Novel Mutations in TACI (TNFRSF13B) Causing Common Variable Immunodeficiency

  • Javad Mohammadi
  • Chonghai Liu
  • Asghar Aghamohammadi
  • Astrid Bergbreiter
  • Likun Du
  • Jiayi Lu
  • Nima Rezaei
  • Ali Akbar Amirzargar
  • Mostafa Moin
  • Ulrich Salzer
  • Qiang Pan-Hammarström
  • Lennart Hammarström
Article

Abstract

Introduction

Common variable immunodeficiency (CVID) is a heterogeneous syndrome characterized by impaired immunoglobulin production. The disorder is also characterized by co-occurrence of autoimmune, lymphoproliferative, and granulomatous diseases. Mutations in the gene encoding TACI (Transmembrane Activator and CAML Interactor, TNFRSF13B) were previously found to be associated with CVID.

Materials and Methods

We therefore sequenced TNFRSF13B gene in a cohort of 48 Iranian CVID patients. Expression of TACI and binding of A proliferation-inducing ligand (APRIL) were tested by FACS.

Results

We identified one patient with a homozygous G to T substitution in the TNFRSF13B gene at the splice site of intron 1 (c.61+1G>T), which abolished expression of the TACI molecule and binding capacity of APRIL. This represents the second CVID patient in the world with a complete absence of TACI expression. B cell lines from family members carrying the same mutation in a heterozygous form showed a reduced level of TACI expression and APRIL-binding capacity, suggesting a gene dosage effect. In addition, we found the previously recognized C104R and C172Y mutations in a heterozygous form in two patients with CVID and one, novel, heterozygous P42T mutation.

Conclusion

TACI mutations were observed in Iran CVID patients in a similar frequency as in other Caucasian populations. The novel mutations identified in this study support the notion of a crucial role for TACI in B cell differentiation.

Keywords

Common variable immunodeficiency TACI human immunoglobulins mutation 

Introduction

Common variable immunodeficiency (CVID) is the most frequent symptomatic primary immunodeficiency disorder. It is characterized by low serum levels of IgA, IgG and, in half of the patients, low levels of IgM. The clinical manifestations are due to a reduction of Ig levels resulting in frequent respiratory and gastrointestinal tract infections [1, 2, 3, 4]. Patients with CVID also have an increased incidence of polyclonal lymphocytic infiltration, autoimmunity, enteropathy [1], and malignancies [5]. In the last few years, several monogenic defects have been suggested to be associated with development of CVID, including mutations in inducible T cell costimulator, encoded on chromosome 2q [6], transmembrane activator and CAML interactor (TACI) on chromosome 17p [7, 8], B cell-activating factor receptor (BAFF-R) on chromosome 22q [9], CD19 on chromosome 16p [10], CD81 on chromosome 11p [11], and MSH5 on chromosome 6p [12].

The tumor necrosis factor receptor (TNFR) superfamily member TACI is expressed on B cells and binds two ligands, BAFF and A proliferation-inducing ligand (APRIL). The latter proteins are both members of the TNF family of ligands and are mainly expressed by neutrophils and monocytes [13].

Mice with a targeted disruption of TACI (TACI−/−) have enlarged spleens and lymph nodes with an increased number of mature B cells [14, 15]. These B cells show an increased proliferation rate and increased Ig production in vitro [15], and with age, the animals develop autoantibodies [16]. Yet, their serum IgA, IgG, and IgM levels are low in response to thymus-independent antigens [15]. Decreased apoptosis in B cells from TACI−/− mice suggests that TACI normally delivers an apoptotic signal and that it has a regulatory role in B cell development [15, 16].

TACI is encoded by TNFRSF13B, which is mutated in a significant proportion of patients with CVID (7–21%) [8, 17, 18]. In a majority of patients, the IgG levels are low at the time of diagnosis, but IgA is the most affected Ig class [18]. Reduced IgG and IgA levels in individuals with TACI deficiency are probably due to an inefficient class switch recombination in B cells [7, 8].

Multiple mutations, including nonsense mutations (S144X, Y164X, C193X, and S194X), frameshift mutations (c.121delG, c.204insA, c. 298insT, and c.571insG), and missense mutations (W40R, D41H, Y79C, I87N, C104Y, C104R, A149T, G152E, A181E, R202H, and V246F) have previously been observed in TNFRSF13B in CVID patients [7, 8, 18, 19]. Most of these mutations have only been observed in one or two patients; however, some mutations (C104R and A181E) are more common, with various frequencies in different ethnic populations [17].

