Advertisement

Chromosome Research

, Volume 18, Issue 4, pp 441–458 | Cite as

Genome-wide search of the genes tagged with the consensus of 33.6 repeat loci in buffalo Bubalus bubalis employing minisatellite-associated sequence amplification

  • Deepali Pathak
  • Jyoti Srivastava
  • Rana Samad
  • Iqbal Parwez
  • Sudhir Kumar
  • Sher AliEmail author
Article

Abstract

Minisatellites have been implicated with chromatin organization and gene regulation, but mRNA transcripts tagged with these elements have not been systematically characterized. The aim of the present study was to gain an insight into the transcribing genes associated with consensus of 33.6 repeat loci across the tissues in water buffalo, Bubalus bubalis. Using cDNA from spermatozoa and eight different somatic tissues and an oligo primer based on two units of consensus of 33.6 repeat loci (5′ CCTCCAGCCCTCCTCCAGCCCT 3′), we conducted minisatellite-associated sequence amplification (MASA) and identified 29 mRNA transcripts. These transcripts were cloned and sequenced. Blast search of the individual mRNA transcript revealed sequence homologies with various transcribing genes and contigs in the database. Using real-time PCR, we detected the highest expression of nine mRNA transcripts in spermatozoa and one each in liver and lung. Further, 21 transcripts were found to be conserved across the species; seven were specific to bovid whereas one was exclusive to the buffalo genome. The present work demonstrates innate potentials of MASA in accessing several functional genes simultaneously without screening the cDNA library. This approach may be exploited for the development of tissue-specific mRNA fingerprints in the context of genome analysis and functional and comparative genomics.

Keywords

Buffalo genome 33.6 minisatellites Satellite-tagged transcripts Relative expression Fluorescence in situ hybridization 

Abbreviations

BAC

Bacterial artificial chromosome

CDH

Cadherin 1

CDS

Complementary DNA sequence

Ct

Cycle threshold

DCS

D cell sorter

DAPI

4′,6-diamidino-2-phenylindole

FISH

Fluorescence in situ hybridization

GAPDH

Glyceraldehyde 3-phosphate dehydrogenase

ISCNDB

International System for Chromosome Nomenclature of Domestic Bovids

MASA

Minisatellite-associated sequence amplification

mRNA

Messenger ribonucleic acid

ORF

Open reading frame

PXMP-4

Peroxisomal membrane protein 4

R2 value

Regression coefficient

RAPD

Random amplification of polymorphic DNA

RT–PCR

Reverse transcriptase–polymerase chain reaction

SARS2

Seryl-tRNA synthetase 2

TBE

Tris/borate/EDTA

UTR

Untranslated region

Notes

Acknowledgements

This work was supported by a DST Grant No. SR/WOSA/LS-92/2005 to DP, SR/FT/L-81/2005 to RS, DBT Grant No. BT/PR8476/AAQ/01/315/2006 to SA, and a core grant from the Department of Biotechnology, Govt. of India to the National Institute of Immunology, New Delhi. SA thanks Alexander Von Humboldt Foundation, Bonn, Germany for equipment donation and Shri Khem Singh Negi for technical assistance.

