Advertisement

European Journal of Plant Pathology

, Volume 140, Issue 3, pp 491–502 | Cite as

Early PCR-based detection of Fusarium culmorum, F. graminearum, F. sporotrichioides and F. poae on stem bases of winter wheat throughout Poland

  • A. KuzdralińskiEmail author
  • H. Szczerba
  • K. Tofil
  • A. Filipiak
  • E. Garbarczyk
  • P. Dziadko
  • M. Muszyńska
  • E. Solarska
Open Access
Article

Abstract

Foot rot and crown rot are fungal diseases of wheat caused by a complex of Fusarium species. They have a huge economic impact mainly due to yield reduction. A survey was conducted to identify four Fusarium species, occurring on wheat stem bases, using species-specific PCR assays in samples collected during spring of 2012. The dominant species was F. graminearum, which was identified in above 64 % of samples. F. culmorum was detected in 15.71 %, F. poae in 15.71 % and F. sporotrichioides in 5.71 % wheat fields. Most of the wheat fields in the eastern Poland were infected with at least one or two of Fusarium species, while in central Poland no Fusarium species were identified in most of the fields. The presence of F. graminearum tends to favor the presence of F. culmorum and this effect was visible also for F. poae and F. sporotrichioides. The frequency of F. graminearum and F. culmorum detections were highest where wheat crops were preceded by maize and in the samples from late sown fields. The opposite observation was made for F. poae and F. sporotrichioides, where the number of detections of these species was higher in samples from early sown fields. The number of detected Fusarium species was significantly lower in samples collected from fields protected with autumn herbicide in comparison to unprotected fields. The rate of autumn N fertilization did not affect the number of Fusarium detections.

Keywords

Fusarium Winter wheat Species-specific PCR Stem base 

Introduction

The genus Fusarium contains many plant-pathogenic fungi, which are responsible for three main diseases of cereals: Fusarium head blight (FHB), foot rot (FR) and crown rot (CR). FHB is the best known Fusarium disease mainly due to the deterioration of grain quality through the production of mycotoxins (Parry et al. 1995; Champei et al. 2004; Gargouri et al. 2011). FR and CR are also a major problem in the production of wheat, causing significant yield losses each year (Smiley and Patterson 1996). CR can cause up to 89 % loss of wheat yield (Klein et al. 1991).

F. graminearum, F. pseudograminearum and F. culmorum have been identified as the predominant species associated with these diseases. Less frequently isolated species are F. poae, F. sporotrichioides, F. acuminatum, F. avenaceum, F. crookwellense, F. oxysporum and F. equiseti (Braithwaite et al. 1998; Bottalico and Perrone 2002; Monds et al. 2005). The relationship between FR, CR and FHB caused by the same fungi from the genus Fusarium is generally unclear (Parry et al. 1995). Fusarium spp. causing FR and CR survive in dead plant material or in the soil. Necrosis of the crown and stem base of wheat are the main symptoms of FR and CR. In some cases, severe disease occurrence contributes to premature death of the whole plants. Residual stubble has been identified as the source of primary infection but still little is known about the basis of the infection process (Burgess et al. 2001). Many authors highlight the fact that host residues for Fusarium spp. inoculum depends on cultivation method, cropping sequence and herbicide usage (Wiese 1987; Cromey et al. 2006). The few studies conducted in Poland have reported that the presence of Fusarium spp. on stem bases of winter wheat depends mainly on the weather and to a lesser extent on the crop rotation and weed infestation (Jaczewska-Kalicka 2001; Korbas 2004; Narkiewicz-Jodko et al. 2005).

Identification of fungi of the genus Fusarium, based on the morphology of mycelium and macroconidia, is a reliable method but it requires time and necessary skills. The polymerase chain reaction (PCR) technique is one of the most frequently used molecular tools for rapid and sensitive identification of Fusarium species (Niessen et al. 2004; Mulé et al. 2005; Demeke et al. 2005; Jurado et al. 2005, 2006).

In this study, we report the incidence of four important Fusarium species on stem bases of winter wheat in Poland. The selected species of F. graminearum, F .culmorum, F. poae and F. sporotrichioides are the prevalent causal agents of Fusarium diseases of roots and stem bases of wheat in Poland (Baturo 2006; Łukanowski 2009; Mielniczuk et al. 2012). We have determined their relationships with the following important factors: geographic region, previous crop, herbicide application, date of sowing and rate of autumn nitrogen fertilization. Lastly, we evaluate the interactions between Fusarium species tested in this work.

Materials and methods

Sample collection

Samples of winter wheat plants were collected in the spring of 2012 from 70 fields located in Poland during the tillering and just before the stem elongation stage of the crop growth (Table 1, Fig. 1). The number of plants collected varied slightly at each site, ranging from 10 to 20 plants, depending on the size of the field. Growers were provided with a questionnaire to supply information on previous crop, sowing date, autumn herbicide and fertilizer applications. Each sample was transported to the laboratory where it was stored at −20 °C.
Table 1

Samples collected from winter wheat fields in the spring of 2012 along with their geographic origin, forecrop, date of sowing and nitrogen level fertilization

Sample

Geographic region

Forecrop

Date of sowing

N fertilization [kg/ha]