The aim of the present study was to determine the prevalence of TNFRSF13B mutations in Iranian patients with CVID.

Materials and Methods

CVID Patients

Forty-eight Iranian patients with sporadic CVID, referred to the Children’s Medical Center Hospital in Tehran or the Immunodeficiency Unit at the Karolinska University Hospital Huddinge in Stockholm, were included in the study as were ethnically matched blood donor controls (n = 244). All patients and controls were unrelated Iranian Caucasians. The diagnosis of CVID was made using the European Society for Immunodeficiency criteria (www.esid.org). The rate of consanguinity among the studied Iranian CVID patients is 58% (28 of 48; 23 first cousins and five second cousins). Local ethical permissions were obtained from the Karolinska Institute and the Tehran University of Medical Science for use of all samples collected in the study.

Serum Immunoglobulin Levels

Serum levels of IgG, IgA, and IgM were measured by nephelometry.

Sequence Analysis of TNFRSF13B

Polymerase chain reaction (PCR) amplification and full sequencing of TNFRSF13B was performed as previously described [8]. Briefly, 50 ng of genomic DNA was used in PCR employing exon-specific primers (sequence of the primers are available in [8]) using the following conditions: 95°C 2 min for one cycle followed by 95°C 15 s, 65°C 30 s, 68°C 1 min for 30 cycles, and a final extension of 72°C for 10 min. An annealing temperature of 67°C was used for exons 4 and 5. The PCR products were purified using a gel extraction kit (Qiagen, Stockholm, Sweden). The purified amplicons were sequenced at the Macrogen Company (Seoul, South Korea) and analyzed using Lasergene (DNAStar, Madison, WI, USA).

Analysis of Mutations of TNFRSF13B in Population-based Controls

Frequencies of the G to T substitution at the first nucleotide of intron 1 (c.61 + 1G > T), P42T, C104R, C172Y, and A181E variants were analyzed by matrix-assisted laser desorption/ionization-time of flight analysis in a single nucleotide polymorphism (SNP)-based assay as described previously [8, 20]. Amplification and detection primers for the tested mutations were designed using the SpectroDesigner software (Sequenom, San Diego, CA, USA) and are available upon request. The PCR temperature profile started with 15 min of denaturation at 95°C followed by 45 cycles of 94°C for 30 s, 60°C for 15 s, and 72°C for 15 s. A final elongation step of 72°C for 5 min ended the program.

Primer extension was carried out in a total volume of 9 μl after salt removal. About 10 nl of the samples were spotted onto Maldimatrix-containing SpectroCHIPS (Sequenom Inc.) using a nanodispenser (Robodesign). The SpectroCHIPS were analyzed using an Autoflex MassARRAY mass spectrometer (Bruker Daltonics, Billerica, MA, USA). Finally, the data were analyzed independently by two persons using the SpectroTyper software (Sequenom Inc.).

TACI Expression and Binding of Flag-APRIL

Staining of TACI on Epstein–Barr virus (EBV) cell lines or peripheral B cells was performed as described previously [8, 18]. Peripheral B cells or EBV-transformed cells were stained either with a biotin-labeled polyclonal goat anti-human TACI antibody (Peprotech, London, UK), followed by Streptavidin PE (BD Biosciences, Heidelberg, Germany) or PE-labeled monoclonal rat anti-human-TACI antibody (1A1, Abcam, Cambridge, UK), together with CD19-PC7 (J4.119; Beckman Coulter, Marseille, France), anti-IgM Cy5 (Dianova, Hamburg, Germany), and anti-CD27 fluorescein isothiocyanate (BD Biosciences). At least 104 cells, gated according to their forward and sideward scatters, were collected using a FACSCalibur (Becton Dickinson, Mountain View, CA, USA) and analyzed using the FlowJo software (Tree Star Inc., Ashland, OR, USA). Dead cells were excluded by forward/side scatter electronic gating.

For binding of flag-APRIL, 106 EBV-transformed cells were incubated with 100 ng of Flag-ACRP-hAPRIL (Alexis Biochemicals, Lausen, Switzerland) [21] in the presence of 0.1 μl heparin (Liquemin, Roche Pharma) and detected with the monoclonal mouse anti-Flag antibody M2 (Sigma, Seelze, Germany) and PE-labeled goat anti-mouse-antibodies (Caltag, Hamburg, Germany), or the biotinylated monoclonal mouse anti-Flag antibody M2 (Sigma, Seelze, Germany) and Streptavidin PE. The specificity of antibody staining and Flag-ACRP-hAPRIL binding to EBV-transformed B cells was assessed by simultaneous staining of an EBV-transformed B cell line known to carry a TNFRSF13B null mutation (S144X) [8].