Supplementary material

10577_2010_9132_MOESM1_ESM.doc (90 kb)
Supplementary Table 1 Details of the primers used for RT–PCR analysis (a) and relative expression studies, copy number assessment by real-time PCR (b) amplification of 3′ region of PXMP-4 gene (c) (DOC 90 kb)
10577_2010_9132_MOESM2_ESM.doc (166 kb)
Supplementary Table 2 Association of mRNA transcripts across the species with consensus of 11 mer 33.6 repeat loci based on in silico analysis. Single unit was found to be present in the flanking and intervening regions of several structural and functional genes across the species (DOC 166 kb)
10577_2010_9132_MOESM3_ESM.doc (58 kb)
Supplementary Table 3 Details of 29 mRNA transcripts tagged with consensus of 33.6 repeat loci uncovered from different somatic tissues and spermatozoa (DOC 57 kb)
10577_2010_9132_MOESM4_ESM.doc (80 kb)
Supplementary Table 4 Cross-hybridization of recombinant clones corresponding to MASA-amplified buffalo mRNA transcripts with genomic DNA of 12 species. Transcript ID and species name are given on top of the panel. Note the exclusive presence of eight transcripts in buffalo/bovids (DOC 80 kb)
10577_2010_9132_MOESM5_ESM.ppt (1.1 mb)
Supplementary Figure 1 Phylogenetic tree based on blast search result of representative MASA-amplified mRNA transcripts. Transcript ID is mentioned on the left side of the panel (al). Only those sequences showing similarity with the characterized genes in the database were taken for phylogenetic analysis (PPT 1116 kb)
10577_2010_9132_MOESM6_ESM.ppt (208 kb)
Supplementary Figure 2 Full-length 1,488-bp cDNA sequence of buffalo PXMP-4 lacking poly A tail. Nucleotide sequence in green shows region amplified by MASA with 33.6 primer, and red represents region amplified by bovine-derived PXMP-4 internal primers. Note the position of the 33.6 primers (underlined). The 1,488-bp cDNA sequences from different somatic tissues and spermatozoa were found to be identical (PPT 208 kb)
10577_2010_9132_MOESM7_ESM.doc (62 kb)
Supplementary Figure 3 Multiple sequence alignment of PXMP-4 nucleotide sequence(s) from different species. Note the close sequence homology between buffalo (red) and cattle (green). Box (yellow) indicates position of minisatellite 33.6 in different species (DOC 61 kb)

