Journal of Chemical Ecology

, Volume 33, Issue 4, pp 861–869 | Cite as

Species-specific Expression of Major Urinary Proteins in the House Mice (Mus musculus musculus and Mus musculus domesticus)

  • R. Stopková
  • P. Stopka
  • K. Janotová
  • P. L. Jedelský
Article

Abstract

The analysis of expression of pheromone-carrying major urinary proteins (MUPs) from two subspecies of house mice (Mus m. musculus, Mus m. domesticus) was studied. It has been previously shown that commensal populations of the two subspecies can discriminate on the basis of urinary signals. MUPs are predominant urinary proteins that protect pheromones from rapid degradation in a hydrophilic environment, and individuals of M. m. musculus tend to rely on these urinary cues in the process of subspecies discrimination more than M. m. domesticus individuals. Although it is not precisely known what triggers phenotypic and epigenetic changes of MUP expression, our results show that in the subspecies M. m. musculus, sex is a significant factor influencing variations in the regulation of selected MUPs in the liver. Furthermore, male M. m. musculus individuals expressed all the studied MUPs’ mRNA significantly more than females or individuals of either sex in M. m. domesticus. Correspondingly, the pattern of mRNA abundance was corroborated with the level of total MUP concentration in the urine, such that the level of sexual dimorphism was also significant and species-specific. Our finding introduces a hypothesis that quantitative variation of these proteins may be an essential part of a subspecies recognition system that maintains homospecific mixing.

Keywords

Gene expression MUP Sexual dimorphism Mus 

Introduction

The urine of M. musculus Linnaeus, 1758 contains large quantities of acidic protein isoforms called major urinary proteins (MUPs) with a molecular mass 18–19 kDa (Cavaggioni and Mucignat-Caretta, 2000). These proteins are synthesized in the liver and released through the kidney into the urine. Although, the production of MUPs indicates that it must have advantages, little is known about the constraints that have shaped the evolution of expression differences of this protein family. In M. m. domesticus, Schwartz & Schwartz, 1943, it has been repeatedly shown that MUPs carry volatile nonpolar pheromones in their hydrophobic pocket (Bacchini et al., 1992; Žídek et al., 1999). The combination of volatile pheromones and their protein carriers may facilitate individual/status recognition and estrus synchronization through a slow release of these ligands from proteins when the urine mark is deposited (Hurst et al., 1998, 2001; Novotny et al., 1999; Marchlewska-Koj et al., 2000). Therefore, these proteins are advantageous for an individual, as the essential information on sex and status is present even in the absence of the territory owner (Hurst et al., 2001). In addition to the information on genetic relatedness that is manifested by the highly polymorphic major histocompatibility complex (MHC), MUPs are important in their ability to reveal temporal individual-status information. If common androgen regulators correlate with the temporal individual status, they may also constitute a method of honest signaling.

One of the remarkable characteristics that have emerged from the study of MUPs is their diversity. This variation is largely caused by single nucleotide and/or single codon mutations (Robertson et al., 1996; Beynon et al., 2002). MUPs are the product of a multigene family of approximately 30 genes and pseudogenes located on chromosome 4 (Bishop et al., 1982). Their expression is largely sex-dependent, such that males produce more than females do (Wicks, 1941), with the pattern and amount probably regulated by testosterone, growth hormone, and thyroid hormone levels (Knopf et al., 1983). For example, females injected with testosterone produce amounts of MUPs similar to those of their male counterparts (Cavaggioni and Mucignat-Caretta, 2000). Sequence variations and different expression patterns have been reported for various laboratory strains (Finlayson et al., 1965), and it is likely that these differences represent polymorphisms that have been detected in wild populations (Pes et al., 1999; Robertson et al., 1997). What has yet to be determined is the species-specific expression pattern of MUPs in wild mice of the genus Mus and to what extent these “expression profiles” may influence or represent a signal for either species recognition and/or a sexually selected behavior. Such testing may further the understanding of natural hybridization between the two subspecies under study.