Total RNA Preparation, cDNA Synthesis, and RT-PCR

Total RNA was extracted from peripheral blood mononuclear cell, and cDNA was prepared using a first-strand cDNA synthesis kit (Amersham Biosciences, UK) according to the manufacturer’s instruction. First-strand cDNA was synthesized using 1.5 μg of total RNA in a 15-μl reaction mixture consisting of bulk first-strand reaction mix 5 μl, 200 uM dithiothreitol 1 μl, and Not I-d (T)18 primer 0.2 μg. The mixture was incubated at 37°C for 1 h. PCR amplification was performed using two pair of primers, the first pair of primers cover exons 1–3 (AGCATCCTGAGTAATGAGTGG as sense and CCTCTGTGCTCCAATCCTT as antisense); the second pair of primers cover exons 3–5 (GACAGCACCCTAAGCAATG as sense and CCGACCTCCTGCTCTATCT as antisense). Briefly, 25-μl reaction mixture was prepared using 2.5 μl of 10× PCR buffer, 1.5 μl of 25 mM MgCl2, 1.5 μl dNTPs (10 mM), 10 pmol of each primer, and 1 unit of Go-Taq DNA polymerase (Promega). The PCRs were run under the following conditions: 95°C 15 s, 63°C 30 s, and 72°C 1 min 30 s for 30 cycles. The PCR product was finally visualized by running agarose gel electrophoresis containing ethidium bromide. To assure the specificity of primers, the PCR products from agarose gel slices were purified using QIAquick Gel extraction Kit (QIAGEN) and sequenced (Macrogen, Seoul, Korea). The β actin gene was used as a control using the following primers: 5′-GATGATGATATCGCCGCGCT-3′ and 5′-TGGGTCATCTTCTCGCGGTT-3′ [22].

Statistical Analyses

Analysis was carried out using the Stata statistical program, and the frequencies of the variants were compared using Fisher’s exact and chi-square test as appropriate.

Results

Sequence Analysis of TNFRSF13B in Iranian CVID Patients

Screening of 48 patients with sporadic CVID identified four (8.3%) individuals who carried different heterozygous/homozygous mutations in the TNFRSF13B gene (Table I, Fig. 1). Sequence analysis showed a homozygous G to T substitution at the first nucleotide of intron 1 (c.61 + 1G > T) in one CVID patient (P1). The mutation converts the GT sequence of the splice donor site to TT. Other family members of the patient were subsequently screened. Three individuals (mother, younger sister, and uncle) showed a heterozygous state (G/T), and one individual showed a homozygous mutation (TT, older sister; Figs. 2a, b). The former, all had normal Ig levels; whereas, the older sister showed low (IgM, 0.44 g/l; IgG, 4.75 g/l; and IgA, 0.82 g/l) Ig levels.
Table I

Sequence Analysis of TNFRSF13B Gene in Iranian Common Variable Immunodeficiency Patients

Exon/intron

Mutations

Patientsa, b

Controlsa

Prediction on functionc

Domain

1

c.61 + 1G > T (ho)

1 (2.1%)

0 (0%)

Not applicable

Not applicable

2

P42T (he)

1 (2.1%)

1 (0.4%)

Possibly damaging

CRD1, extracellular

3

C104R (he)

1 (2.1%)

2 (0.8%)

Probably damaging

CRD2, extracellular

4

C172Y (he)

1 (2.1%)

0 (0%)

Probably damaging

Transmembrane

 

Total

4 (8.3%)

3 (1.2%)

  

aFrequency of the mutation in patients (n = 48) and controls (n = 244)

bThe mutations were all detected at similar frequencies as compared to controls (p > 0.05), although in total, the frequency of mutations in transmembrane activator and CAML interactor is significantly higher as compared to controls (p = 0.003)

cPrediction based on results of the Polyphen algorithm

Fig. 1

Position of mutations in transmembrane activator and CAML interactor in Iranian common variable immunodeficiency patients. ST stalk, TM transmembrane domain, ho homozygous, and he heterozygous mutations