1

central Poland

winter rape

mid-September

5

2

central Poland

winter rape

mid-September

0

3

central Poland

winter rape

mid-September

50

4

eastern Poland

maize

early October

22,2

5

eastern Poland

winter wheat

early September

58

6

north-westernPoland

winter rape

early October

0

7

north-westernPoland

winter rape

late September

16

8

north-westernPoland

winter rape

mid-September

40

9

north-westernPoland

maize

early October

0

10

north-westernPoland

winter wheat

mid-September

55

11

eastern Poland

winter wheat

mid-September

52

12

eastern Poland

winter wheat

early September

8

13

north-westernPoland

winter rape

mid-September

40

14

north-westernPoland

maize

late September

0

15

north-westernPoland

winter barley

mid-September

0

16

eastern Poland

white beet

early October

30

17

north-westernPoland

winter rape

late September

0

18

central Poland

winter wheat

mid-September

30

19

north-westernPoland

winter wheat

late September

0

20

north-westernPoland

winter rye

early October

0

21

north-westernPoland

winter barley

late September

0

22

central Poland

winter rape

late September

0

23

south-western Poland

maize

mid-October

0

24

south-western Poland

winter rape

late September

0

25

south-western Poland

winter rape

mid-September

12

26

south-western Poland

maize

early October

0

27

south-western Poland

winter rape

late September

28

28

south-western Poland

maize

early October

0

29

south-western Poland

maize

mid-October

0

30

south-western Poland

maize

mid-October

10

31

south-western Poland

maize

mid-October

34

32

eastern Poland

winter rape

mid-September

110

33

south-western Poland

winter rape

mid-September

0

34

south-western Poland

winter wheat

mid-October

0

35

south-western Poland

maize

early October

0

36

south-western Poland

winter rape

late September

18

37

north-westernPoland

lupine

late September

0

38

central Poland

nd

nd

nd

39

north-westernPoland

winter wheat

mid-September

0

40

central Poland

winter wheat

mid-September

0

41

central Poland

winter wheat

nd

18

42

south-western Poland

maize

late October

0

43

south-western Poland

winter wheat

mid-October

0

44

north-westernPoland

spring wheat

late September

nd

45

north-westernPoland

winter rape

late September

0

46

north-westernPoland

white beet

mid-September

0

47

eastern Poland

winter rape

late September

20

48

central Poland

winter rape

mid-September

20

49

south-western Poland

maize

late September

10

50

north-westernPoland

white beet

early September

15

51

south-western Poland

triticale

nd

nd

52

north-westernPoland

winter rape

nd

nd

53

eastern Poland

winter rape

mid-September

20

54

eastern Poland

winter wheat

mid-September

20

55

central Poland

winter wheat

early October

250

56

south-western Poland

winter rape

late September

0

57

south-western Poland

winter rape

nd

nd

58

south-western Poland

white beet

nd

nd

59

south-western Poland

winter rape

late September

0

60

north-westernPoland

winter wheat

early September

30

61

north-westernPoland

winter wheat

mid-September

30

62

eastern Poland

nd

nd

nd

63

eastern Poland

winter rape

late September

60

64

central Poland

winter wheat

mid-September

0

65

eastern Poland

winter wheat

mid-September

35

66

central Poland

maize

late October

15

67

eastern Poland

winter wheat

mid-September

18

68

eastern Poland

spring wheat

mid-September

18

69

central Poland

white beet

early November

0

70

south-western Poland

winter rape

late September

0

nd no data available

Fig. 1

Map of Poland (Google Maps Engine Lite, Liebert 2013) showing the location of sites of collection of winter wheat plants. Samples were divided into four groups with respect to geographic and climatic regions and marked with different icons: square - eastern Poland, circle - central Poland, star – south-western Poland and diamond – north-western Poland

DNA extraction

The leaf sheaths of each plant were removed and stems were washed carefully with tap water to remove adhering soil. Single stem sections between the crown roots and the first node (0.5–1 cm in length) were removed from each stem and used for DNA isolation. DNA was extracted from 15- to 25-mg subsamples of wheat stem bases that were transferred to 2 ml Eppendorf tube and pestled with liquid nitrogen to a fine powder. DNA from stem bases was obtained using Plant and Fungi Kit (EURx, Poland) according to the manufacturer’s instruction. DNA purity and concentration was determined spectrophotometrically (NanoDrop, ThermoScientific, USA). Until the analysis, DNA samples were stored at −20 °C.

PCR identification of Fusarium species

Species-specific PCR primers were used for identification of F. graminearum, F. culmorum, F. poae, and F. sporotrichioides. The sequences of the primers, the sizes of the amplicons and reference sources are shown in Table 2. Each PCR analysis included DNA of F. graminearum, F. culmorum, F. poae, and F. sporotrichioides, which served as positive controls and were obtained from internal Fusarium spp. strains collection of the Department of Biotechnology, Human Nutrition and Science of Food Commodities.
Table 2

Species-specific primers used to identify Fusarium species

Target species

Primer name

Sequence 5′-3′

Amplicon size (bp)

