Advertisement

An efficient transgene-free DNA-editing system for Arabidopsis using a fluorescent marker

  • Lejun OuyangEmail author
  • Mingsai Ma
  • Limei Li
Open Access
Original Research Paper

Abstract

Objective

To obtain transgene-free progeny by constructing a DNA editing system with a fluorescent screening marker gene and two pairs of single-guide RNAs to simultaneously recognize two different sites in the target gene encoding Arabidopsis microRNA(miR)160A

Results

The T1 seeds with red fluorescence were easily identified and were selected to verify that the proportion of miR160A knockout mutants reached approximately 50%. Seeds with no fluorescence in the T2 generation were selected and screened for homozygous mutants. In the T2 generation plants, the Cas9 fragment was not detected by polymerase chain reaction. The traits of the homozygous mutants were stably inherited by the T2 population.

Conclusions

A highly efficient DNA-editing construct was successfully developed and can be used as a plant genome site-specific editing tool that may be useful for improving plant genetic resources.

Keywords

Transgene-free CRISPR/Cas9 Gene editing Fluorescence screening 

Introduction

A major challenge of the functional genomics era is the identification of specific gene function and the corresponding application value from a large number of genomic databases. Gene editing technology is a powerful tool that can be utilized to help solve this problem. For site-directed gene editing, a foreign DNA fragment and a homologous receptor gene fragment can be recombined when donor DNA is provided, allowing site-specific integration of the foreign DNA fragment into the genome. Compared to gene knockout techniques, including T-DNA tags, transposon tags, and retrotransposon tags, site-directed editing technology enables both site-specific integration of genes and fine-tuning of target genes, including insertions, deletions, and substitutions (Wang et al. 2018a, b). CRISPR/Cas9-based genome editing technology was discovered in 2013 (Jinek et al. 2012; Cong et al. 2013; Mali et al. 2013) and uses sgRNA to perform site-specific DNA editing of genes of interest. It is simple to use, inexpensive, and highly efficient. Compared to traditional transgenic technologies, the insertion site of the CRISPR/Cas9 construct differs from the gene editing site. The inserted exogenous DNA element can be removed through chromosome segregation after completion of the gene editing to avoid any residual foreign genes after editing in the offspring. This increases biosafety and the prospect of broad applications (Hu et al. 2017).

However, the effective removal of transgenic DNA from genetically modified offspring presents technical challenges (Gao et al. 2016). In this study, a high-efficiency DNA editing construct was created using the cauliflower mosaic virus (CaMV) 35S promoter driving the mCherry gene, which encoded a fluorescent protein as a selection marker, and the Arabidopsis thaliana gene encoding microRNA (miR) 160A was used as the target gene, which is closely related to plant growth and development (Yang et al. 2014, 2019). Transgenic T1 seeds (fluorescent) were selected and grown into T1 plants. Homozygous mutant offspring were identified from non-fluorescent T2 seeds. Genome editing was confirmed by DNA polymerase chain reaction (PCR) and DNA sequencing. The results of this study may provide a useful reference for the establishment of a CRISPR/Cas9 system for improved ecological safety and gene editing efficiency.

Materials and methods

Plants and other materials

Wild-type seeds of A. thaliana Col-0 were treated with 75% ethanol for 4 min, 100% ethanol for 5 min, and then aseptically spread on Murashige and Skoog solid medium. After incubation at 4 °C for 48 h, the seeds were transferred into a growth chamber. The cultures were incubated for 6 days in a growth chamber at 21 ± 2 °C with a 15-h light/9-h dark cycle. Then, the seedlings were transplanted into the soil and placed in a growth chamber for normal growth. The pHDE CRISPR construct plasmid and the pCBC plasmid were provided by Professor Yunde Zhao, from the University of California, San Diego (USA). Escherichia coli DH5α competent cells (MCC001) and Agrobacterium GV3101 competent cells were from Dingguo Biosciences (Beijing, China). The restriction endonucleases and high-fidelity PFU DNA polymerase were purchased from New England Biolabs.