Fig. 2

Family tree and sequence of the TNFRSF13B gene of the common variable immunodeficiency (CVID) patient with a splice site mutation. a Sequences of the first intron-exon border in the patient and family members. The sequences from the negative strand are shown. The CVID patient (III:1) and his older sister (III:2) both carry a homozygous form of the C to A substitution in the splice site of exon 1 (G to T in the positive strand). His younger sister (III:3), mother (II:1), and uncle (II:4) all are heterozygous for the same substitution. b. Family tree of the patient carrying the splice mutation. Solid square or circle: homozygous mutation. Semi-solid square or circle: heterozygous mutation. Open circle: wild-type sequence

One CVID patient (P2) was heterozygous with respect to a novel TACI mutation in the extracellular CRD1 domain (P42T), and one patient (P4) was heterozygous for a recently described mutation in the transmembrane region (C172Y) [19]. One patient carried the well-known heterozygous C104R missense mutation in the CRD2 region. Several additional, previously noted variants (P97P, P251L, and S277S), not associated with development of CVID, were also found in the Iranian CVID patients at frequencies comparable to those in other Caucasian populations (data not shown).

Clinical and Immunological Manifestations of the Iranian CVID Patients with TNFRSF13B Mutations

The patient carrying the homozygous splice site mutation (c.61 + 1G > T) is born to consanguineous parents (the parents are first cousins). Since childhood, he suffered from recurrent upper respiratory infections and was tonsillectomized at 4 years of age. Asthmatic problems have also been noted since childhood, and he has been treated with topical steroids. In his early twenties, he started having recurrent pneumonias (four to five per year) and was diagnosed with CVID at the age of 27 (IgM 0.12 g/L, IgG 3.0 g/L, and IgA 0.33 g/L). Since diagnosis, he has been substituted with subcutaneously administered gamma globulin with a favorable clinical outcome. The clinical and immunological manifestations of this patient (P1) and the remaining three Iranian CVID patients (P2-P4) with TNFRSF13B mutations are summarized in Table II. All patients suffered from gastrointestinal and respiratory tract infections. Autoimmunity was present in three patients (P1, P2, and P4), ulcerative colitis in P1, autoimmune thrombocytopenia in P2, and chronic active hepatitis in P4 and, thus, presence of autoimmunity was significantly more common (using Fisher’s exact test, p = 0.01) in CVID patients with TACI mutations than in those who did not carry mutations (75% compared to 23%, respectively. Clinical manifestations of Iranian patients with CVID have previously been summarized in [23]).
Table II

Clinical and Immunological Manifestations in Iranian Common Variable Immunodeficiency Patients Carrying Mutations in Transmembrane Activator and CAML Interactor

Patient

Mutations

IgG (g/l)

IgM (g/l)

IgA (g/l)

WBC (cells/µl)

Lymp (%)

PMN (%)

CD3 (%)

CD4 (%)

CD8 (%)

CD19 (%)

Clinical features

P1

c.61 + 1G > T

3.0

0.12

0.33

9,500

22

69

62

43

18

32

Otitis, sinusitis, pneumonia, chronic diarrhea, urinary tract infection, epididymitis, asthma, nasal polyps, anemia, ulcerative colitis (?)

P2

P42T

3.2

0.40

0.20

3,800

48

42

78

55

20

5.7

Chronic otitis, sinusitis, pneumonia, liver granulomas, thrombocytopenia, chronic diarrhea, splenomegaly, clubbing of finger, bronchiectasis

P3

C104R

3.5

0.33

0

7,500

47

47

90

53

35

4.5

Otitis media, chronic diarrhea, pneumonia, skin infections

P4

C172Y

6.4

0.20

0.40

5,800

44

42

97

12

73

2.5

Otitis media, sinusitis, pneumonia, bronchiectasis, chronic diarrhea, cirrhosis hepato/splenomegaly, chronic active hepatitis

TACI Mutations in Iranian Controls

A total of 244 healthy Iranian controls were analyzed for mutations in the TNFRSF13B gene. In this screening, no splice site mutation in intron 1 was found. One (0.4%) of the healthy controls was heterozygous for the P42T allele, and two (0.8%) were heterozygous for the C104R allele. The C172Y mutation was not observed in the healthy control group (Table I).