To further elucidate whether major urinary proteins in mice are a product of sexual selection, we tested the hypothesis that differences between male and female expression patterns are greater than differences between the two subspecies. Sampsell and Held (1985) discovered—with an application of a technique known as dot-blot—little variation in MUP mRNA quantity between male and female M. m. domesticus but larger differences in M. m. musculus. Our study aimed for a more precise quantification of the expression variation in wild caught mice of both subspecies. Our model organisms, M. m. musculus and M. m. domesticus, recolonized Europe after glaciation and formed a narrow hybrid zone about 20 km wide spanning across Europe from Denmark to Bulgaria. Regarding their ecology, populations of both subspecies live commensally (i.e., syn-anthropically), and to date no published data suggest that there are significant ecological differences between them (Boursot et al., 1993). The rationale for testing this hypothesis is highlighted by the fact that it would be advantageous for an individual to recognize individuals of the same species and those of another to avoid potential problems with F1 hybrid sterility. One can envisage two likely, yet understudied, scenarios: (1) MUP quantity and expression pattern are a product of sexual selection and, therefore, females choose males on the basis of their MUP-related smell, regardless of the species, or (2) MUP signals are a trait under purifying selection and form an efficient species-specific barrier to diminish the cost of producing sterile litters. The former scenario could partially explain an introgression of several domesticus genes into musculus populations (Munclinger et al., 2002) as a consequence of such a recognition error, whereas the latter scenario may partially explain why the narrow hybrid zone is relatively stable. Our approach in analyzing MUP expression profiles combines real-time polymerase chain reaction (PCR) of unique mRNA/cDNA sequences and densitometry analysis of isolated urinary MUPs run on polyacrylamide gel electrophoresis under denaturating condition (i.e., SDS-PAGE).

Methods and Materials

Subjects

Eighty-three reproductively active (approximately 70-d-old) mice were used. Different mice were used for the isolation of mRNA (29 individuals, i.e., M. m. domesticus—eight males + seven females, M. m. musculus—eight males + six females) and for the urine collection (54 individuals, i.e., M. m. domesticus—12 males + 14 females, M. m. musculus—15 males + 13 females). The mice were trapped at three domesticus sites in Germany (i.e., Straas, Neunreuth, and Wuppertall), and at six musculus sites in the Czech Republic (i.e., Sedlecko, Vintirov, Praha, Brandys, Studenec, and Svetla Hora).

RNA Isolation and cDNA Synthesis

Total RNA from a 50-mg liver tissue was extracted with ToRNAzol reagent (GeneAge Technologies, a.s., Prague, Czech Republic) according to the manufacturer’s protocol. The purity of RNA was assessed from the ratio of the optical densities at 260 and 280 nm, and the integrity was controlled by electrophoresis on 1% agarose gel containing ethidium bromide.

Five micrograms of total RNA were used for synthesis of single-stranded cDNA according to a first-strand cDNA synthesis protocol (Fermentas UAB, Vilnius, Lithuania) with RevertAid™ M-MulV Reverse Transcriptase and oligo(dT)18 primer. To minimize variation in the reverse transcription, all RNA samples were reverse-transcribed simultaneously.

Quantitative Real-Time PCR

The resultant cDNA was amplified with PCR by using primers given in Table 1. The target sequences belong to the six most abundant MUP variants in mice (Shahan et al., 1987). Amplified PCR products were consequently sequenced to ensure correct priming with the target sequences of given MUPs. Real-time PCR was performed in a Rotor-Gene 2000 from Corbett Research by using the SYBR® Green detection method. Total reaction volume was 25 μl of buffer solution containing 1 μl of cDNA sample, 3 mM MgCl2, 0.2 mM dNTP, SYBR® Green 1: 25,000, 0.4 U/μl taq polymerase, and 0.2 μM primers. PCR amplifications were always performed in duplicate wells under the following conditions: 2 min at 95°C, then 30 repetitive cycles: 30 sec at 95°C, 30 sec at 56°C, 30 sec at 72°C, and an additional fourth step of 15 sec at 82°C where the fluorescent data were collected to avoid any nonspecific signals derived by eventual primer dimers or unspecific minor product (Pfaffl, 2003). This fourth step ensures accurate quantification of desired product, and the appropriate product compound is checked in all samples by the melting analysis. The beta-2-microglobulin, out of five tested housekeeping genes, was assayed as a normalization control to correct any loading discrepancies (Bustin, 2000; 2002), and hypoxanthine phosphoribosyltransferase (HPRT) was used as a control gene for each individual. Control reactions with “RT minus template” did not produce significant amplification product (Vandesompele et al., 2002).
Table 1

A set of specific primers that were used for the real-time amplification of given products