Reference

F. graminearum

Fg16NF

ACAGATGACAAGATTCAGGCACA

280

Nicholson et al. 1998

Fg16NR

TTCTTTGACATCTGTTCAACCCA

F. culmorum

Fc01F

ATGGTGAACTCGTCGTGGC

570

Nicholson et al. 1998

Fc01R

CCCTTCTTACGCCAATCTCG

F. poae

Fp82F

CAAGCAAACAGGCTCTTCACC

220

Parry and Nicholson 1996

Fp82R

TGTTCCACCTCAGTGACAGGTT

F. sporotrichioides

FspITS2K

CTTGGTGTTGGGATCTGTGTGCAA

288

Kulik et al. 2004

P28SL

ACAAATTACAACTCGGGCCCGAGA

Samples were run in 25 μl reactions using 2 × PCR Master Mix (Thermo Scientific Fermentas, Lithuania) with 20 pmol of each primer and 20 ng of DNA on a SensoQuest Labcycler (SensoQuest GmbH, Germany). Thermal cycling conditions specific for each primer pairs were as follows: an initial step at 95 °C for 5 min and 5 cycles at 95 °C for 30 s, 66 °C for 30 s, and 72 °C for 30 s, 5 cycles at 95 °C for 30 s, 64 °C for 30 s, and 72 °C for 30 s, 25 cycles at 95 °C for 30 s, 62 °C for 30 s, and 72 °C for 30 s followed by 72 °C for 8 min for F. graminearum and F. culmorum, respectively; an initial step at 95 °C for 5 min and 40 cycles at 95 °C for 30 s, 68 °C for 30 s, and 72 °C for 40 s followed by 72 °C for 8 min for F. sporotrichioides; an initial step at 95 °C for 3 min and 38 cycles at 95 °C for 30 s, 62 °C for 30 s, and 72 °C for 30 s followed by 72 °C for 8 min for F. poae.

Amplification products were separated by electrophoresis in 1.5 % (wt/vol) agarose gels stained with ethidium bromide in 1× TBE 1.5 h at 120 V. DNA bands were then visualized using GelDoc 2000 gel documentation system (BioRad, USA), and sizes of the PCR products were determined by comparison against the migration of GeneRuler 100 bp plus DNA Ladder (Thermo Scientific Fermentas, Lithuania).

Data analysis

Data analyses were carried out: (i) to determine the presence of interactions between species identified, and (ii) to determine whether the occurrence of Fusarium species depends on one of the known factors: geographic location, date of sowing, previous crop, herbicide application in autumn and autumn N fertilization. Relationships were statistically analyzed by Pearson correlation coefficient using Statgraphics Centurion XV (Stat Point, Inc.). Significance was assumed at P ≤ 0.05. Charts were plotted using Microsoft Excel (Microsoft Corp., Redmond, WA, USA).

Results

Table 3 shows the incidence of Fusarium species identified by the PCR technique in the eastern, central, south-western and north-western regions of Poland. All four species were detected. Species-specific PCR for F. graminearum amplified the expected DNA fragment in 64.29 % of stem bases samples of winter wheat. The second most frequently detected species were F. culmorum (15.71 %) and F. poae (15.71 %), followed by F. sporotrichioides (5.71 %). F. graminearum was recorded four times more often in comparison to F. culmorum and F. poae. The highest number of F. graminearum samples was identified in the southwestern Poland (72.73 %) in comparison to other regions. The proportion of samples, from all regions, positive for the Fusarium species were: 45:11:11:4 for F. graminearum, F. culmorum, F. poae and F. sporotrichioides, respectively.
Table 3

Incidence of Fusarium species detected in different sampling regions

 

Fusarium species [%]

Sampling region

F. graminearum

F. culmorum

F. sporotrichioides

F. poae

Eastern Poland (n = 14)

64.29 (9 out of 14)

21.43 (3 out of 14)

14.29 (2 out of 14)

35.71 (5 out of 14)

Central Poland (n = 13)

46.15 (6 out of 13)

7.7 (1 out of 13)

7.7 (1 out of 13)

23.08 (3 out of 13)

South-western Poland (n = 22)

72.73 (16 out of 22)

22.73 (5 out of 22)

0 (0 out of 22)

9.09 (2 out of 22)

North-western Poland (n = 21)

66,67 (14 out of 21)

9.52 (2 out of 21)

4.76 (1 out of 21)

4.76 (1 out of 21)

Total (n = 70)

64.29 (45 out of 70)

15.71 (11 out of 70)

5.71 (4 out of 70)

15.71 (11 out of 70)

Table 4 shows the number of samples with none, one or multiple detections of tested Fusarium species. There were more fields in the eastern Poland with more than one or two detections of Fusarium species on the stem bases of wheat (11 and 7 out of 14, respectively) than in other regions of Poland included in the study. The number of negative samples for Fusarium species tested was highest in central Poland. Moreover, the number of detected Fusarium species was lowest in the central and northwestern Poland in comparison to the eastern and south-western regions. In all samples considered collectively, only 28.57 % of crops were free of the tested species of Fusarium.
Table 4

Number of Fusarium species detected in different sampling regions

 

No. of Fusarium species detected

Sampling region

0

1

2

3

>1

>2

Eastern Poland (n = 14)

3 (21.42 %)

4 (28.57 %)

6 (42.86 %)

1 (7.14 %)

11 (78.57 %)

7 (50 %)

Central Poland (n = 13)

5 (38.46 %)

5 (38.46 %)

3 (23.08 %)

0 (0.0 %)

8 (61.54 %)

3 (23.08 %)

South-western Poland (n = 22)

6 (27.27 %)

9 (40.9 %)

7 (31.82 %)

0 (0.0 %)

16 (72.72 %)

7 (31.82 %)

North-western Poland (n = 21)

6 (28.57 %)

13 (61.9 %)

1 (4.76 %)

1 (4.76 %)

15 (71.43 %)

2 (9.52 %)

Total (n = 70)

20 (28.57 %)

31 (44.29 %)

17 (24.29 %)

2 (2.86 %)

50 (71.42 %)

19 (27.14 %)

The presence of one species of Fusarium tended to favour the presence of other (Table 5). Overall, the presence of F. graminearum appeared to be related to the presence of F. culmorum and the presence of F. poae seemed to be associated with F. sporotrichioides. The correlations found were positive. Correlation coefficient between F. culmorum and F. graminearum showed slightly stronger interaction in comparison to F. sporotrichioides and F. poae. However, both correlations indicated rather weak but noticeable associations between these Fusarium species.
Table 5