TACI Expression in Individuals with Splice Site Mutations (c.61 + 1G > T)

Peripheral B cells from the patient with the homozygous splice site mutation (P1) were analyzed for TACI expression (Fig. 3a). Two normal individuals without TACI mutation served as positive controls. B cells from the patient and controls were incubated with a polyclonal antibody against TACI (left panels) and a monoclonal Ab (clone 1A1), which requires cysteine 104 for TACI recognition (right panel). Surface expression of TACI in B cells from healthy controls was readily detected. In B cells from patient P1, the binding of both the polyclonal antibody against TACI and the monoclonal Ab 1A1 were completely abolished, indicating that TACI surface expression is absent on cells from this patient. In addition, reverse transcription (RT)-PCR showed no expression of TACI transcripts in peripheral B cells from this patient (Fig. 3b), suggesting instability or degradation of a potential transcript. In the control tested for TACI mRNA expression, two alternative isoforms of TACI were observed. One was 441 bp in length including the first three exons (transcript ID: ENST00000261652) and one was 303 bp in length, where exon 2 was skipped (transcript ID: ENST00000343345).
Fig. 3

Abolished transmembrane activator and CAML interactor (TACI) expression in the common variable immunodeficiency (CVID) patient with splice site mutation. a Abolished expression of TACI protein is observed in the CVID patient with splice site mutations and normal expression of TACI in two healthy controls. B cells from the patient and control stained with a monoclonal Ab (clone 1A1), which requires Cys 104 for TACI recognition. b Reverse transcription-polymerase chain reaction analysis of TACI mRNA expression in peripheral B cells from this patient and a control. M, 1 Kb DNA ladder (Invitrogen). Two alternative TACI transcripts were observed in the control, one with 441 bp length and one with 303 bp length with a skipped exon 2

EBV cell lines were subsequently generated from the patient and the older sister (III.1 and III.2 in Fig. 2; both homozygous for c.61 + 1G > T) as well as from the patient’s mother and uncle (II.1 and II.4 in Fig. 2, both heterozygous for c.61 + 1G > T). EBV cell lines from three healthy individuals, two previously described CVID patients carrying heterozygous nonsense mutations (C193X and S194X) [8, 18] and one CVID patient carrying a homozygous TNFRSF13B null mutation (S144X) [8], were also included as controls. As shown in Fig. 4, the EBV cell lines of the c.61 + 1G > T homozygous individuals do not express any TACI and do not bind APRIL. The EBV cell lines of the c.61 + 1G > T heterozygous mother and uncle, similar to the patients with heterozygous S194X or C193X mutations, show an intermediate staining intensity with all three staining methods when compared to TACIwildtype healthy controls and the homozygous TACInull mutants, thus suggesting a gene dosage effect (Fig. 4). However, it should be noted that there is considerable variation in the expression of TACI and APRIL-binding capacity also in healthy controls (Fig. 4) and that TACI is a cell surface receptor where expression is highly regulated depending on the activation and differentiation status of the B cells [24].
Fig. 4

Transmembrane activator and CAML interactor (TACI) expression and A proliferation-inducing ligand (APRIL) binding on Epstein–Barr virus (EBV) cell lines from the patient with a homozygous splice site mutation, his family members, and various controls. a Mean fluorescence intensity (MFI) of staining with monoclonal anti-TACI antibody. b MFI of staining with a polyclonal anti-TACI antibody. c MFI of flag-APRIL binding to EBV cells; symbols: filled diamonds, healthy controls; open boxes, individuals with heterozygous C193X and heterozygous S194X TACI mutations; filled triangles, uncle and mother of patient (heterozygous); filled circles, patient and his older sister (homozygous); open circle, individual with homozygous S144X TACI mutations (negative control). The mean values and the standard deviations of two sets of independent experiments are depicted. d The flow cytometry result from one set of experiments

Prediction on Function of TACI Protein Affected by Mutations

By in silico analysis using Polyphen [25], the three missense mutations in the Iranian CVID patient group were predicted to be probably (C172Y, C104R) or possibly (P42T) damaging (Table I). Using the GeneRunner software (version 3.05, 1994 Hastings Software, Inc., http://www.generunner.com), hydrophobicity of the P42T protein was predicted to be changed (from hydrophobic to hydrophilic); whereas, the hydrophobicity of both C104R and C172Y was unaltered.

