | [65] |
| R | AGAAAGAACGTAATGAAAATGAGCAAC | ||||||
Statistical Analysis
For the descriptive analyses, categorical variables are presented as frequencies and percentages and continuous variables are presented as mean ± standard deviation (SD). We quantified the prevalence of each tested IPs by the type of testing assay (microscopic or molecular), prevalence regardless of the testing assay for being positive for at least one of the tested IPs, and the overall prevalence for being positive for at least one IPs regardless of the testing assay.
The prevalence for being positive for at least one IP regardless of the testing assay, was also quantified according to the workers’ sociodemographic characteristics. Differences in IP prevalence were compared using the Chi square or Fisher’s exact tests. Odds ratio (OR) and adjusted OR were quantified using univariate and multivariate binary logistic regression analyses to assess the crude and adjusted strength of association between being positive for at least one of the tested IPs regardless of the testing assay with workers’ sociodemographic characteristics.
All analyses were conducted using SPSS version 25.0. An alpha value of ≤ 0.05 was considered to indicate statistical significance.
Results
Sociodemographic and Health Characteristics
Sociodemographic and lifestyle-related characteristics of surveyed workers and prevalence of at least one intestinal parasite by molecular and microscopy assays
| Characteristic | N | Valid % | Prevalence (tested = 86) | |||||
|---|---|---|---|---|---|---|---|---|
| Molecular | Microscopy | Any assay | ||||||
| Positivea | % | Positivea | % | Positiveb | % | |||
| All | 102 | 100 | 36 | 41.8 | 15 | 17.4 | 41 | 40.2 |
| Age (mean = 35.0 years) | ||||||||
| 20–29 | 29 | 28.7 | 8 | 22.2 | 4 | 28.6 | 9 | 22.5 |
| 30–39 | 41 | 40.6 | 18 | 50.0 | 6 | 42.9 | 19 | 47.5 |
| 40–50 | 23 | 22.8 | 7 | 19.4 | 4 | 28.6 | 9 | 22.5 |
| 50–56 | 8 | 7.9 | 3 | 8.3 | 0 | 0.0 | 3 | 7.5 |
| P value | 0.905 | 0.557 | 0.882 | |||||
| Missing | 1 | 1 | 1 | 1 | ||||
| Education | ||||||||
| Grade 5 or below | 20 | 19.8 | 11 | 30.6 | 5 | 35.7 | 12 | 30.0 |
| Grade 6–8 | 17 | 16.8 | 8 | 22.2 | 3 | 21.4 | 9 | 22.5 |
| Grade 9–10 | 32 | 31.7 | 8 | 22.2 | 3 | 21.4 | 9 | 22.5 |
| High school or above | 32 | 31.7 | 9 | 25.0 | 3 | 10 | 25.0 | |
| P-value | 0.154 | 0.457 | 0.115 | |||||
| Missing | 1 | 1 | 1 | 1 | ||||
| Gender | ||||||||
| Male | 99 | 97.1 | 35 | 97.2 | 14 | 93.3 | 2 | 95.1 |
| Female | 3 | 2.9 | 1 | 2.8 | 1 | 6.7 | 39 | 4.9 |
| P-value | 0.665c | 0.350c | 0.224c | |||||
| Marital status | ||||||||
| Ever married | 74 | 72.5 | 29 | 80.6 | 12 | 80.0 | 34 | 28.9 |
| Never married | 28 | 27.5 | 7 | 19.4 | 3 | 20.0 | 7 | 17.1 |
| P-value | 0.197c | 0.750c | 0.069c | |||||
| Ethnicity | ||||||||
| African | 13 | 12.9 | 7 | 19.4 | 1 | 6.7 | 7 | 17.1 |
| Arabic | 8 | 7.8 | 2 | 5.6 | 2 | 13.3 | 2 | 4.9 |
| Asian | 80 | 78.4 | 27 | 75.0 | 12 | 80.0 | 32 | 78.0 |
| P-value | 0.415 | 0.162 | 0.718 | |||||
| Place of residence in home country | ||||||||
| Rural | 47 | 46.1 | 17 | 47.2 | 11 | 73.3 | 20 | 48.8 |
| Urban | 55 | 53.9 | 19 | 52.8 | 4 | 26.7 | 21 | 51.2 |
| P-value | 0.221b | 0.090 | 0.829 | |||||
| Length of stay in UAE | ||||||||
| 0–5 years | 34 | 33.3 | 14 | 38.9 | 6 | 40.0 | 15 | 36.6 |
| 6–10 years | 30 | 29.4 | 11 | 30.6 | 5 | 33.3 | 14 | 34.1 |
| 11–20 years | 26 | 25.5 | 11 | 30.6 | 4 | 26.7 | 12 | 29.3 |
| > 20 years | 12 | 11.8 | 0 | 0.0 | 0 | 0.0 | 0 | 0.0 |
| P-value | 0.052 | 0.545 | 0.024 | |||||
| Accommodation | ||||||||
| Labor accommodation | 81 | 79.4 | 33 | 91.7 | 13 | 86.7 | 37 | 90.2 |
| Live alone | 5 | 4.9 | 1 | 2.8 | 1 | 6.7 | 2 | 4.9 |
| Live with a family | 16 | 15.4 | 2 | 5.6 | 1 | 6.7 | 2 | 4.9 |
| P-value | 0.303 | 0.632 | 0.152 | |||||
| Number of people sharing same room (mean = 5.78) | ||||||||
| 0–1 | 9 | 9.0 | 1 | 2.8 | 0 | 0.0 | 1 | 2.5 |
| 2–3 | 15 | 15.0 | 2 | 5.6 | 0 | 0.0 | 2 | 5.0 |
| 4–5 | 13 | 13.0 | 5 | 13.9 | 4 | 28.6 | 6 | 15.0 |