Pearson correlation coefficients of Fusarium spp. incidence in stem bases of winter wheat

Fusarium species

F. graminearum

F. culmorum

F. sporotrichioides

F. poae

F. graminearum

0.324*

ns

ns

F. culmorum

0.324*

ns

ns

F. sporotrichioides

ns

ns

0.26*

F. poae

ns

ns

0.26*

ns not statistically significant

* correlation is significant at P < 0.05

A limited range of preceding crops (forecrops) was present in the surveyed samples, mainly winter rape, maize and winter wheat. Among the 70 wheat fields examined, 35.7 % followed winter rape, 18.6 % maize and 25.7 % winter wheat. Previous crop was the factor associated with the occurrence of Fusarium spp. in wheat stem bases (Table 6). The frequency of F. graminearum and F. culmorum detections were highest where wheat followed maize. The number of samples with at least one or two Fusarium species identified was also highest in wheat grown after maize in comparison to rape and wheat forecrops. Only about 15 % of samples that followed maize as the previous crop were free of Fusarium species in comparison to 32 % for winter rape and 39 % for winter wheat as forecrops.
Table 6

Fusarium spp. incidence in stem bases of winter wheat with different forecrops

 

Fusarium spp. incidence

Previous crop (number of samples)

F. graminearum

F. culmorum

F. sporotrichioides

F. poae

Crops with >1 species detected

Crops with >2 species detected

Crops with >3 species detected

Winter rape (n = 25)

64 % (16 out of 25)

16 % (4 out of 25)

8 % (2 out of 25)

12 % (3 out of 25)

68 % (17 out of 25)

20 % (5 out of 25)

8 % (2 out of 25)

maize (n = 13)

69,23 % (9 out of 13)

38,46 % (5 out of 13)

7,69 % (1 out of 13)

15,38 % (2 out of 13)

84,62 % (11 out of 13)

46,15 % (6 out of 13)

0,0 % (0 out of 13)

Winter wheat (n = 18)

61,11 % (11 out of 18)

5,56 % (1 out of 18)

0,0 % (0 out of 18)

16,67 % (3 out of 18)

61,11 % (11 out of 18)

22,22 % (4 out of 18)

0,0 % (0 out of 18)

The incidence percentage of Fusarium species depended also on the date of sowing (Fig. 2). The frequency of F. graminearum and F. culmorum detections was highest in samples collected from late sown fields. However, the number of samples positive for F. poae and F. sporotrichioides was higher in crops sown earlier, in September, rather than in October.
Fig. 2

The percentage of Fusarium spp. incidence in stem bases of winter wheat sown in different months. Early - 1st decade of the month, mid - 2nd decade, late - 3rd decade. Earlier and later dates of sowing were disregarded due to the low number of samples

The incidence of F. graminearum, F. culmorum and F. sporotrichioides in stem bases of winter wheat was lower when herbicide was applied in autumn 2012 (Table 7). The number of Fusarium-free samples was over 100 % higher if herbicide was applied in comparison to unprotected crops.
Table 7

Fusarium spp. incidence in wheat crops in relation to the application of autumn herbicide prior to sowing

Herbicide autumn application

Fusarium graminearum incidence [%]

Fusarium culmorum incidence [%]

Fusarium sporotrichioides incidence [%]

Fusarium poae incidence [%]

No Fusarium spp. detected [%]

Crops with 1 species incidence [%]

Crops with 2 species incidence [%]

Crops with 3 species incidence [%]

yes n = 39

59

15.4

2.6

20.5

33.3

38.5

25.6

2.6

no n = 25

76

20

12

8

16

56

20

4

The level of autumn nitrogen fertilization was also compared with the number of detected Fusarium species (Fig. 3). There was a slight trend detected, but not statistically significant, indicating the positive role of the level of N fertilization on the number of Fusarium species. About 36 % of samples originated from fields with no fertilization in autumn. Nitrogen fertilization rate below 50 kg/ha was recorded in about 39 % of the fields. More than 7 % of the samples originated from the fields with N fertilization rate above 50 kg/ha (data not shown).
Fig. 3

Number of Fusarium spp. detected according to the level of autumn N fertilization with line indicating linear trend (n = 61)

Discussion

Wheat (Triticum aestivum L.) is one of the most extensively cultivated cereals around the world. Fusarium diseases of wheat are very important factors contributing to economic losses and deterioration in grain quality (McMullen et al. 2012). The PCR-based assays can be used for the routine detection and identification of pathogenic fungi from genus Fusarium without morphological determination (Murillo et al. 1998; Moeller et al. 1999; Mulé et al. 2004). The development and use of PCR assays could be also very helpful for early diagnosis and control of Fusarium population on wheat ear and stem base (Ben-Amar et al. 2012).