UniSTS Name

Forward Primer (5′-3′)

Reverse Primer (5′-3′)

Product Size (bp)

MUP1

AATGCCAATCGCTGCC

GCTCCGAATTATCTATGGTTGC

430

MUP2

ATTAATGGGGAATGGCATACTA

GGATTCCATGCTCCTCACAT

388

MUP3

GCAAGTGTAATCATTTATTGAACAGG

ATGGAGCTCTATGGCCGAG

407

MUP4

TTCCGATCGATACAGCATTG

TTGAACAGGAAGAGGAAGCAA

189

MUP5

TGGCACCATGAGAGTTTTTG

CACTGGAGGCTCAAACCATT

404

Beta 2-microglobulin

AGTCTTTCTGGTGCTTGTCTCA

TATCAGTCTCAGTGGGGGTGA

248

HPRT*

CCTCATGGACTGATTATGGACA

AGTTGAGAGATCATCTCCACCA

239

*Hypoxanthine phosphoribosyltransferase

Relative quantitation of target gene expression was evaluated by using the comparative Ct method (Giulietti et al., 2001) by determining the cycle threshold (Ct) based on the fluorescence detected within the geometric region of the semilog view of the amplification plot. The ΔCt value was determined by subtracting the target Ct of each sample from its respective beta-2-microglobulin Ct value. Calculation of ΔΔCt involves using the highest sample ΔCt value as an arbitrary constant to subtract from all other ΔCt sample values. Fold changes in gene expression of the target gene are equivalent to \( 2^{{ - \Delta \Delta _{{{\text{Ct}}}} }} \) (Livak and Schmittgen, 2001). Relative fold change (i.e., a change in an order of magnitude), therefore, represents an exponent value, whereas the threshold value of the amplification cycle (i.e., Ct) ensures that the levels are measured at a linear range.

Protein Analysis

Urine was collected by a gentle bladder massage and frozen at −20°C. The volume of 0.2 μl of male and 0.4 μl of female urine, respectively, was used for protein analysis. SDS-polyacrylamide gel electrophoresis was performed on Mini-PROTEAN III Electrophoresis System (BioRad Laboratories, Hercules, CA, USA) according to modified protocol by Laemmli (1970). To avoid potential errors caused by a loading inaccuracy, we used Carbonic Anhydrase (29 kDa) marker for SDS-PAGE (Sigma-Aldrich, St. Louis, MO, USA) as standard. Thirteen microliters of sample buffer (containing 1,000 ng of carbonic anhydrase) were added to each sample. The gels were stained with Coomassie® G-250 (SimplyBlue™ Safe Stain, Invitrogen Life Technologies, Paisley, UK). The gel images were acquired by using Gel Doc XRS, and Quantity One 1-D Analysis Software (BioRad Laboratories, Hercules, CA, USA) was used for the densitometry analysis. The total urinary MUP concentrations were calculated from the adjusted volumes that were obtained after corrections by using carbonic anhydrase of known volumes as internal standards.

Statistical Analysis

As the mRNA expression and protein concentration were collected from different individuals, we performed two separate analyses. General Linear Model (GLM-Factorial ANOVA) was used to test for dependences on two categorical variables (sex and species). Two separate models were used for detecting differences on the level of mRNA abundance or the level of protein.

Results

Quantitative analysis of mRNA expression by using real-time PCR techniques traditionally employs reference or housekeeping genes to control any errors between samples. To ensure the robustness of our housekeeping system of normalization, we used two reference genes. Beta-2-microglobulin was used as a primary housekeeping gene for this system (i.e., housekeeping by which all other genes including second housekeeping—HPRT—were normalized). Main effects ANOVA revealed that none of the tested factors (i.e., species, individual, sex) had significant effects on the variation of the mRNA abundance of a second housekeeping gene HPRT that was normalized by the first one (MANOVA, factor sex: F = 0.931, df = 1, P = 0.34; species F = 0.59, df = 1, P = 0.45; sex × species F = 0.6, df = 1, P = 0.43). Thus, the following expression variations represent biologically relevant differences.