| ≥ 6 | 63 | 63.0 | 28 | 77.8 | 10 | 71.4 | 31 | 77.5 |
| P-value | 0.265 | 0.107 | 0.131 | |||||
| Missing | 2 | 1 | 1 | |||||
| Number of people sharing same toilet | 7.3 | |||||||
| ≤ 5 | 20 | 19.8 | 3 | 8.3 | 1 | 6.7 | 3 | 92.7 |
| > 5 | 81 | 80.2 | 33 | 91.7 | 14 | 93.3 | 38 | 0.121c |
| P-value | 0.227c | 0.380c | ||||||
| Missing | 1 | |||||||
| Frequency of eating unwashed food items | ||||||||
| Weekly | 5 | 5.1 | 4 | 11.1 | 1 | 6.7 | 4 | 9.8 |
| Monthly | 4 | 4.1 | 2 | 5.6 | 0 | 0.0 | 2 | 4.9 |
| Yearly | 7 | 7.1 | 3 | 8.3 | 2 | 13.3 | 4 | 9.8 |
| Never | 82 | 83.7 | 27 | 75.0 | 12 | 80.0 | 31 | 75.6 |
| P-value | 0.074 | 0.534 | 0.74 | |||||
| Missing | 4 | |||||||
| Most frequent source of food | ||||||||
| Arabia restaurant | 6 | 5.9 | 2 | 5.6 | 2 | 13.3 | 2 | 4.9 |
| Filipino restaurant | 5 | 5.0 | 3 | 8.3 | 0 | 0.0 | 3 | 7.3 |
| Home-based cooking | 73 | 72.3 | 26 | 72.2 | 11 | 73.3 | 31 | 75.6 |
| Indian restaurant | 15 | 14.9 | 5 | 13.9 | 2 | 13.3 | 5 | 12.2 |
| Mixed | 2 | 2.0 | 0 | 0.0 | 0 | 0.0 | 0 | 0.0 |
| P-value | 0.468 | 0.369 | 0.398 | |||||
| Missing | 1 | |||||||
| Same cutting board used for vegetables and meat | ||||||||
| No | 53 | 53.0 | 17 | 48.6 | 8 | 53.3 | 20 | 50.0 |
| Rarely | 47 | 47.0 | 18 | 51.4 | 7 | 46.7 | 20 | 50.0 |
| P-value | 0.427c | 0.541c | 0.835 | |||||
| Missing | 2 | 1 | 1 | |||||
| Last time traveled abroad of UAE | 45.0 | |||||||
| Within the last year | 44 | 43.6 | 14 | 40.0 | 9 | 60.0 | 18 | 55.0 |
| Within over a year | 57 | 56.4 | 21 | 60.0 | 6 | 40.0 | 22 | |
| P-value | 0.443c | 0.109c | 0.641 | |||||
| Missing | 1 | 1 | 1 | |||||
Health-related characteristics of surveyed workers and prevalence of at least one intestinal parasite by molecular and microscopy assays
| Characteristic | N | Valid % | Prevalence (tested = 86) | |||||
|---|---|---|---|---|---|---|---|---|
| Molecular | Microscopy | Any assay | ||||||
| Positivea | % | Positivea | % | Positiveb | % | |||
| Stool type | ||||||||
| 1 (separate hard lumps, like nuts) | 0 | 0 | – | – | – | – | – | – |
| 2 (sausage-shaped but lumpy) | 8 | 7.8 | 5 | 13.9 | 3 | 20.0 | 5 | 12.2 |
| 3 (like a sausage but with cracks on surface) | 22 | 21.6 | 7 | 19.4 | 2 | 13.3 | 8 | 19.5 |
| 4 (like a sausage or snake, smooth and soft) | 44 | 43.1 | 12 | 33.3 | 6 | 40.0 | 16 | 39.0 |
| 5 (soft blobs with clear-cut edges) | 8 | 7.8 | 3 | 8.3 | 1 | 6.7 | 3 | 7.3 |
| 6 (fluffy pieces with ragged edges, a mushy stool) | 17 | 16.7 | 7 | 19.4 | 3 | 20.0 | 7 | 17.1 |
| 7 (watery, no solid pieces. Entirely liquid) | 3 | 2.9 | 2 | 5.6 | 0 | 0.0 | 2 | 4.9 |
| P-value | 0.492 | 0.804 | ||||||
| Missing | ||||||||
| Craving for sugar | ||||||||
| Daily or weekly | 19 | 18.8 | 8 | 22.9 | 4 | 26.7 | 10 | 25.0 |
| Monthly or rarely | 57 | 56.4 | 18 | 51.4 | 7 | 46.7 | 20 | 50.0 |
| Never | 25 | 24.8 | 9 | 25.7 | 4 | 26.7 | 10 | 25.0 |
| P-value | 0.712 | 0.514 | ||||||
| Missing | 1 | 1 | 1 | |||||
| Anemia (mean Hb = 14.63) | ||||||||
| Not anemic (mean Hb = 14.85) | 87 | 90.6 | 28 | 84.8 | 14 | 93.3 | 33 | 86.8 |
| Anemic (mean Hb = 12.5) | 9 | 9.4 | 5 | 15.2 | 1 | 6.7 | 5 | 13.2 |
| P-value | 0.173b | 0.542b | 0.352 | |||||
| Missing | 6 | 3 | 3 | |||||
| Nutritional status (mean BMI = 25.75) | ||||||||
| Underweight (BMI < 18.5) | 3 | 3.0 | 2 | 5.6 | 4 | 26.7 | 15 | 36.6 |
| Normal weight (BMI = 18.5–24.9) | 40 | 39.6 | 15 | 41.7 | 1 | 6.7 | 2 | 4.9 |
| Overweight (BMI = 25.0–29.9) | 46 | 45.5 | 15 | 41.7 | 8 | 53.3 | 18 | 43.9 |
| Obese (BMI ≥ 30) | 12 | 11.9 | 4 | 11.1 | 2 | 13.3 | 6 | 14.6 |
| P-value | 0.793 | 0.692 | 0.593 | |||||
| Missing | 1 | |||||||
Microscopic Prevalence of IPs
Of the 102 surveyed workers, only 86 (84.3%) provided stool samples. Microscopically, seven species of IPs were identified in the tested stool samples (four helminths: T. trichiura, Taenia species, hookworm species and Hymenolepis species and three protozoans: Entamoeba coli, Entamoeba hartimani, Endolimax nana, Cryptosporidium species, and Giardia lamblia).
