Genetic Resources and Crop Evolution

, Volume 57, Issue 3, pp 357–370 | Cite as

Identification of European and Asian pears using EST-SSRs from Pyrus

Research Article

Abstract

Ten EST-SSRs previously isolated from Pyrus were used to identify 81 P. communis, 13 P. pyrifolia and 20 P. ussuriensis or P. × bretschneideri accessions. Cross-transference of these EST-SSRs was high in these species. PYC-008 and PYC-004 were the least informative SSRs in each of the pear species and were monomorphic in P. pyrifolia while PYC-013, PYC-002 and PYC-009b were the most informative in all species. EST-SSRs were very valuable for identification of incorrectly identified accessions, failed grafts and sets of synonyms in each of the species. Unsuspected relationships were uncovered, including a parental relationship between ‘Anjou’ and ‘Farmingdale’, a clonal relationship between ‘Berger’ and ‘Bartlett’, and a very close relationship between ‘Beurre Superfin’ and ‘Doyenne du Comice’. One SSR marker was different in one of three sports of ‘Doyenne du Comice’ (‘Doyenne du Comice Crimson Gem’) and in one of two sports of ‘Anjou’ (‘Gebhard Red’ red skin sport of ‘Anjou’). UPGMA cluster analysis separated the pear accessions into a large European cluster and an Asian group mostly according to common ancestry, geographical origin or time of ripening. High cross-transference of EST-SSRs in Pyrus species is very valuable for germplasm management in such a highly diverse collection as found at the NCGR Pyrus genebank in Corvallis, OR.

Keywords

Asian pear European pear Expressed sequence tags (ESTs) Microsatellite markers Pyrus Simple sequence repeat (SSR) 

Introduction

Pyrus belongs to the subtribe Pyrinae, tribe Pyreae in the Spiraeoideae subfamily of the Rosaceae (Potter et al. 2007). This genus is believed to have originated during the tertiary periods (65–55 million years ago) in the mountainous area of western and southwestern China and spread east and west from there. Vavilov (1951) identified three centers of diversity for pears: Chinese, Central Asian and Near Eastern/Asia Minor. There are 22 recognized primary Pyrus species (Bell et al. 1996). The European pear, P. communis L., is the most commonly cultivated pear species in Europe, North America, South America, Australia and Africa. They have been cultivated in Europe since as early as 1000 BC. Homer mentioned a pear orchard in the Odyssey written between 900 and 800 BC. The indigenous cultivated species in Asia include P. pyrifolia Nakai, P. ussuriensis Maxim., P. × bretschneideri Rehder and P. × sinkiangensis Yu (Bao et al. 2007). Asian pears have been cultivated in China for at least 3000 years (Lombard and Westwood 1987).

Worldwide production of European pear cultivars is based on ‘heirloom’ varieties released in the late eighteenth or in the nineteenth such as ‘Abbe Fetel’, ‘Bartlett’ (syn. ‘Williams Bon Chretien’ and its sports), ‘Beurré Anjou’, ‘Beurré Bosc’ (syn. ‘Kaiser’), ‘Conference’, ‘Doyenne du Comice’, ‘Packham’s Triumph’ and ‘Passe Crassane’. While ‘Bartlett’ is the most important cultivar of this species worldwide, ‘Packham’s Triumph’ production is a close second in southern hemisphere growing regions (Palmer and Grills 2008; Sanchez 2008) and ‘Conference’ is the dominant cultivar in Europe (Deckers and Schoofs 2008). China accounts for most of the world’s Asian pear production with the P. × bretschneideri cultivars ‘Dong Shan Su Li’, ‘Ya Li’ and ‘Huang Hua Li’ comprising the largest production area (Gemma 2008). The P. pyrifolia cultivars ‘Kosui’ and ‘Hosui’ make up 65% of production area in Japan, followed by ‘Nijisseiki’ and ‘Niitaka’, while ‘Niitaka’ is the primary cultivar in Korea (Gemma 2008).

The U.S. Department of Agriculture (USDA), Agricultural Research Service (ARS) maintains more than 2300 Pyrus accessions with origins in 55 countries at the National Clonal Germplasm Repository in Corvallis, Oregon (Postman 2008). The clonal pear collection consists of 1,781 trees in 5 ha of orchard plantings, with a single tree per accession. More than 300 seedlots, stored in moisture-proof packages at −18°C, represent wild collected Pyrus species populations. Clonal accessions include 844 European cultivars, 144 Asian cultivars, 87 hybrid cultivars and 159 rootstock selections of assorted Pyrus species (Postman 2008).

Microsatellite or simple sequence repeat (SSR) markers have become valuable molecular tools for genetic fingerprinting due to their abundance, high degree of polymorphism, co-dominance and suitability for automation. Genomic microsatellite markers in pear are a recent development (Bassil et al. 2005; Fernández-Fernández et al. 2006; Inoue et al. 2007; Yamamoto et al. 2002a, b, 2005), and have been used for mapping, genotype identification and determination of genetic relatedness. Apple microsatellite markers represent an additional source of markers for pear due to their reported cross transference (Bassil et al. 2009; Hemmat et al. 2003; Monte-Corvo et al. 2000; Yamamoto et al. 2001). Nuclear Pyrus DNA sequences deposited in GenBank represent a ready source of microsatellites from genes or functional regions of the genome and we have used them to generate expressed sequence tag (EST)-SSR markers (Bassil et al. 2005). An added advantage is that since these EST-SSRs occur in the expressed or more conserved region of the genome, they are more transferable to related species than are genomic SSRs (reviewed in Varshney et al. 2005). The aim of this study was to evaluate the usefulness of these EST-SSRs in managing a diverse collection of genotypes from the three most commonly cultivated pear species: P. communis, P. pyrifolia and P. ussuriensis.

Materials and methods

Plant material and DNA extraction

The pear accessions evaluated in this study consisted of 81 P. communis, 13 P. pyrifolia and 20 P. ussuriensis or P. × bretschneideri (Table 1). Many Chinese cultivars are derived from P. ussuriensis or from the hybrid species P. × bretschneideri, and these cultivars in the NCGR collection arrived with many different English spelling permutations of their Chinese names. In the current study, these accessions were analyzed as a single “ussuriensis/bretschneideri” (ussu/bretsch) group, since they could often not be associated with a known cultivar or cultivar group. Some authorities consider P. × bretschneideri to be a subspecies of P. pyrifolia. Five pairs of same name accessions in P. communis that were obtained from different sources had identical fingerprints and were represented by one accession each. The identical pairs were: ‘Beurré Superfin’, ‘Bon Chretien d’Hiver’, ‘Coscia Precoce’, OH × F 333, and ‘Wilder Early’. Identical fingerprints were also found in two ‘Nijisseiki’ accessions, allowing us to discard one of the accessions.
Table 1

List of European and Asian pear genotypes used in this study

Cultivar name

PI no.