Discussion

The frequency of TACI mutations in our Iranian CVID patients was similar (8.3%) to that noted in patients from other Caucasians populations [17, 18], which is significantly higher (p = 0.003) than in healthy Iranian controls. The novel mutation in the splice site of intron 1 (c.61 + 1G > T), when in a homozygous form, eliminates expression of TACI and abolishes the binding of APRIL on B cells. Hence, it has a profound influence on TACI function and the development of CVID. In the older sister with the same homozygous mutation, the decreased immunoglobulin levels also support the notion of a significant influence of this mutation on B cell function. The heterozygous family members are healthy. However, B cell lines from these individuals showed a reduced level of TACI expression and APRIL binding, suggesting that this mutation may also affect TACI function even in a heterozygous form. The P42T mutation is a new variant with the same frequency as in controls (Table I). The C104R mutation has previously been described as a disease-associated mutation, but in the present study, its frequency did not differ significantly from normal controls. The C172Y mutation recently described as a potential risk factor for development of CVID [19] was not found in healthy Iranian donors. However, further analysis of a larger sample size of patients and controls is required to determine whether heterozygous c.61 + 1G > T, P42T, and C172Y mutations actually do constitute risk factors for development of CVID.

Structural characteristics can serve as reasonably reliable predictors of the effect of amino acid substitutions. As previously noted, most disease-associated/causing mutations and deleterious non-synonymous SNPs have an effect on protein stability rather than functionality [26], and hydrophobic core stability parameters are the best predictors for the effect of a mutation on the protein [25]. Proline is a helix-breaking amino acid [27] and, thus, the P42T mutation will probably lead to an alteration of the structure of TACI. Based on the Swiss-Prot database, there is a disulfide bond between amino acids number 34 and 47 in the TACI molecule. Thus, the P42T mutation is likely to change non-covalent and van der Waals bonding forces and, consequently, the folding of the receptor. It also introduces a hydrophilic propensity into the hydrophobic core of the protein, possibly destabilizing its folded structure.

The cysteine at position 104 forms a disulfide bond with the cysteine at position 93 and participates in the maintenance of the spatial structure of the CRD2 domain of TACI, and is localized close to the APRIL ligand-binding domain [28]. The C104R mutation may impair the function of TACI both in homozygous and heterozygous states [18, 29]. Homozygous C104R mutations have previously been identified exclusively in CVID patients; whereas, heterozygous mutations have been identified in both CVID patients and healthy individuals [8, 18]. However, C104R heterozygosity is clearly associated with an increased risk for CVID [17] and may be associated with a low number of IgDCD27+ B cells, benign lymphoproliferation, and autoimmune complications [18]. Recently, three individuals (relatives of CVID patients) with normal immunoglobulin levels, carrying homozygous C104R mutations, have been described [30], suggesting that even in a homozygous form, this variant may still show incomplete penetrance.

Tyrosine is a hydrophilic amino acid with a higher positive charge than cysteine. As the transmembrane region has a hydrophobic propensity, the C172Y mutation probably damages the structure and function of the receptor, even though the cysteine at position 172 is not linked by an intra-chain disulfide bond (based on the Swiss-Prot databases entry O14836).

We have previously reported that heterozygous A181E mutations in TNFRSF13B constitute risk factors for the development of CVID, but not for IgAD [17]. In that study, the A181E mutation was observed both in normal and immunodeficient individuals, supporting the notion of an incomplete penetrance of the described TNFRSF13B mutations. However, the A181E mutation was present neither in the Iranian CVID patients nor in the ethnically matched controls (data not shown).

Conclusion

The splice site mutation found in one of our Iranian CVID patients is the second in the world who has no expression of TACI, the first being a patient with a homozygous S144X mutation [8]. As is the case in our patient, he had a sibling carrying the same mutation in a homozygous form, but with a much milder phenotype suggesting the existence of, as yet unidentified, “modifier” genes.

Notes

Acknowledgments

The work was supported by the Swedish Research Council, EU (EUROPAD), the Swedish Cancer Society, and funds from the Karolinska Institutet. The authors have no conflicting financial interests.