References

  1. Akagi T, Yin D, Kawamata N et al (2009) Functional analysis of a novel DNA polymorphism of a tandem repeated sequence in the asparagine synthetase gene in acute lymphoblastic leukemia cells. Leuk Res 33:991–996CrossRefPubMedGoogle Scholar
  2. Ali S, Wallace RB (1988) Intrinsic polymorphism of variable number tandem repeat loci in the human genome. Nucleic Acids Res 16:8487–8496CrossRefPubMedGoogle Scholar
  3. Altschul SF, Gish W, Miller W et al (1990) A basic local alignment search tool. J Mol Biol 215:403–410PubMedGoogle Scholar
  4. Azfer MA, Bashamboo A, Ahmed N et al (1999) Random amplification of polymorphic DNA with conserved sequences reveals genome-specific monomorphic amplicons: implications in clad identification. J Biosci 24:35–41CrossRefGoogle Scholar
  5. Caburet S, Vaiman D, Veitia RA (2004) A genomic basis for the evolution of vertebrate transcription factors containing amino acid runs. Genetics 167:1813–1820CrossRefPubMedGoogle Scholar
  6. Caburet S, Cocquet J, Vaiman D et al (2005) Coding repeats and evolutionary “agility”. Bioessays 27:581–587CrossRefPubMedGoogle Scholar
  7. Charlesworth B, Sniegowski P, Stephan W (1994) The evolutionary dynamics of repetitive DNA in eukaryotes. Nature 371:215–220CrossRefPubMedGoogle Scholar
  8. Cribiu EP, Di Berardino D, Di Meo GP et al (2001) International system for chromosome nomenclature of domestic bovids (ISCNDB 2000). Cytogenet Cell Genet 92:283–299CrossRefPubMedGoogle Scholar
  9. Dey I, Rath PC (2005) A novel rat genomic simple repeat DNA with RNA-homology shows triplex (H-DNA)-like structure and tissue-specific RNA expression. Biochem Biophys Res Commun 327:276–286CrossRefPubMedGoogle Scholar
  10. Fondon JW, Garner HR (2004) Molecular origins of rapid and continuous morphological evolution. Proc Natl Acad Sci USA 101:18058–18063CrossRefPubMedGoogle Scholar
  11. Georges M, Andersson L (1996) Livestock genomics comes of age. Genome Res 6:907–921CrossRefPubMedGoogle Scholar
  12. Gibbons WJ Jr, Yan Q, Li R et al (2004) Genomic organization, expression, and subcellular localization of mouse mitochondrial seryl-tRNA synthetase. Biochem Biophys Res Commun 317:774–778CrossRefPubMedGoogle Scholar
  13. Heymans HS, Schutgens RB, Tan R et al (1983) Severe plasmalogen deficiency in tissues of infants without peroxisomes (Zellweger syndrome). Nature 306:69–70CrossRefPubMedGoogle Scholar
  14. Jeffreys AJ, Wilson V, Thein SL (1985) Hypervariable ‘minisatellite’ regions in human DNA. Nature 314:67–73CrossRefPubMedGoogle Scholar
  15. Jeffreys AJ, Neumann R, Wilson V (1990) Repeat unit sequence variation in minisatellites: a novel source of DNA polymorphism for studying variation and mutation by single molecule analysis. Cell 60:473–485CrossRefPubMedGoogle Scholar
  16. John MV, Ali S (1997) Synthetic DNA-based genetic markers reveal intra- and inter species DNA sequence variability in the Bubalus bubalis and related genomes. DNA Cell Biol 16:369–378CrossRefPubMedGoogle Scholar
  17. Karaca M, Sukumar S, Zipf A et al (2002) Genetic diversity among forage Bermuda grass (Cynodon spp.). Evidence from chloroplast and nuclear DNA fingerprinting. Crop Sci 42:2118–2127CrossRefGoogle Scholar
  18. Kim TS, Booth JG, Gauch HG Jr et al (2008) Simple sequence repeats in Neurospora crassa: distribution, polymorphism and evolutionary inference. BMC Genomics 9:31CrossRefPubMedGoogle Scholar
  19. Lalancette C, Thibault C, Bachand L et al (2008a) Transcriptome analysis of bull semen with extreme nonreturn rate: use of suppression-subtractive hybridization to identify functional markers for fertility. Biol Reprod 78:618–635CrossRefPubMedGoogle Scholar
  20. Lalancette C, Miller D, Li Y et al (2008b) Paternal contributions: new functional insights for spermatozoal RNA. J Cell Biochem 104:1570–1579CrossRefPubMedGoogle Scholar
  21. Lambard S, Galeraud-Denis I, Martin G et al (2004) Analysis and significance of mRNA in human ejaculated sperm from normozoospermic donors: relationship to sperm motility and capacitation. Mol Hum Reprod 10:535–541CrossRefPubMedGoogle Scholar
  22. Legendre M, Pochet N, Pak T et al (2007) Sequence-based estimation of minisatellite and microsatellite repeat variability. Genome Res 17:1787–1796CrossRefPubMedGoogle Scholar
  23. Levdansky E, Romano J, Shadkchan Y et al (2007) Coding tandem repeats generate diversity in Aspergillus fumigatus genes. Eukaryot Cell 6:1380–1391CrossRefPubMedGoogle Scholar