Species

Pedigree

Origin

European pears

Abbé Fetel

260195

P. communis

Chance seedling

France ~1866

Allexandrine Douillard

541114

P. communis

Chance seedling

France ~1849

Anjou

617502

P. communis

Chance seedling

Belgium ~1819

Anjou—Columbia Red

617558

P. communis

Sport of Beurré d’Anjou

Hood River, Oregon ~1976

Anjou—Gebhard Red

541248

P. communis

Sport of Beurré d’Anjou

Medford, Oregon <1960

Arganche

264694

P. communis

Uncertain

Yugoslavia <1960

Bartlett

300693

P. communis

Chance seedling

England 1797

Bartlett—Low Chill

617605

P. communis

Sport of Bartlett

South Africa <1980

Bartlett—Max Red

541249

P. communis

Sport of Bartlett

Zillah, Washington 1938

Bella di Giugno

324125

P. communis

Uncertain

Italy ~1700

Belle Lucrative

295091

P. communis

Uncertain

Belgium ~1827

Berger

541359

P. communis

Sport of unknown cultivar

California 1925

Beurré Clairgeau

541133

P. communis

O.P. Duchess D’Angouleme

France 1830

Beurré Gris

541145

P. communis

Unknown

Europe <1650

Beurré Gris d’Hiver Nouveau

541146

P. communis

Shance seedling

France 1830

Beurré Hardy

300691

P. communis

Seedling

France 1830

Beurré Superfin

541150

P. communis

Chance seedling

France 1844

Bon Chretien d’Hiver

255609

P. communis

Unknown

Italy 1495

Brandy

541305

P. communis

Unknown

England 1800

Butirra Precoce Morettini

276764

P. communis

Coscia × Bartlett

Italy <1956

Butirra Rosata Morettini

282935

P. communis

Coscia × Beurré Clairgeau

Italy 1940

Cascade

541472

P. communis

Max Red Bartlett × Comice

Oregon <1986

Clapp Favorite

502171

P. communis

Flemish Beauty × Bartlett

Massachusetts <1860

Coloree de Juillet

264695

P. communis

Uncertain

France 1857

Coscia

541557

P. communis

Uncertain

Italy ~1800

Coscia (Precoce?)

541459

P. communis

Precoce di Cassano × Coscia?

Italy

Coscia Tardive

292656

P. communis

Uncertain

Italy ~1800

Delbard Premiere

Q 21774

P. communis

Akca × Dr. Jules Guyot

France 1955

Delbard Premiere (failed graft)

541524

P. communis

Akca × Dr. Jules Guyot

France 1955

Doyenne de Juillet (Doyenne d’Ete)

260197

P. communis

Uncertain

Belgium 1823

Doyenne du Comice

271658

P. communis

O.P. seedling

France 1849

Doyenne du Comice—4× (not 4×)

541334

P. communis

Purported tetraploid sport of Comice

Uncertain

Doyenne du Comice—Crimson Gem #2

541536

P. communis

Sport of Regal Red Comice

Oregon 1978

Doyenne du Comice—Regal Red

541534

P. communis

Sport of Comice

Oregon 1965

Duchesse d’Angouleme

541303

P. communis

Chance seedling

France 1808

Eletta Morettini

311714

P. communis

Beurré Hardy × Passe Crassane

Italy 1963

Farmingdale

541188

P. communis

Chance seedling—O.P. Anjou?

Illinois 1921

Flemish Beauty (Fondante de Bois)

541189

P. communis

Chance seedling

Belgium 1800

Forelle

541191

P. communis

Uncertain

Germany 1600

Gaspard

617556

P. communis

Unknown—same as Summercrisp?

Minnesota

General Le Clerc

260157

P. communis

Unknown—O. P. Comice?

France 1950

Grand Champion

541197

P. communis

Sport of Gorham (Gorham = Bartlett × Josephine de Malines)

Oregon 1936

Hager Grove Pioneer Pear

617686

P. communis

Uncertain

Oregon 1850

Harrow Sweet (HW 609)

617562

P. communis

Bartlett × (Old Home × Early Sweet)

Ontario 1980

Helmershus Roda

295090

P. communis

Unknown

Sweden

Highland (NY 10274)

541207

P. communis

Bartlett × Comice

New York 1956

Idaho (Mulkey)

541507

P. communis

O.P. seedling

Idaho 1867

Jeanne d’Arc

541553

P. communis

Buerre Diel × Doyenne du Comice

France 1893

Joey’s Red Flesh Pear

617584

P. communis

Unknown

New York

Jubileer D’Ar

541341

P. communis

Clapp Favorite × Klementina

Bulgaria

June Sugar

541501

P. communis

Uncertain

United States

Junsko Zlato

617620

P. communis

Precoce de Trevoux × Doyenne de Juillet

Yugoslavia 1978

Klementinka

392320

P. communis

Unknown

Bulgaria <1974

La France

617638

P. communis

Uncertain

Uncertain

Laxton’s Progress

127039

P. communis

Marie Louise × Bartlett

England 1933

Lemon

541215

P. communis

Unknown

Russia <1879

Lesnaia Krasavitza

292375

P. communis

Uncertain

Russia

Lubenicarka

264696

P. communis

Uncertain

Yugoslavia

Messire Jean

541233

P. communis

Unknown

France 1550

Mirandino Rosso

617639

P. communis

Uncertain

Italy ~1700

Mission La Purisima Pear 17-E

617578

P. communis

Uncertain

California 1846

Mission San Juan Bautista Pear

617683

P. communis

Uncertain

California <1836

Michurin’s Winter Beurré

312503

P. communis

Unknown

Poland (Russia) 1894

Mustafabey

324134

P. communis

Uncertain

Turkey <1960

Norhausen Forelle

172495

P. communis

Uncertain

Germany 1864

Normannischen Ciderbirne

231806

P. communis

Uncertain

France

OH × F 333

541405

P. communis

Old Home × Farmingdale

United States 1952

Old Home

541456

P. communis

Chance seedling

Illinois 1915

Packham’s Triumph

280405

P. communis

Uvedale St. Germain × Bartlett

Australia 1897

Passe Crassane

131662

P. communis

Seedling selection

France 1855

Pautalia

392321

P. communis

Green Magdelene × Beurré Giffard

Bulgaria 1956

President Drouard

CPYR 2341

P. communis

Chance seedling

France 1886

Professor Grosdemage

541246

P. communis

Uncertain

France 1908

Progres

392322

P. communis

Beurré Giffard × Green Magdelene

Bulgaria 1956

Rocha

286384

P. communis

Chance seedling

Portugal (mid 1800s)

Sanguinole

277529

P. communis

Unknown

Germany 1500

Vermont Beauty

541277

P. communis

Chance seedling

Vermont 1885

Wilder Early

541283

P. communis

Chance seedling

New York 1884

Wikler Early

541355

P. communis

Misspelling of Wilder?

