Advertisement

Cellular and Molecular Neurobiology

, Volume 30, Issue 7, pp 1049–1058 | Cite as

Wnt3a Promotes Hippocampal Neurogenesis by Shortening Cell Cycle Duration of Neural Progenitor Cells

  • Yutaka Yoshinaga
  • Tetsushi KagawaEmail author
  • Takeshi Shimizu
  • Toshihiro Inoue
  • Shinji Takada
  • Jun-ichi Kuratsu
  • Tetsuya Taga
Original Research

Abstract

The effects of Wnt signaling on neural progenitor cells have been controversial. Activation of the canonical Wnt signaling pathway either promotes neural progenitor cell proliferation or accelerates their differentiation into postmitotic neurons. This study demonstrates that activation of the Wnt signaling pathway by itself induces neural progenitor cell proliferation but does not directly affect neuronal differentiation processes. To investigate whether Wnt signaling promotes expansion and/or differentiation of neural progenitor cells in the developing hippocampus, we prepared primary mouse hippocampal progenitors and treated them with Wnt3a in a chemically defined culture medium. Wnt3a increased the total number of cells, including the numbers of Ki67+ proliferating cells and Tuj1+ differentiated neurons. This result verified that Wnt3a promoted neural progenitor cell proliferation. Meanwhile, Wnt3a did not appear to actively enhance the neuronal differentiation process itself, because (1) the ratio of Tuj1+ cells to the total cells, and (2) the ratio of BrdU+ Tuj1+ cells to the total BrdU+ cells, were both comparable between cultures with or without Wnt3a. Indeed, Wnt3a caused no significant change in either cell survival or the proportion of symmetric and asymmetric cell divisions that directly affected neuron production. We finally demonstrated that the Wnt3a treatment simply shortened cell cycle duration of neural progenitor cells by 2.9 h. The accelerated cell cycle progression without affecting the ratio of symmetric/asymmetric cell divisions explains how Wnt signaling per se leads to the expansion of both proliferative cell population and differentiated neuronal cell population.

Keywords

Wnt3a Hippocampus Cell cycle Cell proliferation Neuronal differentiation 

Notes

Acknowledgments

We thank members of our laboratory for valuable discussions and technical advice. We also thank Ms. M. Teramoto for secretarial assistance. We are very grateful to Ms. Y. Saiki for technical help. This work was supported by a Grant-in-Aid for twenty-first century COE research from the Ministry of Education, Culture, Sports, Science and Technology “Cell Fate Regulation Research and Education Unit”, Grants-in-Aid #16047223 and #18053018 for Scientific Research on Priority Areas on “Elucidation of glia-neuron network mediated information processing systems” (T. K.); Grants-in-Aid for Scientific Research on Priority Areas on “Molecular Brain Science” (T. T.); CREST (T. T.); and Grants-in-Aid for Scientific Research on Priority Areas on “Self-renewal and pluripotency of the stem cells” (T. T.) from the Ministry of Education, Culture, Sports, Science and Technology. This work was also supported by Grants-in-Aid #17500255 for Scientific Research (C) from the Japan Society for the Promotion of Science (T. K.).

Supplementary material

Supplementary Fig. 1

No significant change in the ratio of active caspase3+ cells among Tuj1+ cells between Wnt3a-treated and non-treated cultures. Neuronal cell death was assessed by double-immunostaining with anti-Tuj1 (red fluorescence) and anti-active caspase3 (rabbit IgG, BD Pharmingen, 1:1000), (green fluorescence, arrowheads) antibodies. The ratio of the number of active caspase 3+ cells to the number of Tuj1+ cells in the control culture was 4.79% (A; 16/334) and that in the Wnt3a-treated culture was 3.18% (B; 16/503). Scale bar: 10 µm (JPEG 793 kb)

Supplementary Fig. 2

Wnt3a effects on neuronal marker expressions. There was no significant change in the percentage of NeuN+ mature neurons/total cells with and without Wnt3a (A, B, and green bars in E). Wnt3a significantly increased the percentage of GABA+ neurons (C, D, and red bars in E: P = 0.014). Significance determined using student’s t tests (**P < 0.01). Data are presented as mean ± SD (JPEG 2069 kb)

Supplementary Fig. 3

Expressions of neuronal sub-type markers examined by RT-PCR. A, Four-day Wnt3a treatment slightly induced interneuron marker Gad1 expression but not glutamatergic neuron marker VGluT1 expression in hippocampal cell culture. B, Four-day Wnt3a treatment induced calpactin and KA-1 but not Oct-6. Both calpactin and KA-1 are highly expressed in adult hippocampus CA3 region. PCR primers used in this figure are as follows. Gad1: GCTGGAAGGCATGGAAGGCTTTA and TGAGCCCCATCACCGTAGCA; VGluT1: ACGGTAACGCAGGTGTCCT and CCTCTCGTACTGAGCAGGA; G3PDH: GTCATCATCTCCGCCCCTTCTGC and GATGCCTGCTTCACCACCTTCTTG; calpactin: ATGCCATCCCAAATGGAGCACG and GAGGGCAATGGGATGCAAAC; KA-1: CCCATCGAGTCTGTGGATGA and TATTCTCCATTCCCAGGCCT; Oct-6: GCGAGCACTCGGACGAGGATGC and GGGGTCATGCGCTTCTCCTTCTGC (JPEG 2564 kb)