Construction of the CRISPR construct

DNA oligonucleotides and selection of target sites

Using the CRISPRscan software, high-scoring target sequences of the miR160A gene were identified as candidates for the CRISPR construct. The Rgenome software was employed to evaluate the off-target potential of the high-scoring target sequences. The DNA target sequences were designed based on the scoring results, so that the selected target sequences would be less likely to result in off-target editing. The SnapGene software was used for vector construction analysis. Primer Premier 5 was used for primer design and analysis, and MegAlign 5.00 (DNASTAR, Inc., Madison, WI, USA) was used for DNA sequence analysis. All DNA primers were synthesized by Invitrogen (Shanghai) Co., Ltd and are listed in Table 1.
Table 1

DNA primers used in the present study

Primer name

Primer sequence (5′ → 3′)a

Size (bp)

miR160A-F

CTAGAGTCGAAGTAGTGATTGAAGAGCACGATGGAGAAGCGTTTTAGAGCTAGAAATAGC

60

miR160A-R

TGCTATTTCTAGCTCTAAAACTGAGTGGGTTCTTCATGTGCAATCTCTTAGTCGACTCTA

60

35S-F

TAATGCATTTTATGACTTGCAACATGGTGGAGCACGACAC

40

35S-R

CCAAGAGCTCCGTGTCCTCTCCAAATGAAA

30

mCherry-F

ATCGTTTTGCTCGAGAACCTGAGGGTACA

29

mCherry-R

GAATTCGTTGTCAATCAATTAATACGATAATTTATTTGAA

40

Cas9-F

CGAGGACATTGTGCTGAC

18

Cas9-R

GACGATATTCACTTGTGGC

19

160A-GT1

GCCTTTCTCTTCTCACTTGCC

21

160A-GT2

TGAGGCAATGTGAGACCAACA

21

DNA primers miR160A-F and miR160A-R were the two target sequences for the miR160A gene, used in sgRNAs for the CRISPR construct; 35S-F and 35S-R were used for the CaMV35S promoter PCR reaction; mCherry-F and mCherry-R were used for the mCherry gene PCR assay; Cas9-F and Cas9-R were used to amplify the transgenic elements in the transgenic progeny by PCR; 160A-GT1 and 160A-GT2 were used to amplify the miR160A gene in a transgenic progeny

Construction of the mCherry CRISPR construct

The CaMV 35S promoter and the mCherry gene were amplified by PCR, respectively, with the plasmid pHDE-mcherry (Ouyang et al. 2018) used as the template. The PCR products of 35S promoter and mCherry were used as templates for fusion PCR amplification. The PCR was carried out using the forward primer (35S-F) of the 35S promoter and the reverse primer (mCherry-R) of the mCherry gene to obtain a full-length DNA fragment of 35S-mCherry. The 35S-mCherry fragment was ligated into the pHDE plasmid at the EcoRI site to obtain the recombinant plasmid, which was transformed into E. coli DH5α competent cells. After verification by colony PCR, the plasmid DNA extracted from positive colonies was sequenced.

The pCBC plasmid, containing the gRNA scaffold, was used as a template to amplify the gRNA with a promoter, and the DNA fragment was recovered and ligated into the pHDE-35S-mCherry plasmid at the BsaI site. After transforming E. coli DH5α competent cells, positive recombinant plasmids were sequenced to obtain the CRISPR construct for plant transformation. Figure 1 shows the CRISPR construct with guide RNAs.
Fig. 1

Schematic diagram of recombinant plasmid pHDE-35S-Mcherry-miR160A. U6-26P and U6-29P are the promoters of two gRNAs, respectively. EC2P is the promoters of Cas9, and 35S is the promoters driving of mCherry gene

Transformation of Arabidopsis

The pHDE-35S-mCherry-miR160A construct was transformed into Agrobacterium tumefaciens for the transformation of Arabidopsis. Aerial parts of A. thaliana were soaked using the inflorescence dip method, and the seeds from the transformed plants were collected for the detection of fluorescent T1 generation seeds.

