Advertisement

European Journal of Plant Pathology

, Volume 149, Issue 1, pp 227–237 | Cite as

Occurrence and phylogenetic analysis of allexiviruses identified on garlic from China, Spain and Poland commercially available on the polish retail market

  • Maria Bereda
  • Elżbieta Paduch-Cichal
  • Elżbieta Dąbrowska
Open Access
Article

Abstract

Garlic plants can be infected by different viruses including eight which belong to the genus Allexivirus, family Alphaflexiviridae. The aim of the research conducted was to detect and identify the allexiviruses GarV-A, GarV-B, GarV-C, GarV-D, GarV-X, GarMbFV and ShVX in garlic (Allium sativum L.) bulbs imported into Poland from China and Spain, and those growing in Poland by ELISA (enzyme-linked immunosorbent assay) as well as reverse transcription polymerase chain reaction (RT-PCR). Bulbs tested were infected with one or more viruses, including species not previously recorded in Poland. Present in various combinations from 146 garlic bulbs were 83 virus isolates representing Garlic virus A, B, D, X and GarMbFV. The most genetically distinct population comprises isolates of GarV-X, while isolates of GarV-B and GarV-D seem to be genetically more uniform. GarMbFV isolates are also genetically uniform, except for isolates from South Korea and Argentina. The high sequence identity of isolates from China, Spain and Poland, detected in this study, probably results from the transmission of the viruses via a vector.

Keywords

Allexiviruses Imported garlic Virus vector Phylogenetic analysis 

Allium sativum L. belongs to the family Liliaceae. It is one of the oldest crop plants and it is not only a valued spice plant, but also a major pharmaceutical raw material due to its health properties (Marjanowski 1988). The conditions in Poland are beneficial for the cultivation of garlic, which results in an increased area of garlic crops for direct consumption and the processing industry. The domestic production of garlic is about 15–20,000 tons and is conducted on an area of around 3000 ha. Apart from domestic garlic crops, material from different parts of the world is also available on the Polish retail market. In recent years garlic has been imported mainly from China and Spain.

Because garlic bulbs do not produce viable seed, they are propagated vegetatively. Therefore garlic is susceptible to the accumulation of a range of viruses, including members of the genera Potyvirus, Carlavirus and Allexivirus. Elimination of these pathogens is problematic, because it involves the production of virus-free plants by meristem-tip culture (Conci et al. 2010).

Allexiviruses formed the most sizable group of garlic viruses. The serious damage of viruses from the genus Allexivirus in garlic cultivations is mainly due to a significant decrease of crop quality (Cafrune et al. 2006; Perotto et al. 2010).

The Allexivirus genus comprises: Garlic mite-borne filamentous virus (GarMbFV), Garlic virus A (GarV-A), Garlic virus B (GarV-B), Garlic virus C (GarV-C), Garlic virus D (GarV-D), Garlic virus E (GarV-E), Garlic virus X (GarV-X) and Shallot virus X (ShVX) (King et al. 2012). Allexiviruses were first detected in shallot in Russia (Vishnichenko et al. 1993). They are now known to occur in various parts of the world. The allexiviruses have been recorded in garlic (Allium sativum L.) plants in Argentina (Conci et al. 1992), Japan (Sumi et al. 1993), Russia (Vishnichenko et al. 1993), Korea (Song et al. 1997), Greece (Dovas et al. 2001), Italy (Dovas and Vovlas 2003), Brazil (Melo-Filho et al. 2004), China (Chen et al. 2004), Spain (Tabanelli et al. 2004), the Czech Republic (Klukáčková et al. 2007), Iran (Shahraeen et al. 2008), New Zealand (Ward et al. 2009), the USA (Gieck et al. 2009), Australia (Wylie et al. 2012), Poland (Chodorska et al. 2012, 2013), Sudan (Mohammed et al. 2013), India (Singh et al. 2014) and Ethiopia (Jemal et al. 2015).