In this study, F. graminearum was the most frequently detected species occurring on wheat stem bases. The results obtained by other authors in years 1997 to 1999 and from 2000 to 2002 showed that F. culmorum and F. poae were the dominant Fusarium species isolated from wheat stem bases in Poland during those years (Narkiewicz-Jodko et al. 2005; Kurowski et al. 2008). The dominance of F. culmorum in stem bases of cereals in Poland was also observed from 2001 to 2006 and only few isolates of F. graminearum were obtained in 2001 from rye seedlings (Kiecana et al. 2008, 2009). The results obtained in this study suggest that the population structure of Fusarium spp. on wheat stem bases has changed in Poland, and that the predominant species in 2012 was F. graminearum. However, until now, F. graminearum species has been detected only occasionally and its high incidence in this study has never been previously observed in Poland on stem bases of cereals. These results may explain the higher number of detections of F. graminearum observed lately on wheat kernels in Poland, Netherlands and Austria (Stępień et al. 2008; Weber and Kita 2010; Mielniczuk et al. 2012). F. graminearum is one of the most aggressive species in comparison to other fungi of the genus Fusarium and for this reason, a common prevalence of this species on stem bases of winter wheat in Poland should be taken seriously. The progressive dominance of F. graminearum over F. culmorum observed in Europe could be explained by climatic conditions during certain growing seasons, the observed changes in climate, or widespread use of feed maize in crop rotation (Scherm et al. 2013). Similarly, the presence of F. sporotrichioides in Fusarium population infecting seedlings, roots and stem bases has increased in Poland during recent years (Kiecana et al. 2008; Kiecana and Mielniczuk 2010).

In the current study, there have been also geographic differences in the Fusarium species occurrence, related to the region. The samples from the southwestern Poland had highest frequency of detections of all Fusarium spp. However, the number of samples with at least one or two detections of Fusarium species on the stem base of wheat was also highest in the eastern Poland. There are several reports describing the structure of Fusarium population in Poland, based on the regions of the country. Goliński et al. (2010) compared two locations, Cerekwica near Poznan (centralwestern Poland) and Sitaniec near Zamość (south-eastern Poland). This author observed highest rate of Fusarium infections and level of mycotoxin biosynthesis in the south-eastern Poland. However, no detailed studies have been published on the distribution of Fusarium spp. in Poland on wheat stem bases to compare with the results obtained in this study. Most of the studies focus on one location (Narkiewicz-Jodko et al. 2005; Kurowski et al. 2008; Kiecana et al. 2008, 2009).

The analysis of co-occurrence of all cases studied showed correlation of F. graminearum with F. culmorum and F. poae with F. sporotrichioides. Interaction between F. graminearum and F. culmorum can be explained by their coexistence as a complex of main species on the same plant (Nicholson et al. 1998). Interactions between species from the genus Fusarium has been observed previously, although most of them had a character of growth inhibition, e.g., F. moniliforme can suppress the growth of F. graminearum. Negative correlation has also been found between F. moniliforme and both F. graminearum and F. subglutinans (Reid et al. 1999). In addition, F. culmorum was showed to suppress the growth of M. nivale (Simpson et al. 2004) and F. graminearum reduced the growth rate of F. moniliforme and F. proliferatum (Marin et al. 1998). These relationships are likely to be explained by the influence of other associated factors, i.e., forecrop and date of sowing that emerged from further analyses of samples. However, a very interesting co-incidence was also noted in these correlations of Fusarium species from the same Fusarium sections: Discolor (F. graminearum and F. culmorum) and Sporotrichiella (F. poae and F. sporotrichioides) (Watanabe et al. 2011).

Our data supports the findings that previous crop has an influence on Fusarium incidence (Wiese 1987). Among analyzed forecrops, maize promoted the occurrence of Fusarium spp. and this influence was highly significant in the case of F. graminearum and F. culmorum. This factor could positively affect co-occurrence of these species. Furthermore, F. graminearum is described as a major pathogen of maize stalks and ears (Waalwijk et al. 2003; Osborne and Stein 2007). The presence of maize in the structure of crop rotations in this study could explain the domination of F. graminearum over F. culmorum (Scherm et al. 2013).

Results of the current study indicate that the date of sowing of winter wheat could also influence the incidence of Fusarium in spring. Later date of sowing increased the incidence of F. graminearum and F. culmorum, while the number of samples positive for F. sporotrichioides and F. poae was highest in earlier sown crops. This could be the second factor responsible for the correlation between these Fusarium species. These findings confirmed results obtained by Subedi et al. (2007) who showed that the later the sowing date, the greater the incidence of Fusarium spp. Furthermore, the incidence of Fusarium-damaged kernels was also higher after later sowing (Ma et al. 2013). Since F. graminearum and F. culmorum represent a significant part of Fusarium spp. population present on wheat stem bases among species analyzed in this study, it should be recommended to avoid late dates of sowing.

The presence of weeds on the field might promote the occurrence of pathogenic fungi. Weeds are one of the potential sources of Fusarium inoculum (Altinok 2013). Our findings confirmed the negative impact of herbicide application in autumn on Fusarium spp. incidence in spring. However, the effect of herbicides on plant pathogens is not clear. The application of herbicides can result in a decrease of the severity of diseases but they can also trigger opposite effects (Velini et al. 2010; Lemańczyk 2012).

The level of autumn nitrogen fertilization had no effect on Fusarium spp. incidence. Several recent studies have shown that FHB infection and Fusarium mycotoxin contaminations were increased with higher rate of N application (Lemmens et al. 2004; Burgt et al. 2011), whereas other studies did not reveal any significant effects of N application on FHB (Váňová et al. 2008; Yoshida et al. 2008).

Conclusions

PCR-assay can be used for early detection of Fusarium spp. even if symptoms of fungi presence are not visible on plant. Among Fusarium species tested, F. graminearum was most frequently isolated from stem bases of wheat. The occurrence of F. graminearum and F. culmorum as well as F. poae and F. sporotrichioides was weakly correlated. Maize most highly promoted the incidence of Fusarium spp among forecrops analyzed. Later date of sowing increased the incidence of F. graminearum and F. culmorum in the spring and decreased the incidence of F. poae and F. sporotrichioides. Application of herbicides in autumn reduced the population of Fusarium. The rate of autumn N fertilization did not affect the number of Fusarium detections.