Supplementary Fig. 4

Experimental design for evaluating cell cycle kinetics (JPEG 769 kb)

References

  1. Chenn A, Walsh CA (2002) Regulation of cerebral cortical size by control of cell cycle exit in neural precursors. Science 297:365–369CrossRefPubMedGoogle Scholar
  2. Decembrini S, Andreazzoli M, Vignali R, Barsacchi G, Cremisi F (2006) Timing the generation of distinct retinal cells by homeobox proteins. PLoS Biol 4:e272CrossRefPubMedGoogle Scholar
  3. Dickinson ME, Krumlauf R, McMahon AP (1994) Evidence for a mitogenic effect of Wnt-1 in the developing mammalian central nervous system. Development 120:1453–1471PubMedGoogle Scholar
  4. Fougerousse F, Bullen P, Herasse M, Lindsay S, Richard I, Wilson D, Suel L, Durand M, Robson S, Abitbol M, Beckmann JS, Strachan T (2000) Human-mouse differences in the embryonic expression patterns of developmental control genes and disease genes. Hum Mol Genet 9:165–173CrossRefPubMedGoogle Scholar
  5. Galceran J, Miyashita-Lin EM, Devaney E, Rubenstein JL, Grosschedl R (2000) Hippocampus development and generation of dentate gyrus granule cells is regulated by LEF1. Development 127:469–482PubMedGoogle Scholar
  6. Grove EA, Tole S, Limon J, Yip L, Ragsdale CW (1998) The hem of the embryonic cerebral cortex is defined by the expression of multiple Wnt genes and is compromised in Gli3-deficient mice. Development 125:2315–2325PubMedGoogle Scholar
  7. Hirabayashi Y, Itoh Y, Tabata H, Nakajima K, Akiyama T, Masuyama N, Gotoh Y (2004) The Wnt/beta-catenin pathway directs neuronal differentiation of cortical neural precursor cells. Development 131:2791–2801CrossRefPubMedGoogle Scholar
  8. Israsena N, Hu M, Fu W, Kan L, Kessler JA (2004) The presence of FGF2 signaling determines whether beta-catenin exerts effects on proliferation or neuronal differentiation of neural stem cells. Dev Biol 268:220–231CrossRefPubMedGoogle Scholar
  9. Kim AS, Anderson SA, Rubenstein JL, Lowenstein DH, Pleasure SJ (2001) Pax-6 regulates expression of SFRP-2 and Wnt-7b in the developing CNS. J Neurosci 21:RC132PubMedGoogle Scholar
  10. Kim WY, Wang X, Wu Y, Doble BW, Patel S, Woodgett JR, Snider WD (2009) GSK-3 is a master regulator of neural progenitor homeostasis. Nat Neurosci 12:1390–1397CrossRefPubMedGoogle Scholar
  11. Kuwabara T, Hsieh J, Muotri A, Yeo G, Warashina M, Lie DC, Moore L, Nakashima K, Asashima M, Gage FH (2009) Wnt-mediated activation of NeuroD1 and retro-elements during adult neurogenesis. Nat Neurosci 12:1079–1081CrossRefGoogle Scholar
  12. Lee SM, Tole S, Grove E, McMahon AP (2000) A local Wnt-3a signal is required for development of the mammalian hippocampus. Development 127:457–467PubMedGoogle Scholar
  13. Lie DC, Colamarino SA, Song HJ, Desire L, Mira H, Consiglio A, Lein ES, Jessberger S, Lansford H, Dearie AR, Gage FH (2005) Wnt signalling regulates adult hippocampal neurogenesis. Nature 437:1370–1375CrossRefPubMedGoogle Scholar
  14. MacDonald BT, Tamai K, He X (2009) Wnt/beta-catenin signaling: components, mechanisms, and diseases. Dev. Cell 17:9–26CrossRefPubMedGoogle Scholar
  15. Maretto S, Cordenonsi M, Dupont S, Braghetta P, Broccoli V, Hassan AB, Volpin D, Bressan GM, Piccolo S (2003) Mapping Wnt/beta-catenin signaling during mouse development and in colorectal tumors. Proc Natl Acad Sci USA 100:3299–3304CrossRefPubMedGoogle Scholar
  16. Martynoga B, Morrison H, Price DJ, Mason JO (2005) Foxg1 is required for specification of ventral telencephalon and region-specific regulation of dorsal telencephalic precursor proliferation and apoptosis. Dev Biol 283:113–127CrossRefPubMedGoogle Scholar
  17. McMahon AP, Bradley A (1990) The Wnt-1 (int-1) proto-oncogene is required for development of a large region of the mouse brain. Cell 62:1073–1085CrossRefPubMedGoogle Scholar
  18. McMahon AP, Joyner AL, Bradley A, McMahon JA (1992) The midbrain-hindbrain phenotype of Wnt-1−/Wnt-1− mice results from stepwise deletion of engrailed-expressing cells by 9.5 days postcoitum. Cell 69:581–595CrossRefPubMedGoogle Scholar
  19. Megason SG, McMahon AP (2002) A mitogen gradient of dorsal midline Wnts organizes growth in the CNS. Development 129:2087–2098PubMedGoogle Scholar
  20. Muroyama Y, Fujihara M, Ikeya M, Kondoh H, Takada S (2002) Wnt signaling plays an essential role in neuronal specification of the dorsal spinal cord. Gene Dev 16:548–553CrossRefPubMedGoogle Scholar
  21. Muroyama Y, Kondoh H, Takada S (2004) Wnt proteins promote neuronal differentiation in neural stem cell culture. Biochem Biophys Res Commun 313:915–921CrossRefPubMedGoogle Scholar
  22. Nowakowski RS, Lewin SB, Miller MW (1989) Bromodeoxyuridine immunohistochemical determination of the lengths of the cell cycle and the DNA-synthetic phase for an anatomically defined population. J Neurocytol 18:311–318CrossRefPubMedGoogle Scholar
  23. Nusse R (2008) Wnt signaling and stem cell control. Cell Res 18:523–527CrossRefPubMedGoogle Scholar
  24. Panhuysen M, Vogt Weisenhorn DM, Blanquet V, Brodski C, Heinzmann U, Beisker W, Wurst W (2004) Effects of Wnt1 signaling on proliferation in the developing mid-/hindbrain region. Mol Cell Neurosci 26:101–111CrossRefPubMedGoogle Scholar
  25. Prakash N, Brodski C, Naserke T, Puelles E, Gogoi R, Hall A, Panhuysen M, Echevarria D, Sussel L, Weisenhorn DM, Martinez S, Arenas E, Simeone A, Wurst W (2006) A Wnt1-regulated genetic network controls the identity and fate of midbrain-dopaminergic progenitors in vivo. Development 133:89–98CrossRefPubMedGoogle Scholar
  26. Sherr CJ (1996) Cancer cell cycle. Science 274:1672–1677CrossRefPubMedGoogle Scholar
  27. Shimizu T, Kagawa T, Inoue T, Nonaka A, Takada S, Aburatani H, Taga T (2008) Stabilized beta-catenin functions through TCF/LEF proteins and the Notch/RBP-Jkappa complex to promote proliferation and suppress differentiation of neural precursor cells. Mol Cell Biol 28:7427–7441CrossRefPubMedGoogle Scholar
  28. Strutt DI (2001) Asymmetric localization of frizzled and the establishment of cell polarity in the Drosophila wing. Mol Cell 7:367–375CrossRefPubMedGoogle Scholar
  29. Thomas KR, Capecchi MR (1990) Targeted disruption of the murine int-1 proto-oncogene resulting in severe abnormalities in midbrain and cerebellar development. Nature 346:847–850CrossRefPubMedGoogle Scholar
  30. van Amerongen R, Nusse R (2009) Towards an integrated view of Wnt signaling in development. Development 136:3205–3214CrossRefPubMedGoogle Scholar
  31. Whangbo J, Harris J, Kenyon C (2000) Multiple levels of regulation specify the polarity of an asymmetric cell division in C. elegans. Development 127:4587–4598PubMedGoogle Scholar
  32. Zhou CJ, Borello U, Rubenstein JL, Pleasure SJ (2006) Neuronal production and precursor proliferation defects in the neocortex of mice with loss of function in the canonical Wnt signaling pathway. Neuroscience 142:1119–1131CrossRefPubMedGoogle Scholar