Research on allexiviruses in Poland has been conducted since 2010. Chodorska et al. (2012, 2013) detected GarV-A, GarV-B, GarV-C, GarV-D, GarV-E and GarV-X in garlic bulbs collected from production fields located in five geographical districts of Poland: northern (Pomerania province), east-central (Mazovia and Łódź provinces), west-central (Wielkopolska province), southern (Małopolska and Silesia provinces) and south-western (Lower Silesia and Opole provinces). In a recent study ShVX was detected in A. caeruleum in Poland (Bereda and Paduch-Cichal 2016). To-date, only GarMbFV has not been detected in Poland.

Plant pathogens are difficult to control because their populations are variable in time, space, and genotype. In order to combat the losses they cause, it is necessary to define the problem and seek remedies. The tasks of the State Plant Health and Seed Inspection Service in Poland related to phytosanitary supervision include control and prevention of spread of harmful organisms, support for agricultural producers with the control of hostile organisms and the assurance of the appropriate health standards of plant material marketed in Poland and moved to other Member States of the European Union (EU) or exported outside the EU. However, control of garlic crops is difficult due to the possibility of the use of imported garlic bulbs as propagating material without the rules of phytosanitary control being followed.

Therefore, the first stage of our research involved checking for the occurrence of GarV-A, GarV-B, GarV-C, GarV-D, GarV-X, GarMbFV and ShVX in garlic plants from Chinese, Spanish and Polish crops commercially available in Poland using ELISA tests (enzyme-linked immunosorbent assay) as well as the RT-PCR technique (reverse transcription polymerase chain reaction). Isolates selected from positive samples were sequenced and used for further analysis.

From 2015 to 2016 garlic bulbs imported from China and Spain were collected from retail stores in Warsaw, Central Poland. Also garlic bulbs originating from Poland available in retail fruit and vegetable stores were collected. A total of 146 bulb samples were tested. Virus detection was first performed by DAS-ELISA with specific antibodies against GarV-A, GarV-B, GarV-C and ShVX obtained from Leibniz Institut DSMZ-German Collection of Microorganisms and Cell Cultures (Braunschweig, Germany). Samples were prepared by grinding 0.5 g of fresh leaves or bulbs in phosphate buffer saline supplemented with 2% polyvinylpyrrolidone and 0.2% egg albumin in the ratio of 1:10 (w:v) and tested according to the manufacturer’s protocol. After 1 h of incubation at room temperature, substrate hydrolysis was measured as the change in absorbance at OD 405 nm using an Infinite 200Pro microplate reader (Tecan, Austria GmbH). Samples were considered positive if their optical density (OD 405 nm) readings were at least twice those of healthy controls.

Total RNA was extracted from the positive samples using the silica capture (SC) method described originally by Boom et al. (1990) and adapted to the diagnosis of plant viruses by Malinowski (1997) and quantified by spectrophotometric measurement. RNA extracts were subjected to translation and amplification by reverse transcription-polymerase chain reaction (RT-PCR) using the Transcriptor One-Step RT-PCR Kit (Roche Applied Science, Germany). RT-PCR with total RNA and appropriate primers (Table 1) was used to confirm DAS-ELISA results and to detect and identify isolates of GarV-D, GarV-X and GarMbFV in garlic plants. A specific primer pair was designed by the authors from consensus sequences available in GenBank sequence database and synthesized for amplifying the region including complete capsid protein (CP) and nucleic acid binding protein (NABP) genes of GarV-A, GarV-B, GarV-C, GarV-D and GarV-X. The primer pair for detection of ShVX was designed in the open reading frame I (ORFI, replicase), and the primer pair for GarMbFV detection was designed in the part of the coat protein gene. The positive and negative controls in ELISA test and RT-PCR were from the commercial ELISA kit (DSMZ, Braunschweig, Germany). After RT-PCR, amplicons of the expected size were ligated to the pCRTM4-TOPO vector in accordance with the manufacturer’s instructions (Invitrogen, Carlsbad, CA, USA). Two clones of each isolate were sequenced in both directions with universal T3 and T7 primers. The nucleotide sequences were determined using an ABI 3730 Genetic Analyzer (Applied Biosystems, Foster City, CA). Sequence data were assembled using DNA Baser Sequence Assembler ver. 4 (Heracle BioSoft, Romania). Sequence alignments were constructed in MEGA ver. 5 (Tamura et al. 2011). Sequences of other isolates used in this study, originating from different parts of the world, were retrieved from GenBank. Sequence similarity and identity analysis was performed in BioEdit (Hall 1999). Phylogenetic trees were constructed with MEGA5 using the maximum-likelihood (ML) and neighbor joining (NJ) methods with 1000 bootstrap replications. Shallot virus X was used as outgroup.
Table 1