Descriptive of tested-positive parasitic infection according to the parasite-ascertainment assay (tested N = 86)
| Ascertainment assay | Tested positive parasite species or subspecies n (%) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Cryp. spp. | E. histolytica | Enta. spp. | Taenia spp. | T. trichuria | G. lamblia | Strongyloides stercoralis | Cyclospora cayetanensis | Isospora belli | Ascaris lumbricoides | Enterobius vermicularis | Fasciola hepatica | Hymenolepis nana | Hook worm | Positive for at least one parasite n (%) | |||
| T. Saginata | T. solium | Ancylostoma duodenale | Necator americanus | ||||||||||||||
| Microscopy | 3 (3.5) | 0 (0.0) | 7 (8.1) | 1 (1.1) | 2 (2.3) | 1 (1.1) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 1 (1.1) | 1 (1.1) | 15 (17.4) | ||
| Conventional PCR | 14 (16.3) | 0 (0.0) | 9 (10.5) | 4 (4.7) | 1 (1.1) | 2 (2.3) | 1 (1.1) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 5 (5.8) | 12 (14.0) | 0 (0.0) | NT | 0 (0.0) | 0 (0.0) | 36 (41.8) |
| Ziehl–Neelsen | 2 (2.3) | NA | NA | NA | NA | NA | NA | NA | NA | NA | NA | NA | NA | NA | NA | NA | 2 (2.3) |
| Positive by at least one assay | 16 (18.6) | 0 (0.0) | 13 (15.1) | 4 (4.7) | 1 (1.1) | 2 (2.3) | 1 (1.1) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 5 (5.8) | 12 (14.0) | 0 (0.0) | 1 (1.1) | 1 (1.1) | 41 (47.8)a | |
Helminthes eggs and protozoan cysts identified under microscope in tested stool samples. aHookworm, bTrichruis trichiura, cTaenia species egg identified in a stool using wet mount with iodine. dCryptosporidium species
Molecular Prevalence of IPs
Fifteen different pathogenic and non-pathogenic IPs species were tested positive by PCR. Nearly half (41.8%) of the tested expatriate workers were positive for at least one of the 15 identified IPs by conventional PCR. The most prevalent parasite was Cryptosporidium species (16.3%) followed by E. vermicularis (14.0%) and A. lumbricoides (5.8%). More than a quarter of expatriate workers were positive for intestinal protozoa (27.9%) and the same proportion tested positive for intestinal helminths (27.9%). Twenty-seven (31.4%) expatriate workers were found to be positive for only one IP, 13 (15.1%) were positive for any two, while only one (1.2%) expatriate worker was positive for any three of the 15 identified IPs.
Regardless of the IPs ascertainment assay, 47.8% of the expatriate workers were positive for at least one of the 15 identified IPs; 34.9% were positive for intestinal protozoa, and 12.8% were positive for intestinal helminths. Among these, 65.8% and 34.1% of expatriate workers had mono- and poly-parasitism, respectively. The most common IPs among the 41 expatriate workers with positive tests were Cryptosporidium species (39.0%), followed by Entamoeba species (31.7%), and Entrobious vermicularis (29.3%). Overall, of the 41 tested positive workers, 73.2% were positive for protozoa and 60.9% were positive for helminths (Table 4).
Agarose gel electrophoresis (2%) shows PCR products of intestinal parasites. Lanes 1 and 9: 50 basepair (pb) DNA ladder, lane 2: A. lumbricoides, lane 3: E. vermicularis, lane 4: T. saginata, lane 5: Gardia lamblia, lane 6: Trichuris trichuria, lane 7: Cryptosporidium spp. lane 8: Taenia solium, lane 10: Entamoeba spp.