 

Zaharoasa de Vara

352661

P. communis

Unknown

Romania (Ukraine?) <1967

Zimska

502169

P. communis

Uncertain

Bosnia

Asian pears

Arirang

541962

P. pyrifolia

Unknown

Korea

Chojuro

97347

P. pyrifolia

Chance seedling

Japan 1889

Kikusui

228014

P. pyrifolia

Taihaku × Nijisseiki

Japan 1927

Kosui

352634

P. pyrifolia

Kikusui × Wasekozo

Japan 1941

Meigetsu

97348

P. pyrifolia

Chance seedling

Japan 1918

Niitaka

392317

P. pyrifolia

Amanogawa × Imamuraaki

Japan 1915

Nijisseiki

224196

P. pyrifolia

Chance seedling

Japan 1888

Seigyoku

228017

P. pyrifolia

Nijiseiki × Chojuro

Japan 1952

Seuri Li

541904

P. pyrifolia

Uncertain

China

Shinko

352635

P. pyrifolia

Seedling of Nijisseiki

Japan 1941

Shinseiki

224087

P. pyrifolia

Nijiesiki × Chojuro

Japan 1945

Shinsui

352636

P. pyrifolia

Kikusui × Kimizukawase

Japan 1947

Singo

617540

P. pyrifolia

Niitaka brought from Japan?

Korea (Japan)

Ba Li Xiang [Ba Li Hsiang]

541985

P. × bretschneideri

Unknown—collected by Meyer in 1916

China, ancient

Cheih Li

541986

P. × bretschneideri

Unknown—collected by Reimer in 1918

China

Chien Li

617537

P. × bretschneideri

Unknown

China (Taiwan?)

Chien Pa Li

541987

P. ussuriensis

Unknown—collected by Reimer in 1918

China

Chinfon Li

654917

P. × bretschneideri?

Unknown—Westwood exchange 1980s

China

Hansen Siberian Pear

542004

P. ussuriensis

Unknown

China

Harbin

542019

P. ussuriensis

Seed collected by N. Hansen in N. China

China 1924

Hung Li

541993

P. × bretschneideri

Unknown hybrid—collected by Reimer in 1918

China

Nan Guo Li [Nan Li]

541997

P. ussuriensis

Seedling selection from Liaoning

China

P. ussuriensis—Korea

542014

P. ussuriensis

O.P. seed

Korea

P. ussuriensis—Korea

542014

P. ussuriensis

O.P. seed

Korea

P. ussuriensis—Korea

542014

P. ussuriensis

O.P. seed

Korea

P. ussuriensis—Manchuria

143978

P. ussuriensis

O.P. seed

China

Pa Li

542010

P. ussuriensis

California of Chinese origin

China

Pai Li (Beijing White Pear)

541998

P. × bretschneideri

Old selection from Beijing Region

China

Ping Guo Li (Pingo Li)

267863

P. × bretschneideri

Old selection from Jilin Province

China

Tang Li

542024

P. ussuriensis

Old russeted pear—collected in north by Reimer in 1918

China

Tse Li

312509

P. × bretschneideri

Shandong Province by way of Poland

China

Tsu Li

542023

P. × bretschneideri

Shandong Province by way of California

China

Xiangshui Li (Hsiang Sui Li)

542022

P. × bretschneideri?

Old selection from Liaoning by way of California

China

Their plant introduction (PI) number, taxon, pedigree and origin are listed. O.P. indicates open pollinated

DNA was extracted from actively growing leaves collected from the NCGR field in the spring using a modified PUREGENE® kit (Gentra Systems Inc., MN) protocol. Proteinase K and RNAse A treatment were added and the protein precipitation step was repeated twice.

Microsatellite marker analysis

Mining for pear microsatellite markers from GenBank was previously described (Bassil et al. 2005). Out of the eighteen primer pairs described in that study, PYC-017 amplified the same locus as PYC-003 and was eliminated; PYC-014 was discarded because it amplified >450 bp fragments; and one of two primer pairs designed from the same sequence was eliminated leaving PYC-007a and PYC-010b. Fluorescently-labeled forward primers for the remaining 14 SSR primers were used for PCR amplification. FAM, HEX, or NED-labeled primers were from Operon Biotechnologies, Inc. (Huntsville, AL) and WellRED primers were from Sigma–Aldrich (St. Louis, MO). PYC-015 was monomorphic in each of the pear accessions and was discarded. The remaining 13 SSRs that amplified in each of the three species evaluated in this study are listed in Table 2.
Table 2

Thirteen EST-SSRs developed from Pyrus sequences in GenBank

Name

Motif

Primers 5′–3′

Linkage group

Expected size

Size ranges in

P. com.

P. pyr.

P. ussur.

PYC-001

(TA)7

F: CGGGATCAGACTACAAGATGTG

R: AGGCTCTAAGGAAGCCCAATAG

341

330–369

337–364

337–387

PYC-002

(CT)10

F: ATGATCCTCCGACTCAGAAATG

R: AATAAGCCACACCAAATCCAAC

9

165

157–201

164–187

157–183

PYC-003

(AT)7

F: TGATGGACAAGTGGAAGTGC

R: GTTTGACAGTAGAACTGAACGACAAA

256

245–277

257–261

253–297

PYC-004

(AT)6

F: GACCTGTGGTTGATGACGTG

R: ATCCAAATTAAGCGACCTCA

8

170

158–172

159

159–168

PYC-005

(CT)11

F: AGAGCAAGGGAGAAGGAAAGAT

R: AATCCCAATCAACTCCAGAGAA

167

153–195

155–177

155–187

PYC-006a

(TC)5

F: TCATTCCTCAACGTTCACACA

R: GTTTCGACGTGAGATTTGAGCTTG

17

120

120–122

118–122

118–122

PYC-007aa

(TCT)7(GT)5

F: TGAAGTTCGAGATGGGTTGA

R: GTTTCATCAAAAGCAAGGGAACA

9, 17

179

177–198

174–213

207

PYC-008

(TG)6

F: GTGCGATCCAATCCAAGAAG

R: GTTTCGAAAAGCAACCCAATCATATC

314

319–321

319

317–321

PYC-009b

(CT)11

F: TACCTGGTTCACTACCCAATGC

R: AATGCTACGAACTAAGCCCAAA

10

302

284–316

286–300

284–320

PYC-010ba

(TTTA)4(TTA)6

F: CACATGGATACTTTGGACAAGC

R: GTTTGGAGTGAAATCTAATCCTTGC

327–339

331–339

331–339

PYC-011a

(AG)7

F: GCCCAGATAGATACCCACAGAG

R: GTTTCGAGGGTGATAGTCTTACCTG

106

107–115

107–119

107–115

PYC-012

(ACA)6

F: ATGCTAGACAGAGCGTGTCCTT

R: GGTCTCTTTCGGTGTAACTTGG

180

175–179

167–181

167–181

PYC-013

(TC)12TT(TC)8

F: CTCTCTCGCTCACTCATCAAA

R: ACAGACCCAAAACCATCAAAAC

1

118

93–123

95–123

101–125

The motif, forward and reverse primers, expected size and observed size ranges in P. communis, P. pyrifolia and P. ussuriensis evaluated in this study. Linkage group locations were kindly provided by Felicidad Fernández-Fernández in an M27 × M116 apple population

aIndicates microsatellite markers were designed from P. pyrifolia sequences

PCR reactions were carried out separately for each primer pair and up to three PCR products (one per SSR primer set) were pooled in a multiplex and separated using capillary electrophoresis. PCR reactions for primers PYC-001, PYC-002, PYC-003, PYC-004, PYC-006, PYC-007a, PYC-009, PYC-012 and PYC-013 were carried out in 10 μl volumes using fluorescently labeled forward primers (FAM, HEX, or NED) and unlabeled reverse primers. The PCR reactions were diluted with water to a factor ranging from 1:80 (FAM-labeled amplicons) to 1:320 (NED-labeled amplicons) and 0.5 μl was injected into an ABI 3100 capillary sequencer (Applied Biosystems, Foster City, Calif.) at the Central Services Laboratory (Oregon State University, Corvallis, Ore.). GeneScan version 2.1 (Applied Biosystems) and Genotyper version 2.0 (Applied Biosystems) were used for automated data collection and computation of allele size and accurate visualization of the alleles, respectively.