Primer sequences used for detection and identification of GarV-A, GarV-B, GarV-C, GarV-D, GarV-X, GarMbFV and ShVX

Virus

Primer sequence

Product size (bp)

Primer position in the reference sequence/the accession number of the reference sequence

The accession numbers of the sequences that were aligned to design the primers

GarV-A

TGTCTCGCGCTCCTACATCAGAA

TCTGGGGACAATAGTTGTTGCAAGGT

1330

7280–7302

8657–8632

(AB010300.1)

AF478197.1, AB010300.1, KF632716.1

GarV-B

TTGTGTTAAGTTTGGAYTTGGGTTGA

TGATATCAACAGCATGGGTGTCTT

1216

7024–7049

8288–8265

(KM379144.1)

KM379144.1, JN019813.1, AF543829.1, AB010301.1

GarV-C

AGTGATTTGSAMCCATAYCAAGC

TAGTAATATCAACAAGCATGGGTGT

1557

6756–6778

8359–8335

(JQ899448.1)

JQ899448.1, JQ899447.1, JN019814.1, AB010302.1

GarV-D

AATCTACGATGATGGCTACCTTT

TTCACGTCCAGAACCCTGTA

1337

6983–7005

8361–8342

(KF555653.1)

AF519572.1, AB010303.1, JN019815.1

GarV-X

ATCAGAGAYGARGTACTATGTTAAGT

TTGTCCATGTCCAGAGCCCT

1195

6807–6832

8046–8027

(U89243.1)

U89243.1, KF530328.1, JX429971.1, JX429969.1, JQ807994.1, AJ292229.1

GarMbFV

ATGAACGACCCTGTTGACC

TCAGAACGTAATCATGGGAG

721

1–19

759–740

(X98991.1)

X98991.1

ShVX

ACCGAAATCACAGTTAACTCCTTTGG

TCTACGGTTGTCGATTTTGTGCGT

800

1860–1885

2708–2685

JX310755.1

JX310755.1, M97264.1

All tested plants were infected with at least two allexiviruses (Table 2). The presence of GarV-A, GarV-B and GarV-C was detected by DAS-ELISA and confirmed by RT-PCR. Products of the expected size were amplified only from the DAS-ELISA-positive samples. RT-PCR with the appropriate primers also revealed the presence of GarV-D, GarV-X and GarMbFV in tested garlic materials. GarMbFV was not previously identified from Poland, and the other allexivirus species were identified from Poland only recently (Chodorska et al. 2012, 2013). According to our knowledge, GarMbFV had been detected in Argentina (Helguera et al. 1997), South Korea (Kang et al. 2007) and Brazil (Oliveira et al. 2014). ShVX was not detected in any of the samples tested. Chinese garlic plants were infected with GarV-A, GarV-B, GarV-D and GarV-X, while only GarV-D and GarV-X occurred in bulbs from Spain. Wylie et al. (2014) identified only GarV-X in garlic bulbs imported from Spain, and they did not detect any allexivirus in plant materials from China, while Parrano et al. (2015) identified GarV-X in plant materials derived from China. The largest amounts of bulbs from different parts of the world were infected with GarV-D and GarV-X, whereas GarV-C was detected in only a few bulbs from Poland. These data are confirmed by the research conducted by Parrano et al. (2012) and Wylie et al. (2014). The presence of allexiviruses species in the materials tested appears to be incidental. No domination of one particular virus species is observed, which was also reported by Dovas et al. (2001) and Fayad-André et al. (2011). This is most likely associated with the transmission of viruses by Aceria tulipae, which occurs mainly during the storage of garlic bulbs (Mann and Minges 1958).
Table 2