Predominant urinary MUPs, originally described as MUP1, 2, 3, and 5, are abundant in the liver in both M. m. musculus and M. m. domesticus. The factorial MANOVA revealed that the major source of variation in mRNA abundance is influenced by sex (F = 8.38, df = 1, P = 0.005), sex × species (F = 6.02, df = 1, P = 0.016), species (F = 5.55, df = 1, P = 0.02), and also marginally by genes (F = 2.8, df = 3, P = 0.042) because of a lower activity of MUP5. Post hoc Tukey HSD test further revealed that the major source of variation was differences in mRNA abundance between M. m. musculus males and females (df = 99, P = 0.003) as well as differences (df = 99, P < 0.002) between M. m. musculus males and individuals of both sexes belonging to M. m. domesticus (Fig. 1). The major result of this analysis, therefore, is the finding that sexual dimorphism in the expression of selected MUP RNAs is species-specific.
Fig. 1

Subspecies differences in normalized mRNA abundance between M. m. domesticus and M. m. musculus. Circles connected by a solid line represent differences in mean between males, squares connected by a dashed line represent differences in mean between females with error bars representing confidence intervals (α = 0.05)

Sexual dimorphism and species specificity of MUP expression was further tested by using calibrated densitometry analysis of total MUPs present in the urine. Correct assignment of an ∼18-kDa band as a MUP was confirmed by isoelectric focusing and Western blotting (data not shown) using goat anti-mouse MUP serum (YN-GMMUP, Accurate Chemical & Scientific Corporation, Westbury, NY, USA) as a primary antibody. For this antibody, characteristic precipitin lines are obtained against normal mouse urine and purified mouse MUP, and gives a reaction of full intensity. The result of this analysis is depicted in Fig. 2 and demonstrates that the pattern of sexual dimorphism is significant (F = 154.5, df = 1, P < 0.001) and species-specific (F = 13.7, df = 1, P < 0.001). Our analysis further revealed that MUP production was slightly higher in estrus females, but this trend was not significant (Wilcoxon paired t test: Z = 1.153, df = 1, P = 0.248). However, it is obvious from Fig. 2 that such influence is of limited value as a result of nonoverlapping confidence intervals in each category. It is also worth pointing out that our analysis revealed significant differences between M. m. domesticus males and females where other studies have reported no variation (Sampsell and Held, 1985).
Fig. 2

Subspecies-specific sexual dimorphism in the concentration of major urinary proteins. Circles connected by a solid line represent differences in mean between males, squares connected by a dashed line represent differences in mean between females of both subspecies with error bars representing confidence intervals (α = 0.05). It is worth noting that a little difference on the level of mRNA between males and females M. m. domesticus (in Fig. 1) yields significant differences on the level of total protein concentration—here demonstrated by nonoverlapping confidence intervals

Discussion

Differences in gene expression between males and females have been regularly reported in various publications that use high-throughput technologies for arraying large sample sets. Usually, such sexually dimorphic genes are further studied at the level of translation, modifications, and effects on phenotype of studied individuals. The importance of this study is that it shows that species-specific and significant sexual dimorphism at the level of selected MUP mRNA abundance can be corroborated with the level of actual protein concentration in the urine. The strength of this finding is accented by the fact that such species-specific sexual dimorphisms may be a potential mechanism for mate selection differences that have been reported in this species (Smadja and Ganem, 2002).

Our study shows that the abundance of mRNA coding for several major urinary proteins is sexually dimorphic, and that the level of such dimorphism is (sub)species-specific. Major urinary proteins are known to carry volatile pheromones in their hydrophobic beta barrel, and these are released when the urine mark is deposited, and as it slowly dries (Robertson et al., 1993; Hurst et al., 1998). If the intensity of signals directly relates to the abundance of proteins secreted into urine, then this study indicates that individuals of the opposite sex may differentially invest in signaling. Furthermore, we also detected that the level of differences between males and females is smaller in M. m. domesticus. This suggests that M. m. musculus males invest relatively more energy into MUP production, and that this may potentially be important in the process of female choice. It is also worth noting that our analysis revealed significant differences in the level of protein concentration and somewhat less reliably (i.e., not significantly) in the level of mRNA between M. m. domesticus males and females in which other studies have reported no variation (Sampsell and Held, 1985).