The amplification products of the four remaining primers were analyzed using a CEQ 8000 genetic analyzer (Beckman Coulter Inc., Fullerton, Calif.). PCR reactions were carried out in 15 μl volumes for each primer pair using Well-RED-labeled forward primers and unlabeled reverse primers. The optimal amount of PCR product (ranging from 0.05 to 1.5 μl) to inject into the CEQ 8000 genetic analyzer was determined experimentally for each primer pair. Allele sizing and visualization were performed using the fragment analysis module of the CEQ 8000 software (Beckman Coulter Inc.).

PCR reactions contained per 10 μl total volume 1× reaction buffer, 2 mM MgCl2, 0.2 mM dNTPs, 0.3 μM of each primer, 0.25 units of Biolase Taq DNA polymerase (Bioline USA Inc., Randolph, MA), and 2.5 ng genomic DNA. The concentrations of each component in the PCR reaction were adjusted accordingly when the final volume of the reaction was 15 μl. The PCR protocol consisted of one cycle of initial denaturation at 94°C for 3 min, followed by 35 cycles of denaturation at 93°C for 40 s, annealing at optimum Ta (Bassil et al. 2005) for 40 s, and extension at 72°C for 40 s. A final extension cycle at 72°C for 30 min followed. DNA was amplified in an Eppendorf Gradient thermocycler (Brinkmann Instruments, Inc., Westbury, NY) or an MJ Research Tetrad thermocycler (MJ Research Inc., Watertown, MA). The success of the PCR reaction was verified by 2% agarose gel electrophoresis prior to capillary electrophoresis. Up to three PCR products were included in each multiplex.

Data analysis

Three primer pairs (PYC-001, PYC-005, and PYC-007a) that generated more than two PCR amplicons were considered multiple loci-SSRs and were not included in data analysis or clustering. PowerMarker (Version 3.25) (Liu and Muse 2005) was used to determine genetic diversity parameters in the remaining 10 EST-SSRs (Tables 2, 3). These diversity measures consisted of: Number of alleles, A; Heterozygosity Ho, or the number of heterozygous individuals in that population; Gene Diversity, often referred to as expected Heterozygosity, He, and defined as the probability that two randomly chosen alleles from the population are different; and polymorphism information content (PIC) (Botstein et al. 1980). Genetic distance matrices were also computed using PowerMarker with the proportion of shared alleles distance (Dsa):
$$ D_{\text{sa}} = {\frac{1}{m}}\sum\limits_{j = 1}^{m} {\sum\limits_{i = 1}^{aj} {\min (pij,qij)} } $$
where pij and qij are the frequencies of the ith allele at the jth locus, m is the number of loci examined, and aj is the number of alleles at the jth locus. The Unweighted Pair Group Method with Arithmetic mean (UPGMA) method of cluster analysis was used to group accessions (Figs. 1, 2).
Table 3

Diversity parameters of 10 single-locus pear EST-SSR markers

Marker

Allele number (A)

Heterozygosity (Ho)

Gene diversity (He)

PIC

Pyrus

P. com.

P. pyr.

P. ussur.

Pyrus

P. com.

P. pyr.

P. ussur.

Pyrus

P. com.

P. pyr.

P. ussur.

Pyrus

P. com.

P. pyr.

P. ussur.

PYC002

15

10

4

8

0.61

0.69

0.38

0.40

0.82

0.70

0.65

0.70

0.80

0.66

0.59

0.67

PYC003

15

10

3

11

0.43

0.43

0.38

0.45

0.65

0.48

0.33

0.83

0.63

0.45

0.30

0.81

PYC004

5

4

1

2

0.24

0.28

0

0.20

0.44

0.26

0

0.46

0.40

0.24

0

0.35

PYC006

5

2

5

3

0.39

0.36

0.54

0.40

0.39

0.32

0.49

0.52

0.34

0.27

0.46

0.46

PYC008

3

2

1

3

0.06

0.02

0

0.25

0.06

0.02

0

0.22

0.06

0.02

0

0.21

PYC009b

16

7

3

11

0.72

0.72

0.38

0.95

0.75

0.66

0.32

0.84

0.72

0.60

0.29

0.83

PYC010b

5

4

3

3

0.97

0.96

1.00

1.00

0.70

0.51

0.54

0.58

0.65

0.39

0.43

0.49

PYC011

6

5

6

4

0.26

0.30

0.38

0.05

0.61

0.38

0.73

0.23

0.56

0.35

0.69

0.22

PYC0012

5

3

3

4

0.31

0.19

0.46

0.70

0.50

0.19

0.37

0.69

0.47

0.18

0.32

0.63

PYC0013

16

12

4

13

0.77

0.85

0.54

0.60

0.87

0.83

0.71

0.86

0.86

0.81

0.66

0.84

Mean

9.10

5.9

3.3

6.2

0.48

0.48

0.41

0.50

0.58

0.44

0.41

0.59

0.55

0.40

0.37

0.55

Total

91

59

33

62

Allele number (A), observed heterozygosity (Ho), expected heterozygosity (He), and polymorphism information index (PIC) were calculated for each species with PowerMarker

Fig. 1

UPGMA cluster analysis of European pear accessions using the proportion of shared allele distance based on 10 EST-SSRs

Fig. 2

UPGMA cluster analysis of Asian pear accessions using the proportion of shared allele distance based on 10 EST-SSRs

Results

Accessions that had more than two amplicons in the 10 SSRs used were excluded from data analysis. These accessions included two sets of suspected synonyms: ‘Amire Joannet’ and ‘Epargne’; as well as ‘Belle Angevine’, ‘Lange Graticol’, and ‘Pound’. ‘Erabasma’ had three alleles at PYC-003 and PYC-010b and was confirmed as triploid by flow cytometry (unpublished data). Ploidy levels will be determined in other accessions (‘Ecmianka’, ‘Graparon’, ‘Jiugnos’, ‘Limoni’, ‘Perazola’, ‘Poirier Fleurissant Tard’, ‘Rotkottig Frau Ostergotland’, ‘Summer Blood Birne’, ‘Vidovaca’, ‘Zimska Kajusta’, ‘Okusankichi’, ‘Zao Su’, ‘Chin Li’ and ‘Nan Guo Li’) that displayed over two alleles in these 10 SSRs.