Viruses detected from garlic (Allium sativum) plants

Origin of plant

The number of the samples tested

The number of the samples infected with virus

The percentage of the samples infected with virus

GarV-A

GarV-B

GarV-C

GarV-D

GarV-X

GarMbFV

ShVX

China

72

13

18%

10

13%

0

0%

68

94%

51

70%

0

0%

0

0%

Poland

50

10

20%

12

24%

4

8%

50

100%

40

80%

37

74%

0

0%

Spain

24

0

0%

0

0%

0

0%

22

91%

13

54%

0

0%

0

0%

Total

146

23

15%

22

15%

4

3%

140

96%

104

71%

37

25%

0

0%

Isolates of each detected virus were selected from positive samples, and obtained sequences were deposited in GenBank. Further analyses were performed based on the sequences of the CPs of 80 GarV-A isolates (four isolates from Poland, 11 isolates from China and 65 isolates from other countries retrieved from GenBank), 87 GarV-B isolates (three isolates from Poland, five isolates from China and 79 isolates from other countries retrieved from GenBank), 144 GarV-D isolates (10 isolates from Poland, 24 isolates from China, eight isolates from Spain and 102 isolates from other countries retrieved from GenBank), 91 GarV-X isolates (3 isolates from Poland, two isolates from China, four isolates from Spain and 82 isolates from other countries retrieved from GenBank) and 17 GarMbFV isolates (eight isolates from Poland and nine isolates from other countries retrieved from GenBank). During construction of phylogenetic trees, isolates showing 100% identity and originating from the same country were removed. The phylogenetic trees constructed using the ML and NJ methods were identical; therefore we presented here only the tree obtained with the ML method.

GarV-A isolates shared only 79–100% nt and 92–100% aa identity. The comparison of amino acid sequences of the CPs of 15 GarV-A isolates obtained in this study (four isolates from Poland and 11 isolates from China) indicated very high identity of 98–100%. Based on the phylogenetic tree (Fig. 1a), it is impossible to distinguish the major GarV-A isolate lineages. Based on the construction of the tree, two isolates, WA6 from Australia and GarVA-SP from Spain, are the most remote from all isolates. Wylie et al. (2014) stated that the WA6 isolate, with two other isolates, is basal to other known isolates, and that they are probably closest to ancestral isolates. Based on our results, we can also advance the hypothesis that the isolates WA6 and GarVA-SP are closest to ancestral isolates.
Fig. 1

Maximum likelihood phylogenetic trees of amino acid sequences of CPs of isolates of GarV-A (a), GarV-B (b), GarV-D (c), GarV-X (d) and GarMbFV (e). Percentages of replicate maximum likelihood trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) are shown next to the branches. The corresponding sequence of Shallot virus X (ShVX) was used as an out-group. Shown for each isolate are GenBank accession code, isolate name and country of origin. Isolates obtained in this study are indicated by a grey background

Nucleotide and amino acid identity of GarV-B isolates was higher, at 85–100% nt and 95–100% aa, respectively. Isolates from Poland and China obtained during this research shared 97–99% aa sequence identity. Five new isolates from China (isolates 539_GarV-B, 542_GarV-B, 546_GarV-B, 549_GarV-B and 550_GarV-B) were very close (97–100% aa identity) to previously identified isolates, whereas three new isolates from Poland (isolates 17_GarV-B, 23_GarV-B and 27_GarV-B) were more genetically distant (95–99% aa identity with other described isolates). A phylogenetic analysis (Fig. 1b) showed that the divergent isolates belong to two major GarV-B isolate lineages, i.e. the lineage represented by isolates from Poland, China, Czech Republic, Russia, Spain, Brazil, Argentina, Australia, Iran and Japan, and the second lineage represented by isolates also from Poland, China, Czech Republic, Brazil and Japan, and additionally from Sudan and Korea. The majority of the prior studies have indicated a lack of genetic differentiation and frequent gene flow of the genus Allexivirus among various countries or several areas in one country (Koo et al. 2002; Chen et al. 2004; Melo-Filho et al. 2004; Wylie et al. 2012; Wylie et al. 2014).