Copyright information

© Springer Science+Business Media, LLC 2010

Authors and Affiliations

  • Yutaka Yoshinaga
    • 1
    • 2
  • Tetsushi Kagawa
    • 1
    • 4
    Email author
  • Takeshi Shimizu
    • 1
    • 6
  • Toshihiro Inoue
    • 1
    • 3
  • Shinji Takada
    • 5
  • Jun-ichi Kuratsu
    • 2
  • Tetsuya Taga
    • 1
    • 4
  1. 1.Division of Cell Fate Modulation, Institute of Molecular Embryology and GeneticsKumamoto UniversityKumamotoJapan
  2. 2.Department of Neurosurgery, Graduate School of Medical SciencesKumamoto UniversityKumamotoJapan
  3. 3.Department of Ophthalmology and Visual Science, Graduate School of Medical SciencesKumamoto UniversityKumamotoJapan
  4. 4.Department of Stem Cell Regulation, Medical Research InstituteTokyo Medical and Dental UniversityTokyoJapan
  5. 5.Division of Molecular and Developmental Biology, Okazaki Institute for Integrative BiosciencesNational Institutes of Natural SciencesOkazakiJapan
  6. 6.Vertebrate Axis Formation Team, Creative Research Promoting Program RIKEN Center for Developmental BiologyKobeJapan

Personalised recommendations