Fluorescent screening of transformed progeny and verification of the edited target gene

The T1 seeds were screened under a fluorescence microscopy at 580 nm, and those that showed red fluorescence were grown into T1 plants. The T1 transformed plants from the fluorescent seeds were screened for DNA editing by genotyping of the target region by PCR. The DNA fragment of the target gene was amplified using PCR with primers 160A-GT1 and 160A-GT2 (Table 1).

Seeds without fluorescence were selected from homozygous mutant T2 plants. PCR amplification was used to determine whether the Cas9 gene was present in T2 plants from these seeds. Cas9-F and Cas9-R (Table 1) were used to amplify the transgenic elements in the transgenic progeny by PCR.

Results

The successfully constructed pHDE-35S-mCherry-gmiR160A plasmid was transformed into A. thaliana using an Agrobacterium-mediated method, and the transformed T1 seeds were screened for mCherry fluorescence under a fluorescence microscope. Fluorescent seeds were selected and retained (Fig. 2a) for next generation growth and genotyping. Leaf genomic DNA from the T1 generation plant was extracted for PCR verification. The construct design included two target sequences, and the middle fragment of the miR160A gene between the two target sequences can be knocked out; homozygous mutation will result in the amplification of a smaller DNA fragment than wild-type; A heterozygous mutation will result in the amplification of two fragments (one large and one small), while the wild-type would show a large amplified fragment (Fig. 3).
Fig. 2

Phenotypic comparison of gene-edited mutants and wild type of Arabidopsis. a Fluorescence-labeled Arabidopsis mutant and wild seeds. b Comparison of mutant and wild-type Arabidopsis seedlings. c Comparison of homozygote mutant and wild-type Arabidopsis leaves. d Comparison of homozygote mutant and wild-type Arabidopsis flowers

Fig. 3

PCR verification of the knocked-out target gene DNA fragment in T1 plants. DNA primers 160A-GT1 and 160A-GT2 (Table 1) were used to amplify the miR160A gene fragment. PCR products were analyzed using electrophoresis in a 1% agarose gel. Lanes 1–24: CRISPR construct-transformed plants of T1; Lane 25: Wild type control

The PCR amplification results showed a higher probability of heterozygous than homozygous mutations, and the total mutation rate was close to 50%. Sequencing analysis of the PCR product of the homozygous mutant revealed that the target gene fragment was successfully deleted between the two target sequences, as originally designed (Fig. 4).
Fig. 4

DNA sequencing results of the PCR product encompassing the two sgRNA target sites. DNA primers 160A-GT1 and 160A-GT2 (Table 1) were used to amplify the miR160A gene fragment. The sequencing tracers show the DNA sequence of miR160A from the 5′-end (tracer a) and from the 3′-end (tracer b), respectively. The deleted DNA fragment of 729 bp was located between the two target sites

The Cas9 sequence PCR of the red fluorescent seed progeny resulted in the amplification of the Cas9 DNA fragment, further confirming that the progeny with red fluorescent seeds contained the exogenously transformed CRISPR/Cas9 element (Lane 1 of Fig. 5).
Fig. 5

Verification of the absence of the Cas9 gene by PCR in non-fluorescent T2 plants. DNA primers Cas9-F and Cas9-R (Table 1) were used to amplify the transgenic elements in the transgenic progeny. PCR products were analyzed using electrophoresis in a 1% agarose gel. Lane 1: DNA product amplified from a T1 fluorescent seed; Lanes 2–13: negative PCR from plants grown from T1 non-fluorescent seeds; lane M: DNA marker

The leaf and flower traits of the homozygous mutant plants were markedly different from those of the wild type (Fig. 2b–d). Some of those homozygous T2 will have the T-DNA construct, some will not. Those homozygous T2 seeds with the T-DNA construct and mCherry fluorescent protein gene were red. However, for some homozygous T2 seeds, transgenes could be eliminated after gametogenesis and chromosome segregation since the offspring without transgenic elements did not show fluorescence. The color of these seeds was normal (without fluorescence under a fluorescence microscopy at 580 nm). Seeds without fluorescence were selected from homozygous mutant plants. PCR amplification was used to determine whether the Cas9 gene was present in the T2 plants from these seeds. The PCR results were all negative, except a positive control with the transgenic unit (Fig. 5). The data clearly showed that the non-fluorescent plants were all Cas9-negative, indicating that the non-fluorescent seed progeny had no exogenous DNA transformation elements. The T2 generation plants were subjected to genetic analysis of the stability of the target gene. The homozygous mutant resulted in a PCR band with the deletion of the miR160A gene, identical to the homozygous mutation in the previous generation (Fig. 6).
Fig. 6