The diversity parameters in the 114 pear accessions and in each of the three species groups (81 P. communis, 13 P. pyrifolia and 20 P. ussuriensis/bretschneideri) are shown in Table 3. These 10 SSR loci revealed 91 alleles in pear: 59, 33 and 62 alleles were observed in P. communis, P. pyrifolia and P. ussuriensis/bretschneideri accessions, respectively (Table 3). Ho, He, and PIC were 0.48, 0.58, and 0.55, respectively. PYC-008 and PYC-004 were the least informative SSRs in each of the pear species and were monomorphic in P. pyrifolia while PYC-013, PYC-002 and PYC-009b were the most informative in all species. In fact, these three informative markers were sufficient to distinguish each of the 114 accessions evaluated here with the exception of bud sports and two pairs of related cultivars: ‘Beurré Clairgeau’ and its parent ‘Duchesse d’Angouleme’; ‘Beurre Superfin’ and ‘Doyenne du Comice’; and ‘Seigyoku’ and its parent ‘Chojuro’.

Many pear trees that displayed similar morphological traits or had similar names from different sources were included in this study. ‘Doyenne du Comice’ and two of its sports (‘Regal Red’ and tetraploid ‘4x’) had identical SSR fingerprints but were different from ‘Doyenne du Comice Crimson Gem’ at PYC-009b which was homozygous for the 186 bp allele (as opposed to the 186/188 alleles in the former). Tetraploid ‘Bartlett’ (‘Bartlett 4x’) was different from ‘Bartlett’ and its two sports ‘Bartlett Low Chill’ and ‘Bartlett Max Red’ at PYC-002 and PYC-009b. The ‘Gebhard Red’ red skin sport of ‘Anjou’ had an allele, 111 bp, at PYC-011 that was absent in both standard ‘Anjou’ and ‘Columbia Red’ red skin sport. In each of these three variants (‘Doyenne du Comice Crimson Gem’, ‘Bartlett 4x’, and ‘Anjou Gebhard Red’), proportion of shared alleles distance (Dsa) was >0 as illustrated in the UPGMA dendrogram (Fig. 1).

In addition to most sports of ‘Anjou’, ‘Bartlett’ and ‘Doyenne du Comice’, eight sets of European accessions had identical fingerprints at each of the 10 SSRs and consisted of: (1) ‘Beurré Superfin’, ‘Doyenne du Comice’ and its supposed tetraploid and ‘Regal Red’ sports; (2) ‘Berger’ and ‘Bartlett’ as well as the ‘Low Chill’ and ‘Max Red’ sports of ‘Bartlett’; (3) ‘OHxF 333’ and ‘Zimska’; (4) ‘Flemish Beauty’ and ‘Lesnaia Krasavitza’; (5) ‘Bella di Giugno’ and ‘Mirandino Rosso’; (6) ‘Jubilee d’Ar’ and ‘Pautalia’; (7) ‘Arganche’, ‘Klementinka’, ‘Mustafabey’ and ‘Zaharosa de Vara’; and (8) ‘Forelle’ and ‘Helmershus Roda’.

Asian pear accessions that exhibited identical SSR profiles in this study consisted of P. pyrifolia [‘Arirang’ and ‘Singo’ (CPYR 2343)] and four pairs in P. ussuriensis/bretschneideri [(‘Chien Pa Li’ and ‘Pa Li’); (‘Tang Li’ and ‘Xiangshui Li’); (‘Chieh Li’ and ‘Chien Li’); (‘Tse Li’ and ‘Tsu Li’)].

Two accessions obtained as ‘Delbard Premiere’ from different sources had different allelic composition and clustered separately (Fig. 1). ‘Delbard Premiere’ (CPYR 2132) was received from a private grower in the U.S. and did not match the published description of this cultivar. It had a different allelic composition from ‘Delbard Premiere’ recently imported from a reputable source in France (CPYR 2437) at all but PYC-003, PYC-008 and PYC-013.

UPGMA cluster analysis separated the pear accessions into a large European cluster and an Asian group (Figs. 1, 2). European pears grouped together based on common ancestry, geographical origin or time of ripening (Fig. 1). The first group consisted mostly of cultivars related to ‘Bartlett’, or ‘Doyenne du Comice’ or both (Bartlett Group). The Italian cultivars ‘Coscia’, ‘Butirra Rosata Morritini’ and ‘Butirra Precoce Morettini’ grouped together (Coscia Group). The latter two have ‘Coscia’ as a parent. Early ripening cultivars ‘June Sugar’, ‘Bella di Giugno’, ‘Colorée de Juillet’ and ‘Doyenne de Juillet’ were in the same cluster (Early Group). ‘Farmingdale’ grouped with the ‘Anjou’ Group and had one allele in common with this group at each of the 10 loci.

P. ussuriensis/bretschneideri accessions were separated into three groups (Fig. 2): Group I included all trees derived from P. ussuriensis wild-collected in northern China and Korea, as well as Chinese cultivars that both Hu (1937) and Shen (1980) assign to P. ussuriensis. Group III included only P. × bretschneideri cultivars. Group II included smaller-fruited cultivars that may be intermediate between the above groups, including ‘Nan Guo Li’ usually designated as P. ussuriensis and ‘Ping Guo Li’ which is designated as P. × bretschneideri.

The P. pyrifolia cultivars formed a sister group to Group III of P. × bretschneideri. These cultivars clustered according to pedigree with the exception of ‘Meigetsu’ and ‘Seuri Li’ which grouped closely. Although ‘Seuri Li’ came from China and ‘Meigetsu’ is from Japan, both produce russeted, late-ripening fruit, have similar tree phenotypes and resemble other Japanese P. pyrifolia cultivars. Full sibs ‘Seigyoku’ and ‘Shinseiki’ grouped with their parents ‘Chojuro’ and ‘Nijisseiki’.

Alleles that were specific to European or to Asian pear were present at all SSR loci except for PYC-008 and PYC-011 (Table 4). The 118 bp allele of PYC-006 was only amplified in Asian species while no unique alleles were present in European pear at this locus. One to six species-specific alleles were observed when using these accessions in each of the species (Table 4). P. communis-specific alleles were absent in PYC-006, PYC-008 and PYC-011. It is interesting to note that primer sequences for PYC-006 and PYC-011 were designed from P. pyrifolia sequences (Bassil et al. 2005). Alleles specific to P. pyrifolia were only present at these two loci (PYC-006 and PYC-011) and at the highly polymorphic PYC-013. P. ussuriensis-specific alleles were absent at four (PYC-004, PYC-006, PYC-010b, and PYC-011) out of the 10 SSRs (Table 4).
Table 4

Alleles that are specific to European or Asian species at each of the 10 EST-SSR loci evaluated

 

Specific alleles (bp) in

P. communis

Asian species

PYC002

165, 167, 169, 181, 197, 201

164

PYC003

245, 255, 258, 265

261

PYC004

158, 170, 172

159

PYC006

118

PYC008

PYC009b

288, 294, 316

300

PYC010b

327, 333

331

PYC011

PYC0012

179

167, 181

PYC0013

93

105

Discussion

Ten out of the thirteen EST-SSRs developed appear to amplify single loci in the pear genome since they generated up to two DNA fragments in each of the diploid accessions evaluated in this study. Presence of PYC-007 in two locations in the pear genome was confirmed by mapping to linkage groups 9 and 17 of an M27 × M116 apple population (Felicidad Fernández-Fernández, personal communication). The dinucleotide motif in PYC-001 was found in the 3′UTR of the polygalacturonase PC-PG2, one of three PG enzymes isolated from pear (Sekine et al. 2006). The forward primer of PYC-001 was designed from the coding region that is usually conserved in the three pear genes. Generating up to four products with this primer pair could have resulted from amplification of two to three of these enzymes. Unfortunately, PYC-001 and PYC-003 could not be mapped in M27 × M116 and amplification of multiple loci awaits additional mapping efforts in different populations.