At the behavioral level, Smadja and Ganem (2002) showed that individuals from both populations of the two subspecies can discriminate each other on the basis of urinary signals. However, they also demonstrated that M. m. musculus females were choosier than females of M. m. domesticus, as when given a choice, they systematically mated with individuals of the same subspecies. Their results, as well as the study by Christophe and Baudoin (1998), corroborate our interpretation of the expression differences detected here, i.e., that males in a more choosy subspecies have to produce more MUPs to outcompete other males in the process of intermale competition and female choice. Moreover, Munclinger and Frynta (1997) lend further support to these findings by revealing that male individuals of M. m. domesticus (individuals from Turkey) were less choosy even when given other species (i.e., M. spretus, M. spicilegus) to choose from. Our findings, along with previously published observations of behavioral discriminations, support the already stated claim that MUPs in M. m. domesticus primarily serve to transfer individual specific information (Hurst et al., 2001).

This study deals with the expression differences of MUPs in wild house mice (Mus musculus). However, the resulting scent profile is a result of both the combination and interaction of MUPs and pheromones that these proteins carry in their hydrophobic pocket. Recent advances in understanding pheromone communication stem from seminal papers by Novotny (2003) who, following Whitten’s definitions (1966) of primer pheromones, demonstrated that two androgen-dependent urinary metabolites, 3,4-dehydro-exo-brevicomin and 2-sec-butyldihydrothiazole, are effective in promoting estrus synchronization. Other pheromones such as 6-hydroxy-6-methyl-3-heptanone have a profound effect on the acceleration of puberty (Novotny, 2003). An important milestone in the study of pheromonal communication in mice was evidence that MUPs are involved in binding these pheromones (Bacchini et al., 1992 ) as well as the discovery that nearly all (pheromone) ligands are protein bound (Robertson et al., 1993). To date, there is sufficient evidence in the literature that the action of known and recently discovered pheromones (Novotny, 2003) influence a chain of physiological and behavioral reactions ranging from modulation of estrus to complex behavioral traits such as aggression (Mucignat-Caretta et al., 2004).

Although various published studies explain how scent molecules are transported and protected (e.g., Hurst et al., 1998), there is a need for further determination of which molecules signal identity and which molecules are rather general signals of physiological status specific for each sex. In this respect, our study is important in showing that individual variation in the expression of most of MUPs studied is relatively smaller than that between sexes and species. The abundance of one protein in our study (MUP5) was not species-specific but was highly sexually dimorphic, suggesting that some particular protein isoforms are differentially regulated in each sex regardless of species. The idea of functional specificity for given MUPs is not new (Shahan et al., 1987). However, apart from a few (Pes et al., 1999; Beynon et al., 2002), most studies have been performed on laboratory mice, and species-specificity has not yet been demonstrated in controlled experiments with wild or wild-derived mice. Here, we suggest that because of detected sexual dimorphisms in the abundance of MUP mRNA in the liver and the proteins in the urine, the function of these proteins may rather be sexual in that females use the scent information to evaluate quality of competing males before or during mating. Although, there is no direct evidence that females use marks to evaluate the quality of particular males in the process of mate choice, it is possible that male marking and overmarking (Humphries et al., 1999) may locally reinforce individual (male) fitness benefits. Thus, the regulation of expression of MUPs (rather than the diversity of MUP isoforms) would be the trait under sexual selection. Further investigation is required to determine to what extent the detected variation in the expression of MUPs is genetic as opposed to phenotypic.

Notes

Acknowledgments

We are grateful to Timothy Hort for language correction, Jaroslav Pialek, Milos Macholan, and Pavel Munclinger for helpful discussions. The work was funded by the Grant Agency of the Czech Republic (206-04/0493), whereas grant MSMT VZ 0021620828 from the Ministry of Education, Youth and Sport of the Czech Republic formed a framework for this study.