A large group of GarV-D isolates indicated very low diversity. All compared isolates showed 85–100% nt and 95–100% aa identity. The same value of identity was obtained for a smaller number of isolates of the research conducted in 2014 (Bereda et al. 2015). High identity was confirmed by a phylogenetic analysis (Fig. 1c). Isolates’ distribution on phylogenetic tree indicates that probably all known isolates are closest to ancestral isolates. New isolates from China and Spain were identical and also shared 100% aa identity with isolates from Poland (271_GarV-D), Argentina (GarV-DSW9) and China (D-CH-3-1).

When the amino acid sequences of the CPs of GarV-X isolates were aligned, new isolates were close to some isolates identified previously, while they were also distant to the other isolates. New isolates from China, Spain and Poland shared 86–100 nt and 69–100% aa identity with previously identified isolates. All isolates of GarV-X shared only 65–100% aa identity. Isolates YH from China and USG1 from USA were the most genetically distant GarVX isolates identified so far (65–86 and 69–85% aa identity with other described isolates). New isolates from China and Spain identified in Poland were closely related to isolates previously identified in Poland (197_GarV-X, 247_GarV-X, 224_GarV-X, 418_GarV-X, 260_GarV-X, 187_GarV-X, 193_GarV-X) (Fig. 1d). It may indicate that they have acquired the virus through the vector during storage with garlic after import to Poland.

Eight new GarMbFV isolates were detected in bulbs derived from Poland. The sequence of these isolates was identical and shared 71–93% identity with other described isolates. The GarMbFV isolate from South Korea shared only 69–76% aa identity with previously identify isolates, which places them slightly below the allexivirus species demarcation point of <80% aa identity between CPs of distinct allexivirus species (King et al. 2012; Adams et al. 2004). Phylogenetic analysis showed that new isolates from Poland are very close to the isolate from Brazil (93% aa identity) (Fig. 1e).

The detection of allexiviruses in garlic bulbs available on the retail market has unquestionable significance for basic research. The results obtained in this study do not indicate clearly that the imported garlic was infected with viruses. Considering that the isolates from China and Spain were closely related to isolates from Poland, this may indicate that they became infected with viruses via a vector during transport or storage. This certainly applies to some of the isolates. However, some of the new isolates were closely related to the isolates from their countries of origin. The results, once again, confirm that the exchange of plant materials increases the risk of introducing new virus species as well as new isolates of viruses already present, which could constitute a real threat to domestic planting in the future. Therefore, the intense development of international trade in plant materials, especially in propagating material, which contributes significantly to the spread of plant pathogens, should take place in compliance with the appropriate phytosanitary requirements.