Cross-transference of the thirteen pear EST-SSRs was high. Each one of these SSRs amplified and was mostly polymorphic in P. communis, P. pyrifolia and P. ussuriensis. However, PYC-004 and PYC-008 were the least informative SSRs and were monomorphic in P. pyrifolia. Presence of a single allele at these two loci could be caused by the small number (13) of P. pyrifolia accessions in this study and the close ancestral relationship of 11 of them (except for ‘Meigetsu’ and ‘Seuri Li’). Polymorphism at PYC-008 was also very low in P. communis in which only two alleles were found in 86 accessions. Overall diversity parameters of the 10 EST-SSRs in the 114 pear accessions were on average: A = 9.1 allele per locus, Ho = 0.48, He = 0.58 and PIC = 0.55. Using nine genomic SSR markers from ‘Housui’ or ‘Bartlett’ to identify 58 accessions of P. communis, P. pyrifolia, P. ussuriensis, P. calleryana Decne., P. × bretschneideri, and P. × sinkiangensis, the average number of alleles was 14.8 and Ho was 0.63 (Kimura et al. 2002). The lower diversity parameters observed in EST-SSRs as opposed to genomic SSRs in pear was also observed in other plants (reviewed by Varshney et al. 2005) and is the result of greater DNA sequence conservation in transcribed regions. According to Cordeiro et al. (2001), EST-derived microsatellites, while highly transferable, are less polymorphic within source and target species as there is selective pressure for sequence conservation in regulatory and functional genes. When comparing the transferability of 14 Pinus taeda L. (loblolly pine) EST-SSRs from public domain databases and 99 traditional microsatellite markers (including seven genomic SSRs), Liewlaksaneeyanawin et al. (2004) found that EST-SSRs had higher transfer rates than the traditional microsatellite markers. Similar results were also obtained in coffee (Baruah et al. 2003; Aggarwal et al. 2007). High cross-transference of EST-SSRs among closely related genera has been reported in many more fruit species such as kiwi (Huang et al. 1998), strawberry (Bassil et al. 2006a, b), apricot and grape (Decroocq et al. 2003). The greater homology of these markers across species compared with genomic markers obtained from non-coding regions of the genome should lead to widespread use for germplasm identification in a genebank setting and more accurate marker-trait associations.

In a genebank, accessions are obtained from many different sources. Some redundancy is intentionally acquired, for example if a cultivar is available from several sources and it is uncertain which is correctly identified. In the case of ‘Delbard Premier’ the NCGR clone from a U.S. source was suspected to be incorrect, and was discarded when the SSR fingerprint did not match another clone with a more likely phenotype. Unintended redundancy can result when a cultivar is given different names in different places, or when the name is translated or transliterated into another language. Four NCGR pear accessions with distinctive, high quality, early ripening fruit were suspected to be the same cultivar after they exhibited nearly identical bloom and fruit maturity phenology and similar disease resistance ratings following genebank evaluations. ‘Arganche’ from Macedonia (PI 264694), ‘Klemintinka’ from Bulgaria (PI 392320), ‘Mustafabey’ from Turkey (PI 324134) and ‘Zaharoasa de Vara’ from Romania (PI 352661) were confirmed as synonyms with identical SSR fingerprints in this study. ‘Helmershus Roda’ from Sweden (PI 295090) appeared to be identical to the very old German cultivar ‘Forelle’ (PI 541189), and the identical SSR fingerprints provide the confidence needed to discard one of these accessions. Propagation failures, where a rootstock is mistakenly grown instead of a cultivar, are another source of genebank identity problems. We found the Bosnian cultivar ‘Zimska’ (PI 502169) to share an identical SSR pattern with the rootstock clone OHxF 333 (PI 541405), which is the rootstock used to propagate all pear clones at NCGR. This misidentified ‘Zimska’ accession was discarded as a result of this work. ‘Old Home’ (PI 541456) is one of the parents of OHxF 333, and grouped closely to this rootstock clone as expected. OHxF 333 also shared one allele with either ‘Old Home’ or ‘Farmingdale’, thus confirming its parentage. ‘Farmingdale’ originated in Farmingdale, Illinois in 1921, and is said to closely resemble ‘Anjou’. ‘Anjou’ and its sports grouped very close to ‘Farmingdale’ which shared one allele at each SSR locus with ‘Anjou’ suggesting that ‘Farmingdale’ almost certainly originated as a seedling of ‘Anjou’. The Russian cultivar ‘Lesnaia Krasavitza’ (PI 292375) translates to “Forest Beauty” in English, and appeared to be identical to the Belgian cultivar ‘Flemish Beauty’ (= ‘Fondante de Bois’) (PI 541189), and the two Italian cultivars ‘Mirandino Rosso’ (PI 617639) and ‘Bella di Guigno’ (PI 324125) are supposed to be synonyms. The SSR fingerprints confirmed these two sets of synonyms. The early season Bulgarian cultivars ‘Jubileer D’Ar’ and ‘Pautalia’ had identical SSR patterns (Fig. 1), however their pedigrees are unrelated, indicating either an identity error for one or incorrect pedigree information. Both of these clones as growing at NCGR have identical phenotypes. They are among the earliest in the world germplasm collection to ripen their fruit, which are small (about 6 cm long), green ripening to almost yellow, with scattered russet and offset peduncles that are about 2.5 cm long and swollen at the base. ‘Berger’ and ‘Bartlett’ also had identical fingerprints in this study. ‘Berger’ was released by Luther Burbank in 1926 (Postman 1997) as a sport of an unknown cultivar. Either the source of the sport was ‘Bartlett’, the ‘Berger’ clone is misidentified, or a sample mix-up occurred in this study. The trees and the fruits are distinctly different in the orchard, and fresh DNA samples are being prepared for SSR analysis.

One cannot always be certain whether slight name differences are the result of spelling errors or of two unique cultivars with similar names. In the case of ‘Wilder Early’/’Wikler Early’ and ‘Chieh Li’/’Chien Li’ we were able to show that these are spelling errors and that the similarly spelled clones are identical. ‘Singo’ is a synonym for ‘Niitaka’ yet one accession of ‘Singo’ (CPYR 2343) grouped with ‘Arirang’ (Fig. 2), indicating that it is misidentified.

‘Beurré Superfin’ (PI 541150) was found to have SSR patterns identical to several clones of ‘Doyenne du Comice’ (Fig. 1). While these cultivars are both of French origin from the mid-1800s, and very highly esteemed with fine, melting flesh and a similar late fall fruit maturity date, the size and shape of the fruits are quite distinct. These two cultivars were also examined at the National Fruit Collection in England and found to have identical SSR patterns at many loci, however they differed at a few loci not used in our study (Kate Evans, personal communication). Their similar SSR-based genomic composition suggests that the two share a common lineage.