References

  1. Altinok, H. H. (2013). Fusarium species isolated from common weeds in eggplant fields and symptomless hosts of Fusarium oxysporum f. sp. melongenae in Turkey. Journal of Phytopathology, 161(5), 335–340.CrossRefGoogle Scholar
  2. Baturo, A. (2006). Effect of thermotherapy, grain treatment and leaf spraying with biological control agents on spring barley Hordeum vulgare health in organic system. Phytopathologia, 41, 15–26.Google Scholar
  3. Ben-Amar, A., Oueslati, S., Ghorbel, A., & Mliki, A. (2012). Prediction and early detection of mycotoxigenic Fusarium culmorum in wheat by direct PCR-based procedure. Food Control, 23, 506–510.CrossRefGoogle Scholar
  4. Bottalico, A., & Perrone, G. (2002). Toxigenic Fusarium species and mycotoxins associated with head blight in small-grain cereals in Europe. European Journal of Plant Pathology, 108, 611–624.CrossRefGoogle Scholar
  5. Braithwaite, M., Alexander, B. J. R., & Adams, R. L. M. (1998). In: Nationwide survey of pests and diseases of cereal and grass seed crops in New Zealand. 2. Fungi and bacteria. Proceedings of the 51st New Zealand Plant Protection Conference, New Zealand Plant Protection Society, 51–9.Google Scholar
  6. Burgess, L. W., Backhouse, D., Summerell, B. A., & Swan, L. J. (2001). Crown rot of wheat. In B. A. Summerell, J. F. Leslie, D. Backhouse, W. L. Bryden, & L. W. Burgess (Eds.), Fusarium. Paul E. Nelson Memorial Symposium (pp. 271–294). St. Paul Minnesota: American Phytopathological Society Press.Google Scholar
  7. Champei, A., Doré, T., & Fourbet, J. F. (2004). Fusarium head blight: epidemiological origin of the effects of cultural practices on head blight attacks and the production of mycotoxins by Fusarium in wheat grains. Plant Science, 166, 1389–1415.CrossRefGoogle Scholar
  8. Cromey, M. G., Parkes, R. A., & Fraser, P. M. (2006). Factors associated with stem base and root diseases of New Zealand wheat and barley crops. Australasian Plant Pathology, 35, 391–400.CrossRefGoogle Scholar
  9. Demeke, T., Clear, R. M., Patrick, S. K., & Gaba, D. (2005). Species-specific PCR-based assays for the detection of Fusarium species and a comparison with the whole seed agar plate method and trichothecene analysis. International Journal of Food Microbiology, 103, 271–284.PubMedCrossRefGoogle Scholar
  10. Gargouri, S., Mtat, I., Kammoun, L. G., Zid, M., & Hajlaoui, M. R. (2011). Molecular genetic diversity in populations of Fusarium pseudograminearum from Tunisia. Journal of Phytopathology, 159, 306–313.CrossRefGoogle Scholar
  11. Goliński, P., Waśkiewicz, A., Wiśniewska, H., Kiecana, I., Mielniczuk, E., Gromadzka, K., et al. (2010). Reaction of winter wheat (Triticum aestivum L.) cultivars to infection with Fusarium spp.: mycotoxin contamination in grain and chaff. Food Additives and Contaminants Part A-chemistry Analysis Control Exposure & Risk Assessment, 27(7), 1015–1024.CrossRefGoogle Scholar
  12. Jaczewska-Kalicka, A. (2001). Występowanie chorób i straty plonu pszenicy ozimej, ze szczególnym uwzględnieniem wpływu warunków klimatycznych. Progress in Plant Protection/Postępy w Ochronie Roślin, 41(2), 607–616.Google Scholar
  13. Jurado, M., Vázquez, C., Marin, S., Sanchis, V., & González-Jaén, M. T. (2006). PCR-based strategy to detect contamination with mycotoxigenic Fusarium species in maize. Systematic and Applied Microbiology, 29, 681–689.PubMedCrossRefGoogle Scholar
  14. Jurado, M., Vázquez, C., Patino, B., & González-Jaén, M. T. (2005). PCR detection assays for the trichothecene-producing species Fusarium graminearum, Fusarium culmorum, Fusarium poae, Fusarium equiseti and Fusarium sporotrichioides. Systematic and Applied Microbiology, 28, 562–568.PubMedCrossRefGoogle Scholar
  15. Kiecana, I., Cegiełko, M., & Mielniczuk, E. (2009). The occurrence of Fusarium spp. on winter rye (Secale cereale L.) and susceptibility of different genotypes to infection with F. avenaceum (Fr.) Sacc. and F. culmorum (W.G.Sm.). Biul IHAR, 252, 151–161.Google Scholar
  16. Kiecana, I., & Mielniczuk, E. (2010). Fusarium head blight of rye (Secale cereale L.). Acta Agrobotanica, 63(1), 129–135.CrossRefGoogle Scholar
  17. Kiecana, I., Mielniczuk, E., & Cegiełko, M. (2008). Fungi infecting roots and stem bases in oat (Avena sativa L.). Biul IHAR, 247, 73–79.Google Scholar
  18. Klein, T. A., Burgess, L. W., & Ellison, F. W. (1991). The incidence and spatial patterns of wheat plants infected by Fusarium graminearum group 1 and the effect of crown rot on yield. Australian Journal of Agricultural Research, 42, 399–407.CrossRefGoogle Scholar