Factors Associated with IPs
Characteristics associated with being positive for at least one intestinal parasite ascertained by conventional PCR and microscopy
| Characteristic | Molecular | Microscopy | Any assay |
|---|---|---|---|
| OR (95% CI) | OR (95% CI) | ||
| Age (mean = 34.96 years) | |||
| 20–29 | 1.00 | 1.00 | 1.00 |
| 30–39 | 1.50 (0.51–4.39) | 0.82 (0.20–3.28) | 1.37 (0.48–3.95) |
| 40–50 | 1.23 (0.33–4.50) | 1.39 (0.29–6.58) | 1.63 (0.45–5.82) |
| 50–56 | 1.31 (0.23–7.41) | – | 1.083 (0.19–6.06) |
| Education | |||
| Grade 5 or below | 1.00 | 1.00 | 1.00 |
| Grade 6–8 | 0.64 (0.16–2.48) | 0.60 (0.11–3.02) | 0.64 (0.16–2.56) |
| Grade 9–10 | 0.26 (0.07–0.89)* | 0.31 (0.06–1.52) | 0.28 (0.07–0.84) |
| High school or above | 0.41 (0.11–1.45) | 0.39 (0.08–192) | 0.39 (0.11–1.38) |
| Gender | |||
| Male | 1.00 | 1.00 | 1.00 |
| Female | 1.40 (0.08–23.15) | 5.00 (0.29–84.76) | – |
| Marital status | |||
| Ever married | 1.00 | 1.00 | 1.00 |
| Never married | 0.56 (0.20–1.57) | 0.68 (0.17–2.69) | 0.41 (0.15–1.15) |
| Ethnicity | |||
| African | 1.00 | 1.00 | 1.00 |
| Arabic | 0.71 (0.07–6.92) | 11.00 (0.65–187.16) | 0.71 (0.07–6.92) |
| Asian | 0.45 (0.13–1.56) | 2.27 (0.27–19.33) | 0.60 (0.17–2.08) |
| Place or residence in home country | |||
| Rural | 1.00 | 1.00 | 1.00 |
| Urban | 1.54 (0.66–3.67) | 0.35 (0.10–1.22) | 1.10 (0.47–2.56) |
| Length of time in UAE | |||
| 0–5 years | 1.00 | 1.00 | 1.00 |
| 6–10 years | 0.84 (0.29–2.41) | 0.95 (0.25–3.58) | 1.17 (0.41–3.34) |
| 11–20 years | 1.26 (0.41–3.84) | 0.94 (0.23–3.85) | 1.33 (0.43–4.10) |
| > 20 years | NA | NA | NA |
| Accommodation | |||
| Labor accommodation | 1.00 | 1.00 | 1.00 |
| Live alone | 0.61 (0.05–6.98) | 2.31 (0.19–27.39) | 1.95 (0.17–22.41) |
| Live with a family | 0.30 (0.06–1.53) | 0.51 (0.06–4.41) | 0.24 (0.05–1.22) |
| Number of people sharing same room (mean = 5.78) | |||
| ≥ 6 | 1.00 | 1.00 | 1.00 |
| 4–5 | 0.89 (0.25–3.26) | 2.74 (0.67–11.17) | 1.05 (0.29–3.81) |
| 2–3 | 0.31 (0.06–1.60) | NA | 0.25 (0.5–1.30) |
| 0–1 | 0.21 (0.02–1.95) | NA | 0.17 (0.02–1.56) |
| Number of people sharing same toilet | |||
| ≤ 5 | 1.00 | 1.00 | 1.00 |
| > 5 | 2.15 (0.53–8.74) | 2.33 (0.28–19.76) | 2.81 (0.69–11.45) |
| Frequency of eating unwashed food items | |||
| Weekly | 1.00 | 1.00 | 1.00 |
| Monthly | NA | NA | NA |
| Yearly | 0.38 (0.02–6.35) | 2.67 (0.16–45.11) | 1.00 (0.05–22.17) |
| Never | 0.15 (0.02–1.41) | 0.81 (0.08–7.80) | 0.19 (0.02–1.77) |
| Most frequent source eaten food | |||
| Arabia restaurant | 1.00 | 1.00 | 1.00 |
| Filipino restaurant | 3.0 (0.15–59.98) | NA | 3.00 (0.15–59.89) |
| Home-based cooking | 0.74 (0.09–5.62) | 0.22 (0.02–1.73) | 1.03 (0.13–7.82) |
| Indian restaurant | 0.56 (0.06–5.24) | 0.16 (0.01–1.96) | 0.55 (0.06–5.24) |
| Mixed | NA | NA | NA |
| Use same cutting board for vegetables and meat | |||
| No | 1.00 | 1.00 | 1.00 |
| Rarely | 1.20 (0.50–2.85) | 0.90 (0.29–2.76) | 1.10 (0.46–2.58) |
| Last time traveled abroad of UAE | |||
| Within the last year | 1.00 | 1.00 | 1.00 |
| Within over a year | 1.18 (0.49–2.83) | 0.42 (0.13–1.31) | 0.82 (0.34–1.93) |
| Stool type | |||
| 2 (sausage-shaped but lumpy) | 1.00 | 1.00 | 1.00 |
| 3 (like a sausage but with cracks on surface) | 0.26 (0.04–1.69) | 0.17 (0.02–1.36) | 0.32 (0.05–2.11) |
| 4 (like a sausage or snake, smooth and soft) | 0.20 (0.03–1.19) | 0.37 (0.05–1.51) | 0.32 (0.05–1.87) |
| 5 (soft blobs with clear-cut edges) | 0.30 (0.03–2.76) | 0.22 (0.02–2.97) | 0.30 (0.03–2.75) |
| 6 (fluffy pieces with ragged edges, a mushy stool) | 0.35 (0.05–2.41) | 0.33 (0.05–2.37) | 0.35 (0.05–2.41) |
| 7 (watery, no solid pieces. Entirely liquid) | 0.80 (0.04–14.6) | 0.80 (0.04–14.6) | |
| Craving for sugar | |||
| Daily or weekly | 1.00 | 1.00 | 1.00 |
| Monthly or rarely | 0.70 (0.23–2.14) | 0.57 (0.14–2.26) | 0.52 (0.17–1.60) |
| Never | 0.84 (0.23–3.05) | 0.76 (0.16–3.65) | 0.64 (0.18–2.31) |
| Anemia (mean Hb = 14.63) | |||
| Not anemic (mean Hb = 14.85) | 1.00 | 1.00 | 1.00 |
| Anemic (mean Hb = 12.5) | 2.68 (0.59–12.01) | 0.60 (0.07–5.30) | 2.02 (0.45–9.09) |
| Nutritional status (mean BMI = 25.75) | |||
| Normal weight (BMI = 18.5–24.9) | 1.00 | 1.00 | 1.00 |
| Underweight (BMI < 18.5) | 2.40 (0.20–29.13) | 3.63 (0.26–49.7) | 2.40 (0.19–29.1) |
| Overweight (BMI = 25.0–29.9) | 0.72 (0.28–1.84) | 1.81 (0.49–6.65) | 0.98 (0.39–2.48) |
| Obese (BMI ≥ 30) | 0.96 (0.22–4.22) | 2.07 (0.31–13.67) | 2.40 (0.51–11.3) |
Discussion
Findings from this study revealed a high prevalence of IPs in expatriate workers in an industrial district in Al Ain city, UAE. Almost half (47.8%) of workers were positive for at least one of the identified 15 tested intestinal helminths and protozoal parasites. The prevalence of the tested IPs was higher among workers with an educational attainment of grade 5 or below, from Asian countries, were living in rural settings in their home country, currently living in labour accommodation, sharing the same bedroom with ≥ 6 other workers, or sharing the same toilet with > 5 other people.