Sports are presumed to be the result of a mutation that results in a small difference in an otherwise identical cultivar. Sports were reported in grapes (‘Pinot’ for example) and in apples (‘Gala’ and its sports). In some cases, clonal polymorphism was caused by retrotransposon activity in grape (Kobayashi et al. 2004) and in apple (Venturi et al. 2006). In other cases, polymorphism revealed by some single microsatellite primer pairs that generated triallelic markers resulted from chimeras in grapevine (Franks et al. 2002; Riaz et al. 2002; Hocquigny et al. 2004). Microsatellite markers have at times succeeded and other times failed at discriminating clones (Franks et al. 2002; Riaz et al. 2002). We could not distinguish between ‘Bartlett’ and its low chill and red skin sports, ‘Anjou’ and one of its red skin sports, and ‘Comice’ and two of its sports. However the sports ‘Gebhard Red Anjou’ and ‘Crimson Gem Comice’ differed at a single locus from their parent clones. We did not observe in either case the appearance of a third allele at one of the single loci, indicating periclinal chimera as the cause of the sport as was observed in grapevine.

The proportion of shared alleles measure used in this study is well suited for use with highly variable loci and unnatural populations like those present in a germplasm repository. This measure does not make assumptions about the populations under study or the frequency of alleles within that population. UPGMA clustering based on this distance measure separated European from Asian pear as previously observed in other SSR-based analyses (Kimura et al. 2002), RAPD markers (Oliveira et al. 1999; Monte-Corvo et al. 2000; Teng et al. 2002), and AFLP markers (Monte-Corvo et al. 2000) in pear. Several pairs showing parent-offspring relationships were grouped together.

In this study, some alleles were shared in the Asian species as previously reported (Bao et al. 2007; Yamamoto et al. 2002a) while some alleles were specific to each of the three species (Table 4). These data can be used to distinguish accessions from each of these species. The higher polymorphism and diversity parameters of PYC-006 and PYC-011 in the focal species, P. pyrifolia, as compared to the other two species was previously observed (Ellegren et al. 1995; Di Gaspero et al. 2000), and was explained as ascertainment bias in the selection of the loci analyzed. Microsatellites chosen on the basis of longer repeats or higher polymorphism in one species were generally found to contain shorter repeats in related species and were consequently less polymorphic. When sequencing PCR products of two markers across a number of Actinidia Lindl. species Fraser et al. (2005) showed that the microsatellite repeat was present in all the species tested, and of variable length. However, the chosen repeat region was longer in the source species [A. deliciosa (A. Chev.) C. F. Liang et A. R. Ferguson and A. chinensis Planch.] than in the other species.

The results obtained in our study showed clearly that EST databases are useful sources for SSR markers. Furthermore, since EST-SSRs exist within genes, they may provide ‘perfect’ genetic markers and are more transferable between species than genomic SSRs (Röder et al. 1995). They are ideal for addressing issues of immediate importance in managing a diverse collection of germplasm accessions: identifying errors, evaluating new potential accessions, and ensuring maximum diversity of core collections.

Notes

Acknowledgments

We acknowledge Barbara Gilmore, Christine Neou-Anderson, and April Nyberg for technical assistance in microsatellite marker separation. Funding for this study was provided by the USDA-ARS CRIS 5358-21000-033-00D and a USDA-ARS National Plant Germplasm System Evaluation Grant.