References

  1. Bacchini, A., Gaetani, E., and Cavaggioni, A. 1992. Pheromone binding proteins of the mouse. Mus musculus. Experientia 48:419–421.CrossRefGoogle Scholar
  2. Beynon, R. J., Veggerby, C., Payne, C. E., Roberstson, D. H. L., Gaskell, S. J., Humphries, R. E., and Hurst, J. L. 2002. Polymorphism in major urinary proteins: Molecular heterogeneity in a wild mouse population. J. Chem. Ecol. 28:1429–1446.PubMedCrossRefGoogle Scholar
  3. Bishop, J. O., Clark, A. J., Clissold, P. M., Hainey, S., and Francke, U. 1982. Two main groups of mouse major urinary protein genes, both largely located on chromosome 4. EMBO J. 1:615–620.PubMedGoogle Scholar
  4. Boursot, P., Auffray, J. C., Britton-Davidian, J., and Bonhomme, F. 1993. The evolution of house mice. Annu. Rev. Ecol. Syst. 24:119–152.CrossRefGoogle Scholar
  5. Bustin, S. A. 2000. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J. Mol. Endocrinol. 25:169–193.PubMedCrossRefGoogle Scholar
  6. Bustin, S. A. 2002. Quantification of mRNA using real-time reverse transcription PCR (RT-PCR): Trends and problems. J. Mol. Endocrinol. 29:23–39.PubMedCrossRefGoogle Scholar
  7. Cavaggioni, A., and Mucignat-Caretta, C. 2000. Major urinary proteins, α2U-globulins and aphrodisin. Biochim. Biophys. Acta Prot. Struct. Mol. Enzymol. 1482:218–228.CrossRefGoogle Scholar
  8. Christophe, N., and Baudoin, C. 1998. Olfactory preferences in two strains of wild mice, Mus musculus musculus and Mus musculus domesticus, and their hybrids. Anim. Behav. 56:365–369.PubMedCrossRefGoogle Scholar
  9. Finlayson, J. S., Asofsky, R., Potter, and M., Runner, C. C. 1965. Major urinary protein complex of normal mice: Origin. Science 149:981–982.PubMedCrossRefGoogle Scholar
  10. Giulietti, A., Overbergh, L., Valckx, D., Decallonne, B., Bouillon, R., and Matheu, C. 2001. An overview of real-time quantitative PCR: Applications to quantify cytokine gene expression. Methods 25:386–401.PubMedCrossRefGoogle Scholar
  11. Humphries, R. E., Robertson, D. H. L., Beynon, R. J., and Hurst, J. L. 1999.Unravelling the chemical basis of competitive scent marking in house mice. Anim. Behav. 58:1177–1190.PubMedCrossRefGoogle Scholar
  12. Hurst, J. L., Robertson, D. H. L., Tolladay, U., and Beynon, R. J. 1998. Proteins in urine scent marks of male house mice extend the longevity of olfactory signals. Anim. Behav. 55:1289–1297.PubMedCrossRefGoogle Scholar
  13. Hurst, J. L., Payne, C. E., Nevison, C. M., Marie, A. D., Humphries, R. E., Robertson, D. H. L., Cavaggioni, A., and Beynon, R. J. 2001. Individual recognition in mice mediated by major urinary proteins. Nature 414:631–634.PubMedCrossRefGoogle Scholar
  14. Knopf, J. L., Gallagher, J. F., and Held, W. A. 1983. Differential, multihormonal regulation of the mouse major urinary protein gene family in the liver. Mol. Cell. Biol. 3:2232–2240.PubMedGoogle Scholar
  15. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680–685.PubMedCrossRefGoogle Scholar
  16. Linnaeus, C. 1758. Systema Naturae per regna tria naturae, secundum classis, ordines, genera species cum characteribus, differentiis, synonymis, locis. Tenth ed. Vol. 1. Laurentii Salvii, Stockholm, 824 pp.Google Scholar
  17. Livak, K., and Schmittgen, T. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 25:402–408.PubMedCrossRefGoogle Scholar
  18. Marchlewska-Koj, A., Cavaggioni, A., Mucignat-Caretta, C., and Olejniczak, P. 2000. Stimulation of estrus in female mice by male urinary proteins. J. Chem. Ecol. 26:2355–2366.CrossRefGoogle Scholar
  19. Mucignat-Caretta, C., Cavaggioni, A., and Caretta, A. 2004. Male urinary chemosignals differentially affect aggressive behavior in male mice. J. Chem. Ecol. 30:777–791.PubMedCrossRefGoogle Scholar
  20. Munclinger, P., and Frynta, D. 1997. Relations between distant populations of Mus musculus sensu lato: is there any odour-based discrimination? Folia Zool. 46:193–199.Google Scholar