The microscopically observed overall prevalence (17.4%) of at least one of the identified IPs in the surveyed expatriate workers is 5.3-times higher than that observed in expatriate workers in Sharjah Emirate (UAE) in 2008 [40] and 2013 [36]. This prevalence is slightly higher than that reported in expatriates working in Saudi Arabia (14.9%) in 2013 [41]. In other studies in the UAE [40], Saudi Arabia [41], and Qatar [42], the IPs prevalence dropped to less than 10%, in long-term residents and expatriates. It is important to note there are foci in Saudi Arabia [27], Oman [43], and Yemen [44] that have a higher incidence of IPs naturally when compared to other parts of these countries. This may be due to geographical locations with tropical climates or rural, isolated areas.
Cryptosporidium infection cases were highest when detected by PCR (14 cases; 16.2%). However, only two samples were observed under the microscope most probably due to the low number of Cryptosporidium count in the stool. Cryptosporidium is the most common water-borne IP in the world and it causes severe diarrhoea [16]. However, the Cryptosporidium genus consists of at least 16 species, with two species, C. hominis and C. parvum, causing most cases of cryptosporidiosis in humans [45]. Cryptosporidium must have 50,000–500,000 oocysts in formed or semi-formed stool to be detected under the microscope [46]. Other Cryptosporidium species have been shown to cause illness in humans, including Cryptosporidium meleagridis, Cryptosporidium felis and Cryptosporidium canis [47], however, in our study we were only able to investigate the Cryptosporidium species and not the exact genus.
IPs have to reach a threshold to be visualised by microscopy and cause clinical or sub-clinical symptoms. Anaemic workers were 168% more likely to be positive for any of the detected IPs, based on only microscopic detection. Other IP-positive workers could be less likely to be classified as anaemic using pulse oximetry if they are smokers [48]. Pinworm is the second most common infection in human [49]. In our study, E. vermicularis was only detected by PCR in 12 cases; however, it was not found by microscopy or macroscopy. Most of E. vermicularis infections are asymptomatic and are commonly seen amongst school children. Microscopically, E. vermiculars eggs are rarely detected in stool because gravid females deposit eggs in a sticky film directly onto the perianal skin at night [50].
Entamoeba genus consist of many species, six of which (E. histolytica, E. dispar, E. moshkoviskii, E. coli, E. hartmani, and E. polki) reside in the human intestinal lumen. E. histolytica is the only pathogenic species that causes intestinal and extra intestinal amebiasis, this is a common parasitic cause of significant morbidity and mortality in developing countries which is usually transmitted from person to person through faecal–oral contaminated food or hands [51, 52]. In our study, all of the screened stool samples were negative for the E. histolytica using PCR. However, using more common primers that can amplify genomic materials of E. dispar, E. bangladishi, E. histolytica and E. moshkovskii [53], nine stool samples were positive. This higher than expected prevalence (10.5%) for non-pathogenic Entamoeba species is probably an indication of the poor personal hygiene habits and lifestyle among this sample of expatriate workers. Indeed, poor personal hygiene habits could potentially expose workers to more serious IPs and illnesses.
Except for the negative association between educational attainment and molecular-ascertainment for at least one of the identified IPs, none of the measured sociodemographic or health-related characteristics revealed significant associations regardless of the IP-ascertainment assay. This finding could be attributed to two potential reasons. Firstly, the study was underpowered to detect associations between these characteristics and IPs. Secondly, this might indicate that workers of different socio-demographic and health-related characteristics have an equal opportunity of exposure to IPs. This assumption is supported by the fact that all of the tested expatriate workers were selected from the same working place in the same industrial district where most of them (79.4%) lived in labor accommodation, 91.0% shared bed rooms with at least another two workers, and 80.2% of them shared toilets with > 5 other workers. Our study suggests potential clustering of intestinal parasitic infections amongst expatriate workers sharing the same bedroom and/or bathroom and future studies would do well to specifically explore the potential clustering of cases.
The present survey improved the reliability and validity of the results through the use of well-trained, native-speaking interviewers, standardized questionnaires, confidential anonymous interviews, and maintaining good communication between the research team and employers throughout the research process. The reliability and validity of identifying workers infected with or carrying IPs was improved through testing stool samples via well-trained and expert microbiologists using both microscopy and molecular assays. Moreover, the molecular assays used helped to quantify the burden of IPs not only in intensively infected workers, but also in workers who carried a low load of IPs that would not be able to be detected microscopically.
The present findings should be interpreted in view of several potential limitations. The cross-sectional design limits the observed association pathway between being positive for at least one IPs and education level. Testing expatriate workers from only one industrial area limits the generalizability of the findings to other workers in different emirates and even to the general population. Despite these limitations, the current findings advocate public health awareness and intervention campaigns to control IPs and promote public health, especially in migrant workers with low education levels originating from countries with a high prevalence of IPs.
Conclusion
Our sample of expatriate workers in Al Ain industrial district were burdened with a high prevalence of IPs. Concerted efforts to control IPs at the industrial district-level would help to protect multinational workers’ health and well-being. Moreover, public health programs targeting reducing IP prevalence have the potential to reduce unfavorable health consequences, increase worker’s productivity, and avoid the spread of IPs to the general public. Educational programs could be directed towards improving workers’ health education and in particular the importance of practicing a hygienic lifestyle. This study advocates for large scale studies to estimate the burden of IPs in the general UAE population at national and subnational levels.
Notes
Acknowledgements
Our grateful thanks go to all technical staff of the Parasitology Laboratory, Department of Microbiology and Immunology, especial thanks to Mr. Osama, from Tawam hospital, Al Ain.