References

  1. Aggarwal R, Hendre P, Varshney R, Bhat P, Krishnakumar V, Singh L (2007) Identification, characterization and utilization of EST-derived genic microsatellite markers for genome analyses of coffee and related species. Theor Appl Genet 114:359–372CrossRefPubMedGoogle Scholar
  2. Bao L, Chen K, Zhang D, Cao Y, Yamamoto T, Teng Y (2007) Genetic diversity and similarity of pear (Pyrus L.) cultivars native to East Asia revealed by SSR (simple sequence repeat) markers. Genet Resour Crop Evol 54:959–971CrossRefGoogle Scholar
  3. Baruah A, Naik V, Hendre PS, Rajkumar R, Rajendrakumar P, Aggarwal RK (2003) Isolation and characterization of nine microsatellite markers from Coffea arabica (L.) showing wide cross-species amplifications. Mol Ecol Notes 3:647–650CrossRefGoogle Scholar
  4. Bassil NV, Postman JD, Neou C (2005) Pyrus microsatellite markers from GenBank sequences. Acta Hortic 671:289–292Google Scholar
  5. Bassil NV, Gunn M, Folta K, Lewers K (2006a) Microsatellite markers for Fragaria from ‘Strawberry Festival’ expressed sequence tags. Mol Ecol Notes 6:473–476CrossRefGoogle Scholar
  6. Bassil NV, Njuguna W, Slovin JP (2006b) EST-SSR markers from Fragaria vesca L. cv. Yellow Wonder. Mol Ecol Notes 6:806–809CrossRefGoogle Scholar
  7. Bassil N, Hummer K, Postman J, Fazio G, Baldo A, Armas I, Williams R (2009) Nomenclature and genetic relationships of apples and pears from Terceira Island. Genet Resour Crop Evol 56:339–352CrossRefGoogle Scholar
  8. Bell RL, Quamme HA, Layne REC, Skirvin RM (1996) Pears. In: Janick J, Moore JN (eds) Fruit breeding, volume I: tree and tropical fruits. Wiley, New York, pp 441–514Google Scholar
  9. Botstein D, White RL, Skolnick M, Davis RW (1980) Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am J Hum Genet 32:314–331PubMedGoogle Scholar
  10. Cordeiro GM, Casu R, McIntyre CL, Manners JM, Henry RJ (2001) Microsatellite markers from sugarcane (Saccharum spp.) ESTs cross transferable to erianthus and sorghum. Plant Sci 160:1115–1123CrossRefPubMedGoogle Scholar
  11. Deckers T, Schoofs H (2008) Status of pear production in Europe. Acta Hortic 800:95–105Google Scholar
  12. Decroocq V, Favé MG, Hagen L, Bordenave L, Decroocq S (2003) Development and transferability of apricot and grape EST microsatellite markers across taxa. Theor Appl Genet 106:912–922PubMedGoogle Scholar
  13. Di Gaspero G, Peterlunger E, Testolin R, Edwards KJ, Cipriani G (2000) Conservation of microsatellite loci within the genus Vitis. Theor Appl Genet 101:301–308CrossRefGoogle Scholar
  14. Ellegren H, Primmer CR, Sheldon BC (1995) Microsatellite “evolution”: directionality or bias? Nat Genet 11:360–362CrossRefPubMedGoogle Scholar
  15. Fernández-Fernández F, Harvey NG, James CM (2006) Isolation and characterization of polymorphic microsatellite markers from European pear (Pyrus communis L.). Mol Ecol Notes 6:1039–1041CrossRefGoogle Scholar
  16. Franks T, Botta R, Thomas MR (2002) Chimerism in grapevines: implications for cultivar identity, ancestry and genetic improvement. Theor Appl Genet 104:192–199CrossRefPubMedGoogle Scholar
  17. Fraser LG, McNeilage MA, Tsang GK, Harvey CF, De Silva H (2005) Cross-species amplification of microsatellite loci within the dioecious, polyploid genus Actinidia (Actinidiaceae). Theor Appl Genet 112:149–157CrossRefPubMedGoogle Scholar
  18. Gemma H (2008) Recent situation of pear industry in Asia. Acta Hortic 800:71–78Google Scholar
  19. Hemmat M, Weeden N, Brown S (2003) Mapping and evaluation of Malus  × domestica microsatellites in apple and pear. J Am Soc Hortic Sci 128:515–520Google Scholar
  20. Hocquigny S, Pelsy F, Dumas V, Kindt S, Heloir M-C, Merdinoglu D (2004) Diversification within grapevine cultivars goes through chimeric states. Genome 47:579–589CrossRefPubMedGoogle Scholar
  21. Hu CC (1937) The variety and distribution of pears in China. Nanking J 7:103–193Google Scholar
  22. Huang WG, Cipriani G, Morgante M, Testolin R (1998) Microsatellite DNA in Actinidia chinensis: isolation, characterisation, and homology in related species. Theor Appl Genet 97:1269–1278CrossRefGoogle Scholar
  23. Inoue E, Matsuki Y, Anzai H, Evans K (2007) Isolation and characterization of microsatellite markers in Japanese pear (Pyrus pyrifolia Nakai). Mol Ecol Notes 7:445–447CrossRefGoogle Scholar
  24. Kimura T, Shi YZ, Shoda M, Kotobuki K, Matsuta N, Hayashi T, Ban Y, Tamamoto T (2002) Identification of Asian pear varieties by SSR analysis. Breed Sci 52:115–121CrossRefGoogle Scholar
  25. Kobayashi S, Goto-Yamamoto N, Hirochika H (2004) Retrotransposon-induced mutations in grape skin color. Science 304:982CrossRefPubMedGoogle Scholar
  26. Liewlaksaneeyanawin C, Ritland CE, El-Kassaby YA, Ritland K (2004) Single-copy, species-transferable microsatellite markers developed from loblolly pine ESTs. Theor Appl Genet 109:361–369CrossRefPubMedGoogle Scholar
  27. Liu K, Muse SV (2005) Powermarker: Integrated analysis environment for genetic marker data. Bioinformatics 21:2128–2129CrossRefPubMedGoogle Scholar
  28. Lombard PB, Westwood MN (1987) Pear rootstocks. In: Rom RC, Carlson RF (eds) Rootstocks for fruit trees. Wiley, New York, pp 145–183Google Scholar
  29. Monte-Corvo L, Cabrita L, Oliveira C, Leitāo J (2000) Assessment of genetic relationships among Pyrus species and cultivars using AFLP and RAPD markers. Genet Resour Crop Evol 47:257–265CrossRefGoogle Scholar
  30. Oliveira CM, Mota M, Monte-Corvo L, Goulão L, Silva DM (1999) Molecular typing of Pyrus based on RAPD markers. Sci Hortic 79:163–174CrossRefGoogle Scholar
  31. Palmer JW, Grills A (2008) Status and trends within the pear industries in New Zealand and Australia. Acta Hortic 800:63–70Google Scholar
  32. Postman JD (1997) Pear in the Brooks and Olmo register of fruit & nut varieties, 3rd edn. ASHS, Alexandria, p 520Google Scholar
  33. Postman JD (2008) World Pyrus collection at USDA genebank in Corvallis, Oregon. Acta Hortic 800:527–533Google Scholar
  34. Potter D, Still SM, Grebenc T, Ballian D, Božič G, Franjiæ J, Kraigher H (2007) Phylogenetic relationships in tribe Spiraeeae (Rosaceae) inferred from nucleotide sequence data. Plant Syst Evol 266:105–118CrossRefGoogle Scholar
  35. Riaz S, Garrison KE, Dangl GS, Boursiquot J-M, Meredith CP (2002) Genetic divergence and chimerism within ancient asexually propagated winegrape cultivars. J Am Soc Hortic Sci 127:508–514Google Scholar
  36. Röder MS, Plaschke J, König SU, Börner A, Sorrells ME, Tanksley SD, Ganal MW (1995) Abundance, variability and chromosomal location of microsatellites in wheat. Mol Gen Genet 246:327–333CrossRefPubMedGoogle Scholar
  37. Sanchez EE (2008) Recent situation of the pear industry in South America. Acta Hortic 800:79–82Google Scholar
  38. Sekine D, Munemura I, Gao M, Mitsuhashi W, Toyomasu T, Murayama H (2006) Cloning of cDNAs encoding cell-wall hydrolases from pear (Pyrus communis) fruit and their involvement in fruit softening and development of melting texture. Physiol Plant 126:163–174CrossRefGoogle Scholar
  39. Shen T (1980) Pears in China. HortScience 15:13–17Google Scholar
  40. Teng Y, Tanabe K, Tamura F, Itai A (2002) Genetic relationships of Pyrus species and cultivars native to East Asia revealed by randomly amplified polymorphic DNA markers. J Am Soc Hortic Sci 127:262–270Google Scholar
  41. Varshney RK, Graner A, Sorrells ME (2005) Genic microsatellite markers in plants: features and applications. Trends Biotechnol 23:48–55CrossRefPubMedGoogle Scholar
  42. Vavilov NI (1951) The origin, variation, immunity and breeding of cultivated plants. Chron Bot 13:1–366 (translated by K. Start)Google Scholar
  43. Venturi S, Dondini L, Donini P, Sansavini S (2006) Retrotransposon characterisation and fingerprinting of apple clones by S-SAP markers. Theor Appl Genet 112:440–444CrossRefPubMedGoogle Scholar
  44. Yamamoto T, Kimura T, Sawamura Y, Kotobuki K, Ban Y, Hayashi T, Matsuta N (2001) SSRs isolated from apple can identify polymorphism and genetic diversity in pear. Theor Appl Genet 102:865–870CrossRefGoogle Scholar
  45. Yamamoto T, Kimura T, Sawamura Y, Manabe T, Kotobuki K, Hayashi T, Ban Y, Matsuta N (2002a) Simple sequence repeats for genetic analysis in pear. Euphytica 124:129–137CrossRefGoogle Scholar
  46. Yamamoto T, Kimura T, Shoda M, Ban Y, Hayashi T, Matsuta N (2002b) Development of microsatellite markers in the Japanese pear (Pyrus pyrifolia Nakai). Mol Ecol Notes 2:14–16CrossRefGoogle Scholar
  47. Yamamoto T, Kimura T, Sawamura Y, Nishitani C, Ohta S, Adachi Y, Hirabayashi T, Liebhard R, Gessler C, van de Weg WE, Hayashi T (2005) Genetic linkage maps of European and Japanese pear. Poster Presentation. Plant and Animal Genome XIII. Available at: http://www.intl-pag.org/13/abstracts/PAG13_P510.html

Copyright information

© US Government 2009

Authors and Affiliations

  1. 1.United States Department of Agriculture (USDA), Agricultural Research Service (ARS), National Clonal Germplasm Repository (NCGR)CorvallisUSA

Personalised recommendations