  24. Li YC, Korol AB, Fahima T et al (2002) Microsatellites: genomic distribution, putative functions and mutational mechanisms: a review. Mol Ecol 11:2453–2465CrossRefPubMedGoogle Scholar
  25. Li YC, Korol AB, Fahima T et al (2004) Microsatellites within genes: structure, function and evolution. Mol Biol Evol 21:991–1007CrossRefPubMedGoogle Scholar
  26. Lohi H, Young EJ, Fitzmaurice SN et al (2005) Expanded repeat in canine epilepsy. Science 307:81CrossRefPubMedGoogle Scholar
  27. Mahr S, Müller-Hilke B (2007) Transcriptional activity of the RHOB gene is influenced by regulatory polymorphisms in its promoter region. Genomic Med 1:125–128CrossRefPubMedGoogle Scholar
  28. Morgante M, Hanafey M, Powell W (2002) Microsatellites are preferentially associated with nonrepetitive DNA in plant genomes. Nat Genet 30:194–200CrossRefPubMedGoogle Scholar
  29. Orgel LE, Crick FH (1980) Selfish DNA the ultimate parasite. Nature 284:604–607CrossRefPubMedGoogle Scholar
  30. Ostermeier GC, Goodrich RJ, Moldenhauer JS et al (2005) A suite of novel human spermatozoal RNAs. J Androl 26:70–74PubMedGoogle Scholar
  31. Pathak D, Srivastava J, Premi S et al (2006) Chromosomal localization, copy number assessment and transcriptional status of BamH1 repeat fractions in water buffalo Bubalus bubalis. DNA Cell Biol 25:206–214CrossRefPubMedGoogle Scholar
  32. Premi S, Srivastava J, Chandy SP et al (2007) AZFc somatic microdeletions and copy number polymorphism of the DAZ genes in human males exposed to natural background radiation. Hum Genet 121:337–346CrossRefPubMedGoogle Scholar
  33. Reisse S, Rothardt G, Völkl A et al (2001) Peroxisomes and ether lipid biosynthesis in rat testis and epididymis. Biol Reprod 64:1689–1694CrossRefPubMedGoogle Scholar
  34. Richard GF, Dujon B (2006) Molecular evolution of minisatellites in hemiascomycetous yeasts. Mol Biol Evol 23:189–202CrossRefPubMedGoogle Scholar
  35. Richard GF, Kerrest A, Dujon B (2008) Comparative genomics and molecular dynamics of DNA repeats in eukaryotes. Microbiol Mol Biol Rev 72:686–727CrossRefPubMedGoogle Scholar
  36. Shah ZH, Toompuu M, Hakkinen T et al (2001) Novel coding-region polymorphisms in mitochondrial seryl-tRNA synthetase (SARSM) and mitoribosomal protein S12 (RPMS12) genes in DFNA4 autosomal dominant deafness families. Hum Mutat 17:433–434CrossRefPubMedGoogle Scholar
  37. Srivastava J, Premi S, Pathak D et al (2006) Transcriptional status of known and novel genes tagged with consensus of 33.15 repeat loci employing minisatellite-associated sequence amplification (MASA) and real-time PCR in water buffalo, Bubalus bubalis. DNA Cell Biol 25:31–48CrossRefPubMedGoogle Scholar
  38. Srivastava J, Premi S, Kumar S et al (2007) Characterization of Smoc-1 uncovers two transcript variants showing differential tissue and age specific expression in Bubalus bubalis. BMC Genomics 8:436CrossRefPubMedGoogle Scholar
  39. Srivastava J, Premi S, Kumar S et al (2008) Organization and differential expression of the GACA/GATA tagged somatic and spermatozoal transcriptomes in buffalo Bubalus bubalis. BMC Genomics 9:132CrossRefPubMedGoogle Scholar
  40. Srivastava J, Premi S, Kumar S et al (2009) Expressional dynamics of minisatellite 33.15 tagged spermatozoal transcriptome in Bubalus bubalis. BMC Genomics 10:303CrossRefPubMedGoogle Scholar
  41. Usdin K (2008) The biological effects of simple tandem repeats: lessons from the repeat expansion diseases. Genome Res 18:1011–1019CrossRefPubMedGoogle Scholar
  42. Vergnaud G, Denoeud F (2000) Minisatellites: mutability and genome architecture. Genome Res 10:899–907CrossRefPubMedGoogle Scholar
  43. Verstrepen KJ, Jansen A, Lewitter F et al (2005) Intragenic tandem repeats generate functional variability. Nat Genet 37:986–990CrossRefPubMedGoogle Scholar
  44. Wickings EJ (1993) Hypervariable single and multi-locus DNA polymorphisms for genetic typing of non-human primates. Primates 34:323–331CrossRefGoogle Scholar
  45. Yokogawa T, Shimada N, Takeuchi N et al (2000) Characterization and tRNA recognition of mammalian mitochondrial seryl-tRNA synthetase. J Biol Chem 275:19913–19920CrossRefPubMedGoogle Scholar

Copyright information

© Springer Science+Business Media B.V. 2010

Authors and Affiliations

  • Deepali Pathak
    • 1
  • Jyoti Srivastava
    • 1
  • Rana Samad
    • 1
  • Iqbal Parwez
    • 1
  • Sudhir Kumar
    • 1
  • Sher Ali
    • 1
    Email author
  1. 1.Molecular Genetics LaboratoryNational Institute of ImmunologyNew DelhiIndia

Personalised recommendations