Disclaimer
The contents of this report are solely the responsibility of the authors and do not necessarily represent the official views of UAE University.
Author Contributions
ZAL, TL, and MSH, conceptualized the study. All authors contributed to the questionnaire design. RHA, analysed and interpreted the data. RHA and ZAL drafted the manuscript. SH performed the microscopic and macroscopic testing. SA ran the molecular tests. MO managed data and collected anthropometric measures. All authors critically reviewed and approved the final version of the manuscript.
Funding
This work was supported by office of the Assistant Dean for Scientific Research and Graduate Studies, College of Medicine and Health Sciences, United Arab Emirates University (Seed Grant; January 2018), and partially supported by Office of Associate Provost for Research United Arab Emirates University Start-up grant (3M181-January 2014).
Compliance with Ethical Standards
Conflict of interest
The research team declares that there is no conflict of interests.
Ethical Approval
The study protocol was approved by the “Al Ain Medical District Human Research Ethics Committee Institutional Research Ethical Review Committee of the College of Medicine and Health Sciences, UAE University (ERH_2016_5479; 23rd February, 2017). The workplace owner consented to the company participating in the research project and written informed consent was obtained from all workers that voluntarily consented to participate in the study, after a full explanation about the objectives and methodology of the survey.
References
- 1.World Health Organization. Prevention and control of schistosomiasis and soil-transmitted helminthiasis: report of a WHO expert committee. (2002). http://www.who.int/intestinal_worms/resources/who_trs_912/en/.
- 2.Efstratiou A, Ongerth JE, Karanis P. Waterborne transmission of protozoan parasites: review of worldwide outbreaks—an update 2011–2016. Water Res. 2017;14:14–22.CrossRefGoogle Scholar
- 3.Pullan RL, Smith JL, Jasrasaria R, Brooker SJ. Global numbers of infection and disease burden of soil transmitted helminth infections in 2010. Parasit Vectors. 2014;7:37.PubMedPubMedCentralCrossRefGoogle Scholar
- 4.World Health Organization. Soil-transmitted helminth infections. 2018. http://www.who.int/news-room/fact-sheets/detail/soil-transmitted-helminth-infections.
- 5.Bethony J, Brooker S, Albonico M, Geiger SM, Loukas A, Diemert D, et al. Soil-transmitted helminth infections: ascariasis, trichuriasis, and hookworm. Lancet. 2006;367(9521):1521–32.PubMedCrossRefGoogle Scholar
- 6.Jasti A, Ojha SC, Singh YI. Mental and behavioral effects of parasitic infections: a review. Nepal Med Coll J. 2007;9(1):50–6.PubMedGoogle Scholar
- 7.Stephenson LS, Latham MC, Ottesen EA. Malnutrition and parasitic helminth infections. Parasitology. 2000;121(Suppl):S23–38.PubMedCrossRefGoogle Scholar
- 8.Simsek Z, Zeyrek FY, Kurcer M. Effect of Giardia infection on growth and psychomotor development of children aged 0–5 years. J Trop Pediatr. 2004;50(2):90–3.PubMedCrossRefGoogle Scholar
- 9.Farthing MJ, Mata L, Urrutia JJ, Kronmal RA. Natural history of Giardia infection of infants and children in rural Guatemala and its impact on physical growth. Am J Clin Nutr. 1986;43(3):395–405.PubMedCrossRefGoogle Scholar
- 10.Jukes M, Nokes C, Alcock KJ, Lambo JK, Kihamia C, Ngorosho N, et al. Heavy schistosomiasis associated with poor short-term memory and slower reaction times in Tanzanian schoolchildren. Trop Med Int Health. 2002;7(2):104–17.PubMedCrossRefGoogle Scholar
- 11.Fried B, Reddy A, Mayer D. Helminths in human carcinogenesis. Cancer Lett. 2011;305(2):239–49.PubMedCrossRefGoogle Scholar
- 12.Herrera LA, Ostrosky-Wegman P. Do helminths play a role in carcinogenesis? Trends Parasitol. 2001;17(4):172–5.PubMedCrossRefGoogle Scholar
- 13.Blackwell AD, Tamayo MA, Beheim B, Trumble BC, Stieglitz J, Hooper PL, et al. Helminth infection, fecundity, and age of first pregnancy in women. Science. 2015;350(6263):970–2.PubMedPubMedCentralCrossRefGoogle Scholar
- 14.Adegnika AA, Agnandji ST, Chai SK, Ramharter M, Breitling L, Kendjo E, et al. Increased prevalence of intestinal helminth infection during pregnancy in a Sub-Saharan African community. Wien Klin Wochenschr. 2007;119(23–24):712–6.PubMedCrossRefGoogle Scholar
- 15.Dubey J, Jones J. Toxoplasma gondii infection in humans and animals in the United States. Int J Parasitol. 2008;38(11):1257–78.PubMedCrossRefGoogle Scholar
- 16.Centers for Disease Control and Prevention (CDC). Cryptosporidiosis—fact sheets—infection—general public, <https://www.cdc.gov/parasites/crypto/gen_info/infect.html> (2009).
- 17.Savioli L, Smith H, Thompson A. Giardia and Cryptosporidium join the ‘neglected diseases initiative’. Trends Parasitol. 2006;22(5):203–8.PubMedCrossRefGoogle Scholar
- 18.World Health Organization. Health Topics, Diarrhoea. http://www.who.int/topics/diarrhoea/en/ (Accessed Nov 1 2018).