  19. Korbas, M. (2004). Choroby podstawy źdźbła, możliwości i perspektywy zwalczania. Progress in Plant Protection/Postępy w Ochronie Roślin, 44(1), 147–154.Google Scholar
  20. Kulik, T., Fordoński, G., Pszczółkowska, A., Płodzień, K., & Łapiński, M. (2004). Development of PCR assay based on ITS2 rDNA polymorphism for the detection and differentiation of Fusarium sporotrichioides. FEMS Microbiology Letters, 239(1), 181–186.PubMedCrossRefGoogle Scholar
  21. Kurowski, T. P., Marks, M., Orzech, K., & Kowalska, E. (2008). Sanitary state and yielding of Winter wheat as dependent on soiltillage system. Zeszyty Problemowe Postepów Nauk Rolniczych, 531, 95–103.Google Scholar
  22. Lemańczyk, G. (2012). Severity of root and stembase diseases ofspring cereals as affected by chemical control of weeds. Progress in Plant Protection/Postępy w Ochronie Roślin, 52(2), 369–376.Google Scholar
  23. Lemmens, M., Haim, K., Lew, H., & Ruckenbauer, P. (2004). The effect of fertilization on Fusarium head blight development and deoxinivalenol contamination in wheat. Journal of Phytopathology, 152, 1–8.CrossRefGoogle Scholar
  24. Liebert, B. (2013). Create, collaborate and share advanced custom maps with Google Maps Engine Lite (Beta). Google Maps. Google, Inc. [http://google-latlong.blogspot.com/2013/03/create-collaborate-and-share-advanced.html]. Accessed 20 May 2013.
  25. Łukanowski, A. (2009). Winter wheat stem base infestation and fungal communities occurring on stems in dependence on cropping system. Phytopathologia, 53, 43–55.Google Scholar
  26. Ma, B. L., Subedi, K. D., Xue, A. G., & Voldeng, H. D. (2013). Crop management effects on fusarium head blight, fusarium-damaged kernels and deoxynivalenol concentration of spring wheat. Journal of Plant Nutrition, 36(5), 717–730.CrossRefGoogle Scholar
  27. McMullen, M., Bergstrom, G. C., DeWolf, E., Dill-Macky, R., Hershman, D., Shaner, G., & Van Sanford, D. (2012). A unified effort to fight an enemy of wheat and barley: Fusarium head blight. Plant Disease, 96, 1712–1728.CrossRefGoogle Scholar
  28. Marin, S., Sanchis, V., Ramos, A. J., Vinas, I., & Magan, N. (1998). Environmental factors, in vitro interactions, and niche overlap between Fusarium moniliforme, F. proliferatum and F. graminearum, Aspergillus and Penicillium species from maize grain. Mycological Research, 102, 831–837.CrossRefGoogle Scholar
  29. Mielniczuk, E., Kiecana, I., & Cegiełko, M. (2012). Fungi infecting the roots and stem base of winter rye (Secale cereale L.) grown in the Lublin region (Poland). Acta Agrobotanica, 65(3), 85–92.CrossRefGoogle Scholar
  30. Moeller, E. M., Chelkowski, J., & Geiger, H. H. (1999). Species-specific PCR assays for the fungal pathogens Fusarium moniliforme and Fusarium subglutinans and their application to diagnose maize ear rot. Journal of Phytopathology, 147, 497–508.CrossRefGoogle Scholar
  31. Monds, R. D., Cromey, M. G., Lauren, D. R., di Menna, M., & Marshall, J. (2005). Fusarium graminearum, F. cortaderiae and F. pseudograminearum in New Zealand: molecular phylogenetic analysis, mycotoxin chemotypes and co-existence of species. Mycological Research, 109, 410–420.PubMedCrossRefGoogle Scholar
  32. Mulé, G., González-Jaén, M. T., Hornok, L., Nicholson, P., & Waalwijk, C. (2005). Advances in molecular diagnosis of toxigenic Fusarium species. Food Additives and Contaminants, 22, 316–323.PubMedCrossRefGoogle Scholar
  33. Mulé, G., Susca, A., Stea, G., & Moretti, A. (2004). A species-specific PCR assay based on the calmodulin partial gene for identification of Fusarium verticillioides, F. proliferatum and F. subglutinans. European Journal of Plant Pathology, 110, 495–502.CrossRefGoogle Scholar
  34. Murillo, I., Cavallarin, L., & San Segundo, B. (1998). The development of a rapid assay for the detection of Fusarium moniliforme. European Journal of Plant Pathology, 104, 301–311.CrossRefGoogle Scholar
  35. Narkiewicz-Jodko, M., Gil, Z., & Urban, M. (2005). Stem base rot of winter wheat by Fusarium spp. - causes and effects. Acta Agrobotanica, 58(2), 319–332.CrossRefGoogle Scholar
  36. Nicholson, P., Simpson, D. R., Weston, G., Rezanoor, H. N., Lees, A. K., Parry, D. W., et al. (1998). Detection and quantification of Fusarium culmorum and Fusarium graminearum in cereals using PCR assays. Physiological and Molecular Plant Pathology, 53(1), 17–37.CrossRefGoogle Scholar
  37. Niessen, L., Schmidt, H., & Vogel, R. F. (2004). The use of tri5 gene sequences for PCR detection and taxonomy of trichothecene-producing species in the Fusarium section Sporotrichiella. International Journal of Food Microbiology, 95, 305–319.PubMedCrossRefGoogle Scholar