  21. Munclinger, P., Božíková, E., Šugerková, M., Piálek, J., and Macholán, M. 2002. Genetic variation in house mice (Mus, Muridae, Rodentia) from the Czech and Slovak republics. Folia Zool. 51:81–92.Google Scholar
  22. Novotny, M. V. 2003. Pheromones, binding proteins and receptor responses in rodents. Biochem. Soc. Trans. 31:117–122.PubMedCrossRefGoogle Scholar
  23. Novotny, M. V., Ma, W., Žídek, L., and Daev, E. 1999. Recent biochemical insights into puberty acceleration, estrus induction, and puberty delay in the house mouse, pp. 99–116, in R. E. Johnston, D. Müller-Schwarze, and P. Sorensen (eds.). Advances in Chemical Communication in Vertebrates. Plenum Press, New York.Google Scholar
  24. Pes, D., Robertson, D. H. L., Hurst, J. L., Gaskell, S., and Beynon, R. J. 1999. How many major urinary proteins are produced by the house mouse Mus domesticus, pp. 149–162, in R. E. Johnston, D. Müller-Schwarze, and P. Sorensen (eds.). Advances in Chemical Communication in Vertebrates. Plenum Press, New York.Google Scholar
  25. Pfaffl, M. W. 2003. Quantification strategies in real-time PCR, in S. Bustin (ed.). A–Z of Quantitative PCR. IUL, La Jolla.Google Scholar
  26. Robertson, D. H. L., Beynon, R. J., and Evershed, R. P. 1993. Extraction, characterization, and binding analysis of two pheromonally active ligands associated with Major Urinary Protein of house mouse (Mus musculus). J. Chem. Ecol. 19:1405–1417.CrossRefGoogle Scholar
  27. Robertson, D. H. L., Cox, K. A., Gaskell, S. J., Evershed, R. P., and Beynon, R. J. 1996. Molecular heterogeneity in the Major Urinary Proteins of the house mouse Mus musculus. Biochem. J. 316:265–272.Google Scholar
  28. Robertson, D. H. L., Hurst, J. L., Bolgar, M. S., Gaskell, S. J., and Beynon, R. J. 1997. Molecular heterogeneity of urinary proteins in wild house mouse populations. Rapid. Commun. Mass Sp. 11:786–790.CrossRefGoogle Scholar
  29. Sampsell, B. M., and Held, W. A. 1985. Variation in the major urinary protein multigene family in wild-derived mice. Genetics 109:549–568.PubMedGoogle Scholar
  30. Schwarz, E., and Schwarz, H.K. 1943. The wild and commensal stocks of the house mouse, Mus musculus Linneaus. J. Mammal. 24:59–72.CrossRefGoogle Scholar
  31. Shahan, K., Denaro, M., Gilmartin, M., Shi, Y., and Derman, E. 1987. Expression of six mouse major urinary protein genes in the mammary, parotid, sublingual, submaxillary, and lachrymal glands and in the liver. Mol. Cell. Biol. 7:1947–1954.PubMedGoogle Scholar
  32. Smadja, C., and Ganem, G. 2002. Subspecies recognition in the house mouse: a study of two populations from the border of a hybrid zone. Behav. Ecol. 13:312–320.CrossRefGoogle Scholar
  33. Vandesompele, J., De Paepe, A., and Spelman, F. 2002. Elimination of primer-dimer artifacts and genomic coamplification using a two-step SYBR Green I Real-Time RT-PCR. Anal. Biochem. 303:95–98.PubMedCrossRefGoogle Scholar
  34. Whitten, W. K. 1966. Pheromones and mammalian reproduction. Adv. Reprod. Physiol. 1:155–177.Google Scholar
  35. Wicks, L. F. 1941. Sex and proteinuria of mice. Proc. Soc. Exp. Biol. Med. 48:395–400.Google Scholar
  36. Žídek, L., Stone, M. J., Lato, S. M., Pagel, M. D., Miao, Z., Ellington, A. D., and Novotny, M. V. 1999. NMR mapping of the recombinant mouse major urinary protein I binding site occupied by the pheromone 2-sec-butyl-4,5-dihydrothiazole. Biochemistry 38:9850–9861.PubMedCrossRefGoogle Scholar

Copyright information

© Springer Science+Business Media, LLC 2007

Authors and Affiliations

  • R. Stopková
    • 1
    • 2
  • P. Stopka
    • 1
    • 2
  • K. Janotová
    • 1
    • 2
  • P. L. Jedelský
    • 1
    • 2
  1. 1.Biodiversity Research Group, Department of Zoology, Faculty of ScienceCharles UniversityPragueCzech Republic
  2. 2.Institute of Animal Physiology and GeneticsAcademy of Sciences of the Czech RepublicLibechovCzech Republic

Personalised recommendations