- 19.Millard PS, Gensheimer KF, Addiss DG, Sosin DM, Beckett GA, Houck-Jankoski A, et al. An outbreak of cryptosporidiosis from fresh-pressed apple cider. JAMA. 1994;272(20):1592–6.PubMedCrossRefGoogle Scholar
- 20.Iarotski L, Davis A. The schistosomiasis problem in the world: results of a WHO questionnaire survey. Bull World Health Organ. 1981;59(1):115.PubMedPubMedCentralGoogle Scholar
- 21.Blair I, Sharif AA. Population structure and the burden of disease in the United Arab Emirates. J Epidemiol Glob Health. 2012;2(2):61–71.PubMedCrossRefGoogle Scholar
- 22.Arfaa F. Intestinal parasites among Indochinese refugees and Mexican immigrants resettled in Contra Costa County, California. J Fam Pract. 1981;12(2):223–6.PubMedGoogle Scholar
- 23.Salas SD, Heifetz M, Barrett-Connor M. Intestinal parasites in central American immigrants in the United States. Arch Intern Med. 1990;150:1514–6.PubMedCrossRefGoogle Scholar
- 24.Varkey P, Jerath AU, Bagniewski S, Lesnick T. Intestinal parasitic infection among new refugees to Minnesota, 1996–2001. Travel Med Infect Dis. 2007;5(4):223–9.PubMedCrossRefGoogle Scholar
- 25.Abu-Madi MA, Behnke JM, Ismail A. Patterns of infection with intestinal parasites in Qatar among food handlers and housemaids from different geographical regions of origin. Acta Trop. 2008;106(3):213–20.PubMedCrossRefGoogle Scholar
- 26.Wang L-C. Parasitic infections among Southeast Asian labourers in Taiwan: a long-term study. Epidemiol Infect. 1998;120(1):81–6.PubMedPubMedCentralCrossRefGoogle Scholar
- 27.Al-Shammari S, Khoja T, El-Khwasky F, Gad A. Intestinal parasitic diseases in Riyadh, Saudi Arabia: prevalence, sociodemographic and environmental associates. Trop Med Int Health. 2001;6(3):184–9.PubMedCrossRefGoogle Scholar
- 28.Loney T, Aw TC, Handysides DG, Ali R, Blair I, Grivna M, et al. An analysis of the health status of the United Arab Emirates: the ‘Big 4’ public health issues. Glob Health Action. 2013;6:20100.PubMedCrossRefGoogle Scholar
- 29.Unicef. MIGRATION PROFILES [REPORT]. 2014 [updated 09.10.2016; cited 2018 JULY]. Available from: https://esa.un.org/miggmgprofiles/indicators/files/UAE.pdf.
- 30.Labor Migration in the United Arab Emirates: Challenges and Responses 2013 [updated 2013-09-18. Available from: http://www.migrationpolicy.org/article/labor-migration-united-arab-emirates-challenges-and-responses.
- 31.Cross J, Basaca-Sevilla V. Intestinal parasitic infections in Southeast Asia. Southeast As J Trop Med Public Health. 1981;12(2):262–74.Google Scholar
- 32.Ward HD. Intestinal protozoal parasites and diarrheal disease in Bangladesh. Chicago: The University of Chicago Press; 2009.CrossRefGoogle Scholar
- 33.Abubakar I, Tillmann T, Banerjee AJL. Global, regional, and national age-sex specific all-cause and cause-specific mortality for 240 causes of death, 1990-2013: a systematic analysis for the global burden of disease study 2013. Lancet. 2015;385(9963):117–71.CrossRefGoogle Scholar
- 34.Expatriate Population of the UAE in 2018. https://www.globalmediainsight.com/blog/uae-population-statistics/#expat_population (Accessed Oct 2 2018).
- 35.Qureshy F. Comparative study of intestinal parasitic infestation among food handlers in Abu Dhabi (U.A.E.) 1981-1982. J Pak Med Assoc. 1988;38(6):163–6.PubMedGoogle Scholar
- 36.Dafalla AIA, Almuhairi S, AlHosani MHJ, Mohamed MY, Alkous MIA, AlAzzawi MA, et al. Intestinal parasitic infections among expatriate workers in various occupations in Sharjah, United Arab Emirates. Rev Inst Med Trop Sao Paulo. 2017;59:e82.PubMedPubMedCentralCrossRefGoogle Scholar
- 37.Blake MR, Raker JM, Whelan K. Validity and reliability of the Bristol Stool Form Scale in healthy adults and patients with diarrhoea-predominant irritable bowel syndrome. Aliment Pharmacol Ther. 2016;44(7):693–703.PubMedCrossRefGoogle Scholar
- 38.World Health Organization. Haemoglobin concentrations for the diagnosis of anaemia and assessment of severity. http://www.who.int/vmnis/indicators/haemoglobin.pdf.
- 39.World Health Organization. Body mass index—BMI. http://www.euro.who.int/en/health-topics/disease-prevention/nutrition/a-healthy-lifestyle/body-mass-index-bmi.