References

  1. 1.
    Chapel H, Lucas M, Lee M, Bjorkander J, Webster D, Grimbacher B, et al. Common variable immunodeficiency disorders: division into distinct clinical phenotypes. Blood. 2008;112:277–86.CrossRefPubMedGoogle Scholar
  2. 2.
    Cunningham-Rundles C, Bodian C. Common variable immunodeficiency: clinical and immunological features of 248 patients. Clin Immunol. 1999;92:34–48.CrossRefPubMedGoogle Scholar
  3. 3.
    Hammarstrom L, Smith CI. Genetic approach to common variable immunodeficiency and IgA deficiency. In: Ochs H, Smith E, Puck J, editors. Primary immunodeficiency disease, a molecular and genetic approach. Oxford: Oxford University Press; 2007. p. 313–25.Google Scholar
  4. 4.
    Pan-Hammarstrom Q, Hammarstrom L. Antibody deficiency diseases. Eur J Immunol. 2008;38:327–33.CrossRefPubMedGoogle Scholar
  5. 5.
    Mellemkjaer L, Hammarstrom L, Andersen V, Yuen J, Heilmann C, Barington T, et al. Cancer risk among patients with IgA deficiency or common variable immunodeficiency and their relatives: a combined Danish and Swedish study. Clin Exp Immunol. 2002;130:495–500.CrossRefPubMedGoogle Scholar
  6. 6.
    Grimbacher B, Hutloff A, Schlesier M, Glocker E, Warnatz K, Drager R, et al. Homozygous loss of ICOS is associated with adult-onset common variable immunodeficiency. Nat Immunol. 2003;4:261–8.CrossRefPubMedGoogle Scholar
  7. 7.
    Castigli E, Wilson SA, Garibyan L, Rachid R, Bonilla F, Schneider L, et al. TACI is mutant in common variable immunodeficiency and IgA deficiency. Nat Genet. 2005;37:829–34.CrossRefPubMedGoogle Scholar
  8. 8.
    Salzer U, Chapel HM, Webster AD, Pan-Hammarstrom Q, Schmitt-Graeff A, Schlesier M, et al. Mutations in TNFRSF13B encoding TACI are associated with common variable immunodeficiency in humans. Nat Genet. 2005;37:820–8.CrossRefPubMedGoogle Scholar
  9. 9.
    Warnatz K, Salzer U, Gutenberger S. Finally found: human BAFF-R deficiency causes CVID. In: XIth meeting of the European Society for Immunodeficiencies, Versailles; 2004.Google Scholar
  10. 10.
    van Zelm MC, Reisli I, van der Burg M, Castano D, van Noesel CJ, van Tol MJ, et al. An antibody-deficiency syndrome due to mutations in the CD19 gene. N Engl J Med. 2006;354:1901–12.CrossRefPubMedGoogle Scholar
  11. 11.
    van Zelm MC, Smet J, Mascart F, Adam B, Schandené L, Janssen F, et al. Antibody-deficiency and acute nephritic syndrome in a patient with homozygous disruption of the CD81 gene. Clin Exp Immunol. 2008;154(1):209.Google Scholar
  12. 12.
    Sekine H, Ferreira RC, Pan-Hammarstrom Q, Graham RR, Ziemba B, de Vries SS, et al. Role for Msh5 in the regulation of Ig class switch recombination. Proc Natl Acad Sci U S A. 2007;104:7193–8.CrossRefPubMedGoogle Scholar
  13. 13.
    Moreaux J, Cremer FW, Reme T, Raab M, Mahtouk K, Kaukel P, et al. The level of TACI gene expression in myeloma cells is associated with a signature of microenvironment dependence versus a plasmablastic signature. Blood. 2005;106:1021–30.CrossRefPubMedGoogle Scholar
  14. 14.
    von Bulow GU, van Deursen JM, Bram RJ. Regulation of the T-independent humoral response by TACI. Immunity. 2001;14:573–82.CrossRefGoogle Scholar
  15. 15.
    Yan M, Wang H, Chan B, Roose-Girma M, Erickson S, Baker T, et al. Activation and accumulation of B cells in TACI-deficient mice. Nat Immunol. 2001;2:638–43.CrossRefPubMedGoogle Scholar
  16. 16.
    Seshasayee D, Valdez P, Yan M, Dixit VM, Tumas D, Grewal IS. Loss of TACI causes fatal lymphoproliferation and autoimmunity, establishing TACI as an inhibitory BLyS receptor. Immunity. 2003;18:279–88.CrossRefPubMedGoogle Scholar
  17. 17.
    Pan-Hammarstrom Q, Salzer U, Du L, Bjorkander J, Cunningham-Rundles C, Nelson DL, et al. Reexamining the role of TACI coding variants in common variable immunodeficiency and selective IgA deficiency. Nat Genet. 2007;39:429–30.CrossRefPubMedGoogle Scholar
  18. 18.
    Salzer U, Bacchelli C, Buckridge S, Pan-Hammarstrom Q, Jennings S, Lougaris V, et al. Relevance of biallelic versus monoallelic TNFRSF13B mutations in distinguishing disease-causing from risk-increasing TNFRSF13B variants in antibody deficiency syndromes. Blood. 2009;113:1967–76.CrossRefPubMedGoogle Scholar
  19. 19.
    Zhang L, Radigan L, Salzer U, Behrens TW, Grimbacher B, Diaz G, et al. Transmembrane activator and calcium-modulating cyclophilin ligand interactor mutations in common variable immunodeficiency: clinical and immunologic outcomes in heterozygotes. J Allergy Clin Immunol. 2007;120:1178–85.CrossRefPubMedGoogle Scholar
  20. 20.
    Hannelius U, Lindgren CM, Melen E, Malmberg A, von Dobeln U, Kere J. Phenylketonuria screening registry as a resource for population genetic studies. J Med Genet. 2005;42:e60.CrossRefPubMedGoogle Scholar
  21. 21.
    Ingold K, Zumsteg A, Tardivel A, Huard B, Steiner QG, Cachero TG, et al. Identification of proteoglycans as the APRIL-specific binding partners. J Exp Med. 2005;201:1375–83.CrossRefPubMedGoogle Scholar
  22. 22.
    Pan Q, Lindersson Y, Sideras P, Hammarstrom L. Structural analysis of human gamma 3 intervening regions and switch regions: implication for the low frequency of switching in IgG3-deficient patients. Eur J Immunol. 1997;27:2920–6.CrossRefPubMedGoogle Scholar
  23. 23.
    Aghamohammadi A, Farhoudi A, Moin M, Rezaei N, Kouhi A, Pourpak Z, et al. Clinical and immunological features of 65 Iranian patients with common variable immunodeficiency. Clin Diagn Lab Immunol. 2005;12:825–32.PubMedGoogle Scholar
  24. 24.
    Darce JR, Arendt BK, Wu X, Jelinek DF. Regulated expression of BAFF-binding receptors during human B cell differentiation. J Immunol. 2007;179:7276–86.PubMedGoogle Scholar
  25. 25.
    Ramensky V, Bork P, Sunyaev S. Human non-synonymous SNPs: server and survey. Nucleic Acids Res. 2002;30:3894–900.CrossRefPubMedGoogle Scholar
  26. 26.
    Wang Z, Moult J. SNPs, protein structure, and disease. Hum Mutat. 2001;17:263–70.CrossRefPubMedGoogle Scholar
  27. 27.
    Chou PY, Fasman GD. Prediction of protein conformation. Biochemistry. 1974;13:222–45.CrossRefPubMedGoogle Scholar
  28. 28.
    Hymowitz SG, Patel DR, Wallweber HJ, Runyon S, Yan M, Yin J, et al. Structures of APRIL-receptor complexes: like BCMA, TACI employs only a single cysteine-rich domain for high affinity ligand binding. J Biol Chem. 2005;280:7218–27.CrossRefPubMedGoogle Scholar
  29. 29.
    Garibyan L, Lobito AA, Siegel RM, Call ME, Wucherpfennig KW, Geha RS. Dominant-negative effect of the heterozygous C104R TACI mutation in common variable immunodeficiency (CVID). J Clin Invest. 2007;117:1550–7.CrossRefPubMedGoogle Scholar
  30. 30.
    Detkova D, Martinez-Pomar N, Arostegui J, Escobar D, Ferrer J, Serra A, et al. Role of the p.C104R variant of TNFRSF13B encoding TACI in patients with common variable immunodeficiency. Clin Exp Immunol. 2008;154(1):158.Google Scholar