  38. Osborne, L. E., & Stein, J. M. (2007). Epidemiology of Fusarium head blight on small-grain cereals. International Journal of Food Microbiology, 119(1–2), 103–108.PubMedCrossRefGoogle Scholar
  39. Parry, D. W., Jenkinson, P., & McLeod, L. (1995). Fusarium ear blight (scab) in small grain cereals – A review. Plant Pathology, 44, 207–238.CrossRefGoogle Scholar
  40. Parry, D. W., & Nicholson, P. (1996). Development of a PCR assay to detect Fusarium poae in wheat. Plant Pathology, 45, 383–391.CrossRefGoogle Scholar
  41. Reid, L. M., Nicol, R. W., Ouellet, T., Savard, M., Miller, J. D., Young, J. C., et al. (1999). Interaction of Fusarium graminearum and F. moniliforme in Maize Ears: disease progress, fungal biomass, and mycotoxin accumulation. Phytopathology, 89(11), 1028–1037.PubMedCrossRefGoogle Scholar
  42. Scherm, B., Balmas, V., Spanu, F., Pani, G., Delogu, G., Pasquali, M., et al. (2013). Fusarium culmorum: causal agent of foot and root rot and head blight on wheat. Molecular Plant Pathology, 14(4), 323–341.PubMedCrossRefGoogle Scholar
  43. Simpson, D. R., Thomsett, M. A., & Nicholson, P. (2004). Competitive interactions between Microdochium nivale var. majus, M. nivale var. nivale and Fusarium culmorum in planta and in vitro. Environmental Microbiology, 6(1), 79–87.PubMedCrossRefGoogle Scholar
  44. Smiley, R. W., & Patterson, L. M. (1996). Pathogenic fungi associated with Fusarium foot rot of winter wheat in semiarid Pacific Northwest USA. Plant Disease, 80, 944–949.CrossRefGoogle Scholar
  45. Stępień, Ł., Popiel, D., Koczyk, G., & Chełkowski, J. (2008). Wheat-infecting Fusarium species in Poland — their chemotypes and frequencies revealed by PCR assay. Journal of Applied Genetics, 49(4), 433–441.PubMedCrossRefGoogle Scholar
  46. Subedi, K. D., Ma, B. L., & Xue, A. G. (2007). Planting date and nitrogen effects on Fusarium head blight and leaf spotting diseases in spring wheat. Agronomy Journal, 99(1), 113–121.CrossRefGoogle Scholar
  47. van der Burgt, G. J. H. M., Timmermans, B. G. H., Scholberg, J. M. S., & Osman, A. M. (2011). Fusarium head blight and deoxynivalenol contamination in wheat as affected by nitrogen fertilization. NJAS - Wageningen Journal of Life Sciences, 58(3–4), 123–129.CrossRefGoogle Scholar
  48. Váňová, M., Klem, K., Míša, P., Matušinsky, P., Hajšlová, J., & Lancová, K. (2008). The content of Fusarium mycotoxins, grain yield and quality of winter wheat cultivars under organic and conventional cropping systems. Plant, Soil and Environment, 54, 395–402.Google Scholar
  49. Velini, E. D., Trindade, M. L. B., Barberis, L. R. M., & Duke, S. O. (2010). Growth regulation and other secondary effects of herbicides. Weed Science, 58(3), 351–354.CrossRefGoogle Scholar
  50. Waalwijk, C., Kastelelin, P., de Vries, I., Kerenyi, Z., van der Lee, T., & Hesselink, T. (2003). Major changes in Fusarium spp. in wheat in the Netherlands. European Journal of Plant Pathology, 109, 743–754.CrossRefGoogle Scholar
  51. Watanabe, M., Yonezawa, T., Lee, K., Kumagai, S., Sugita-Konishi, Y., Goto, K., et al. (2011). Molecular phylogeny of the higher and lower taxonomy of the Fusarium genus and differences in the evolutionary histories of multiple genes. BMC Evolutionary Biology, 11, 322.PubMedCrossRefPubMedCentralGoogle Scholar
  52. Weber, R., & Kita, W. (2010). Effects of tillage system and forecrop type on frequency of Fusarium culmorum and F. avenaceum occurrence on culm base of some winter wheat (Triticum aestivum L.) cultivars. Acta Agrobotanica, 63(1), 121–128.CrossRefGoogle Scholar
  53. Wiese, M. V. (1987). Compendium of wheat diseases (2nd ed.). St. Paul: American Phytopathological Society.Google Scholar
  54. Yoshida, M., Nakajima, T., & Tonooka, T. (2008). Effect of nitrogen application at anthesis on FHB and mycotoxin accumulation in breadmaking wheat in the western part of Japan. Journal of General Plant Pathology, 74, 355–363.CrossRefGoogle Scholar

Copyright information

© The Author(s) 2014

Open AccessThis article is distributed under the terms of the Creative Commons Attribution License which permits any use, distribution, and reproduction in any medium, provided the original author(s) and the source are credited.

Authors and Affiliations

  • A. Kuzdraliński
    • 1
    Email author
  • H. Szczerba
    • 1
  • K. Tofil
    • 1
  • A. Filipiak
    • 1
  • E. Garbarczyk
    • 1
  • P. Dziadko
    • 1
  • M. Muszyńska
    • 1
  • E. Solarska
    • 1
  1. 1.Department of Biotechnology, Human Nutrition and Science of Food CommoditiesUniversity of Life Sciences in LublinLublinPoland

Personalised recommendations