- 40.Dash N, Al-Zarouni M, Anwar K, Panigrahi D. Prevalence of intestinal parasitic infections in Sharjah, United Arab Emirates. Hum Paras Dis. 2010;2:21–4.CrossRefGoogle Scholar
- 41.Taha HA, Soliman MI, Banjar SA. Intestinal parasitic infections among expatriate workers in Al-Madina Al-Munawarah, Kingdom of Saudi Arabia. Trop Biomed. 2013;30(1):78–88.PubMedGoogle Scholar
- 42.Abu-Madi MA, Behnke JM, Doiphode SH. Intestinal parasitic infections among long-term-residents and settled immigrants in Qatar in the period 2005 to 2011. Am J Trop Med Hyg. 2013;88(6):1185–95.PubMedPubMedCentralCrossRefGoogle Scholar
- 43.Idris MA, Ruppel A, De Carneri I, Shaban MA, Al-Awfy SA, Jayawardene CR, et al. High prevalence and intensity of hookworm infection in the Dhofar Governorate, Oman. Ann Trop Med Parasitol. 1993;87(4):421–4.PubMedCrossRefGoogle Scholar
- 44.Alyousefi NA, Mahdy MA, Mahmud R, Lim YA. Factors associated with high prevalence of intestinal protozoan infections among patients in Sana’a City, Yemen. PLoS ONE. 2011;6(7):e22044.PubMedPubMedCentralCrossRefGoogle Scholar
- 45.Xiao L, Fayer R, Ryan U, Upton SJ. Cryptosporidium taxonomy: recent advances and implications for public health. Clin Microbiol Rev. 2004;17(1):72–97.PubMedPubMedCentralCrossRefGoogle Scholar
- 46.Weber R, Bryan RT, Bishop HS, Wahlquist SP, Sullivan JJ, Juranek DD. Threshold of detection of Cryptosporidium oocysts in human stool specimens: evidence for low sensitivity of current diagnostic methods. J Clin Microbiol. 1991;29(7):1323–7.PubMedPubMedCentralGoogle Scholar
- 47.Xiao L, Bern C, Limor J, Sulaiman I, Roberts J, Checkley W, et al. Identification of 5 types of Cryptosporidium parasites in children in Lima, Peru. J Infect Dis. 2001;183(3):492–7.PubMedCrossRefGoogle Scholar
- 48.Nordenberg D, Yip R, Binkin NJ. The effect of cigarette smoking on hemoglobin levels and anemia screening. JAMA. 1990;264(12):1556–9.PubMedCrossRefGoogle Scholar
- 49.Goldmann DA, Wilson CM. Pinworm infestations. In Primary pediatric care. 3rd ed. St Louis: Mosby; 1997.Google Scholar
- 50.Hashmey R, Genta RM, White AC Jr. Parasites and diarrhea. II: helminths and diarrhea. J Travel Med. 1997;4(2):72–5.PubMedCrossRefGoogle Scholar
- 51.Haque R, Huston CD, Hughes M, Houpt E, Petri WA Jr. Amebiasis. N Engl J Med. 2003;348(16):1565–73.PubMedCrossRefGoogle Scholar
- 52.Shirley DT, Farr L, Watanabe K, Moonah S. A review of the global burden, new diagnostics, and current therapeutics for amebiasis. Open Forum Infect Dis. 2018;5(7):161.CrossRefGoogle Scholar
- 53.Liu J, Gratz J, Amour C, Nshama R, Walongo T, Maro A, et al. Optimization of quantitative PCR methods for enteropathogen detection. PLoS One. 2016;11(6):e0158199.PubMedPubMedCentralCrossRefGoogle Scholar
- 54.Jothikumar N, da Silva AJ, Moura I, Qvarnstrom Y, Hill VR. Detection and differentiation of Cryptosporidium hominis and Cryptosporidium parvum by dual TaqMan assays. J Med Microbiol. 2008;57(Pt 9):1099–105.PubMedCrossRefGoogle Scholar
- 55.Cuttell L, Owen H, Lew-Tabor AE, Traub RJ. Bovine cysticercosis—development of a real-time PCR to enhance classification of suspect cysts identified at meat inspection. Vet Parasitol. 2013;194(1):65–9.PubMedCrossRefGoogle Scholar
- 56.Yera H, Dupont D, Houze S, et al. Confirmation and follow-up of neurocysticercosis by real-time PCR in cerebrospinal fluid samples of patients living in France. J Clin Microbiol. 2011;49(12):4338–40.PubMedPubMedCentralCrossRefGoogle Scholar
- 57.Liu J, Gratz J, Amour C, et al. A laboratory-developed TaqMan Array Card for simultaneous detection of 19 enteropathogens. J Clin Microbiol. 2013;51(2):472–80.PubMedPubMedCentralCrossRefGoogle Scholar
- 58.Verweij JJ, Blange RA, Templeton K, et al. Simultaneous detection of Entamoeba histolytica, Giardia lamblia, and Cryptosporidium parvum in fecal samples by using multiplex real-time PCR. J Clin Microbiol. 2004;42(3):1220–3.PubMedPubMedCentralCrossRefGoogle Scholar
- 59.Ogren J, Dienus O, Lofgren S, Iveroth P, Matussek A. Dientamoeba fragilis DNA detection in Enterobius vermicularis eggs. Pathog Dis. 2013;69(2):157–8.PubMedPubMedCentralCrossRefGoogle Scholar
- 60.Basuni M, Muhi J, Othman N, et al. A pentaplex real-time polymerase chain reaction assay for detection of four species of soil-transmitted helminths. Am J Trop Med Hyg. 2011;84(2):338–43.PubMedPubMedCentralCrossRefGoogle Scholar
- 61.Sulaiman IM, Ortega Y, Simpson S, Kerdahi K. Genetic characterization of human-pathogenic Cyclospora cayetanensis parasites from three endemic regions at the 18S ribosomal RNA locus. Infect Genet Evol. 2014;22:229–34.PubMedCrossRefGoogle Scholar
- 62.Murphy HR, Lee S, da Silva AJ. Evaluation of an improved US Food and Drug Administration method for the detection of Cyclospora cayetanensis in produce using real-time PCR. J Food Protect. 2017;80(7):1133–44.CrossRefGoogle Scholar
- 63.ten Hove RJ, van Lieshout L, Brienen EA, Perez MA, Verweij JJ. Real-time polymerase chain reaction for detection of Isospora belli in stool samples. Diagn Microbiol Infect Dis. 2008;61(3):280–3.PubMedCrossRefGoogle Scholar
- 64.Alasaad S, Soriguer RC, Abu-Madi M, et al. A TaqMan real-time PCR-based assay for the identification of Fasciola spp. Vet Parasitol. 2011;179(1–3):266–71.PubMedCrossRefGoogle Scholar
- 65.Okamoto M, Agatsuma T, Kurosawa T, Ito A. Phylogenetic relationships of three hymenolepidid species inferred from nuclear ribosomal and mitochondrial DNA sequences. Parasitology. 1997;115(Pt 6):661–6.PubMedCrossRefGoogle Scholar
Copyright information
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.