Copyright information

© Springer Science+Business Media, LLC 2009

Authors and Affiliations

  • Javad Mohammadi
    • 1
  • Chonghai Liu
    • 1
  • Asghar Aghamohammadi
    • 2
  • Astrid Bergbreiter
    • 4
  • Likun Du
    • 1
  • Jiayi Lu
    • 1
  • Nima Rezaei
    • 2
  • Ali Akbar Amirzargar
    • 5
  • Mostafa Moin
    • 3
  • Ulrich Salzer
    • 4
  • Qiang Pan-Hammarström
    • 1
  • Lennart Hammarström
    • 1
  1. 1.Division of Clinical Immunology, Department of Laboratory MedicineKarolinska Institutet at Karolinska University Hospital HuddingeStockholmSweden
  2. 2.Growth and Development Research Center, Children’s Medical Center HospitalTehran University of Medical SciencesTehranIran
  3. 3.Immunology, Asthma and Allergy Research Institute, Children’s Medical Center HospitalTehran University of Medical SciencesTehranIran
  4. 4.Division of Rheumatology and Clinical Immunology, Medical SchoolUniversity Hospital FreiburgFreiburgGermany
  5. 5.Immunological Laboratory, Department of Immunology, School of MedicineTehran University of Medical SciencesTehranIran

Personalised recommendations