References

  1. Adams, M. J., Antoniw, J. F., Bar-Joseph, M., et al. (2004). The new plant virus family Flexiviridae and assessment of molecular criteria for species demarcation. Archives of Virology, 149, 1045–1060.PubMedGoogle Scholar
  2. Bereda, M., & Paduch-Cichal, E. (2016). First report of Shallot virus X in Allium caeruleum in Poland. Plant Disease, 100(9), 1958.CrossRefGoogle Scholar
  3. Bereda, M., Kalinowska, E., Paduch-Cichal, E., et al. (2015). Low genetic diversity of a natural population of Garlic virus D from Poland. European Journal of Plant Pathology, 142(2), 411–417.CrossRefGoogle Scholar
  4. Boom, R., Sol, C. J. A., Salimans, M. M. M., et al. (1990). Rapid and simple method for purification of nucleic acids. Journal of Clinical Microbiology, 28, 495–503.PubMedPubMedCentralGoogle Scholar
  5. Cafrune, E. E., Balzarini, M., & Conci, V. C. (2006). Changes in the concentration of an Allexivirus during the crop cycle of two garlic cultivars. Plant Disease, 90(10), 1293–1296.CrossRefGoogle Scholar
  6. Chen, J., Zheng, H. Y., Antoniw, J. F., et al. (2004). Detection and classification of allexiviruses from garlic in China. Archives of Virology, 149, 435–445.CrossRefPubMedGoogle Scholar
  7. Chodorska, M., Nowak, P., Szyndel, M. S., et al. (2012). First report of Garlic virus A, garlic virus B and Garlic virus C in garlic in Poland. Journal of Plant Pathology, 94, S4.100.Google Scholar
  8. Chodorska, M., Paduch-Cichal, E., Kalinowska, E., et al. (2013). Occurrence of the viruses belonging to the Allexivirus genus on garlic plants in Poland. Progress in Plant Protection/Postępy w Ochronie Roślin, 53(3), 605–609.Google Scholar
  9. Conci, V. C., Nome, S. F., & Milne, R. G. (1992). Filamentous viruses of garlic in Argentina. Plant Disease, 76, 594–596.CrossRefGoogle Scholar
  10. Conci, V. C., Canavelli, A. E., & Balzarini, M. G. (2010). The distribution of garlic viruses in leaves and bulbs during the first year of infection. Journal of Phytopathology, 158, 186–193.CrossRefGoogle Scholar
  11. Dovas, C. I., & Vovlas, C. (2003). Viruses infecting Allium spp. in southern Italy. Journal of Plant Pathology, 85, 135.Google Scholar
  12. Dovas, C. I., Hatziloukas, E., Salomon, R., et al. (2001). Incidence of viruses infecting Allium spp. in Greece. Phytopathology, 149, 1–7.CrossRefGoogle Scholar
  13. Fayad-André, M. S., Dusi, A. N., & Resende, R. O. (2011). Spread of viruses in garlic fields cultivated under different agricultural production systems in Brazil. Tropical Plant Pathology, 36(6), 341–349.CrossRefGoogle Scholar
  14. Gieck, S. L., Hamm, P. B., David, N. L., et al. (2009). First report of Garlic virus B and Garlic virus D in garlic in the Pacific northwest. Plant Disease, 93, 431.CrossRefGoogle Scholar
  15. Hall, T. A. (1999). BioEdit: a user-friendly biological sequence alignment editor and analysis program for windows 95/98/NT. Nucleic Acids Symposium Series, 41, 95–98.Google Scholar
  16. Helguera, M., Bravo-Almonacid, F., Kobayashi, K., et al. (1997). Immunological detection of a GarV-type virus in argentine garlic cultivars. Plant Disease, 81, 1005–1010.CrossRefGoogle Scholar
  17. Jemal, K., Abraham, A., & Feyissa, T. (2015). The occurrence and distribution of four viruses on garlic (Allium sativum L.) in Ethiopia. International Journal of Basic and Applied Sciences, 4(1), 5–11.Google Scholar
  18. Kang, S. G., Bong, J. K., Eun, T. L., et al. (2007). Allexivirus transmitted by eriophyoid mites in garlic plants. Journal of Microbiology and Biotechnology, 17, 1833–1840.PubMedGoogle Scholar
  19. King, A. M. Q., Adams, M. J., Carstens, E. B., et al. (2012). Ninth report of the international committee on taxonomy of viruses. San Diego: Elsevier Academic Press.Google Scholar
  20. Klukáčková, J., Navratil, M., & Duchoslav, M. (2007). Natural infection of garlic (Allium sativum L.) by viruses in the Czech Republic. Journal of Plant Diseases and Protection, 114(3), 97–100.CrossRefGoogle Scholar
  21. Koo, B. J., Kang, S. G., & Chang, M. U. (2002). Survey of garlic virus disease and phylogenetic characterization of garlic viruses of the genus Allexivirus isolated in Korea. Journal of Plant Pathology, 18, 237–243.CrossRefGoogle Scholar
  22. Malinowski, T. (1997). Silica capture-reverse transcription-polymerase chain reaction (SC-RT-PCR): application for the detection of several plant viruses. Diagnosis and Identification of Plant Pathogens, 11, 445–448.CrossRefGoogle Scholar
  23. Mann, L. K., & Minges, P. A. (1958). Growth and bulbing of garlic (Allium sativum L.) in response to storage temperature of planting day length and planting date. Hilgardia, 27, 385–419.CrossRefGoogle Scholar
  24. Marjanowski, A. (1988). Problemy hodowli i ocena wartości gospodarczej typów czosnku znajdujących się w kolekcji Instytutu Warzywnictwa. Nowości Warzywnicze, 20, 5–10.Google Scholar
  25. Melo-Filho, P. A., Nagata, T., Dusi, A. N., et al. (2004). Detection of three Allexiviruses species infecting garlic in Brazil. Pesquisa Agropecuaria Brasileira, 39, 375–340.Google Scholar
  26. Mohammed, H. S., Zicca, S., Manglli, A., et al. (2013). Occurrence and phylogenetic analysis of Potyviruses, Carlaviruses and Allexiviruses in garlic in Sudan. Journal of Phytopathology, 161(9), 642–650.CrossRefGoogle Scholar
  27. Oliveira, M. L., De Marchi, D. R., Mituti, T., et al. (2014). Identification and sequence analysis of five allexiviruses species infecting garlic crops in Brazil. Tropical Plant Pathology, 39(6), 483–489.CrossRefGoogle Scholar
  28. Parrano, L., Afunian, M., Pagliaccia, D., et al. (2012). Characterization of viruses associated with garlic plants propagated from different reproductive tissues from Italy and other geographic regions. Phytopathologia Mediterranea, 51(3), 549–565.Google Scholar
  29. Perotto, M. C., Cafrune, E. E., & Conci, V. C. (2010). The effect of additional viral infections on garlic plants initially infected with Allexiviruses. European Journal of Plant Pathology, 126(4), 489–495.CrossRefGoogle Scholar
  30. Shahraeen, N., Lesemann, D. E., & Ghtbi, T. (2008). Survey for viruses infecting onion, garlic and leek crops in Iran. OEPP/EPPO Bulletin, 38, 131–135.CrossRefGoogle Scholar
  31. Singh, P., Prabha, K., Jain, R. K., & Baranwal, V. K. (2014). N-terminal in coat protein of Garlic virus X is indispensible for its serological detection. Virus Genes, 48(1), 128–132.CrossRefPubMedGoogle Scholar
  32. Song, S. I., Song, J. T., Chang, M. U., et al. (1997). Identification of one of the major viruses infecting garlic plants, Garlic virus X. Molecules and Cells, 7, 705–709.PubMedGoogle Scholar
  33. Sumi, S., Tsuneyoshi, T., & Furutani, H. (1993). Novel rod-shaped viruses isolated from garlic, Allium sativum, possessing a unique genome organization. Journal of General Virology, 74, 1879–1885.CrossRefPubMedGoogle Scholar
  34. Tabanelli, D., Bertaccini, A., & Bellardi, M. G. (2004). Molecular detection of filamentous viruses infecting garlic from different geographic origins. Journal of Plant Pathology, 86(4), 335–335.Google Scholar
  35. Tamura, K., Peterson, D., Peterson, N., et al. (2011). MEGA5: molecular evolutionary genetics using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution, 28, 2731–2739.CrossRefPubMedPubMedCentralGoogle Scholar
  36. Vishnichenko, V. K., Konareva, T. N., & Zavriev, S. K. (1993). A new filamentous virus in shallot. Plant Pathology, 42, 12–126.CrossRefGoogle Scholar
  37. Ward, L. I., Perez-Egusquiza, Z., Fletcher, J. D., & Clover, G. R. G. (2009). A survey of viral diseases of Allium crops in New Zealand. Australasian Plant Pathology, 38, 533–539.CrossRefGoogle Scholar
  38. Wylie, S. J., Li, H., & Jones, M. G. K. (2012). Phylogenetic analysis of allexiviruses identified on garlic from Australia. Australasian Plant Disease Notes, 7, 23–27.CrossRefGoogle Scholar
  39. Wylie, S. J., Hua, L., Saqib, M., & Jones, M. G. K. (2014). The global trade in fresh produce and the vagility of plant viruses: a case study in garlic. PloS One, 9(8), e105044.CrossRefPubMedPubMedCentralGoogle Scholar

Copyright information

© The Author(s) 2017

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.

Authors and Affiliations

  • Maria Bereda
    • 1
  • Elżbieta Paduch-Cichal
    • 1
  • Elżbieta Dąbrowska
    • 1
  1. 1.Department of Plant PathologyWarsaw University of Life Sciences-SGGWWarsawPoland

Personalised recommendations