DNA fragment deletion verification of the target gene non-fluorescent T2 plants. DNA primers 160A-GT1 and 160A-GT2 (Table 1) were used to amplify the miR160A gene fragment. PCR products from the DNA of plants derived from the wild type control; lanes 3–12: PCR products from DNA of T2 plants derived from non-fluorescent seeds of homozygous mutant plants

Discussion

The CRISPR/Cas9 system has significant advantages over the traditional transgenic technologies. After completion of the genetic editing of the target gene, the exogenous transformation element can be eliminated through the segregation of chromosomes in the process of progeny gametogenesis, with no trace of transgenes in the edited progeny. Additionally, no foreign gene is required to be used in the end product. Therefore, gene-edited plants, with transgenes removed, are biologically safe (Liu et al. 2015, 2018; Wang et al. 2018a, b).

In the present study, the expression of the mCherry fluorescent protein gene, driven by the CaMV 35S promoter, was used to produce the fluorescent protein in transgenic plants. Seeds with fluorescence were screened to retain (T1) or to eliminate (T2) transgenic seeds. By selecting fluorescent T1 seeds and eliminating the non-transgenic offspring, progeny screening became simpler. For T2 seeds, transgenes could be eliminated after gametogenesis and chromosome segregation since the offspring without transgenic elements did not show fluorescence. Moreover, gene editing most likely occurs in a different chromosome or away from the insertion site of transgenic DNA. This method of fluorescent marker-based screening used to determine whether the CRISPR/Cas9 system exists in a seed is simple and accurate. Detection of a gene editing event requires only PCR analysis and a fluorescence screening of the seed coat. Using mCherry for the screening of the mutant offspring greatly improves the efficiency and provides a method for obtaining new germplasm resources, without the requirement of exogenous transgene elements, in a genetically modified progeny of sexually propagated crops.

It is crucial to design a highly efficient CRISPR/Cas9 system to save time, labor, and resources. The efficiency of gene editing can be improved by using multiple sgRNAs to edit the same target gene, and the deletion of a large fragment of the genome is also beneficial for the mutant screening procedure. In the present study, two different sgRNAs were designed for one target gene to simultaneously identify different sites of the target sequence, to improve target recognition and gene editing efficiency, and to reduce the possibility of off-target editing.

The CRISPR/Cas9 system is an effective gene editing tool that offers advantages such as simplicity, high efficiency, and specificity, which are absent in other gene editing tools (Fan et al. 2015). For the effective use of CRISPR/Cas9 DNA-editing systems, researchers must find ways to reduce the occurrence of off-target and inefficient gene editing. Thus, ongoing developments and the wide application of CRISPR/Cas9 technology will enable scientists and technicians to maximize efficiency and accuracy in gene editing (Donohoue et al. 2017; Mao et al. 2017). Next, we will apply this screening marker gene to obtain gene edited offspring without transformed components in other plants, and continue to study the function of miR160A during the growth and development of Arabidopsis.

Conclusion

In the present study, a highly efficient DNA editing construct with a fluorescence screening marker gene was successfully developed, and the transgenic element was successfully eliminated from the progeny by avoiding T2 seeds with fluorescent marker. This system can be used as a plant genome site-specific editing technique and may be useful in the improvement of plant genetic resources.

Notes

Acknowledgements

This research was supported by the National Natural Science Foundation of China (31470677), the Natural Science Foundation of Guangdong Province (2017A030307017), the Science and Technology Tackle Key Project (2017A030303087) of Guangdong Province, and Key Project of Basic Research and Applied Research of Guangdong Province (2018KZDXM047).

Compliance with ethical standards

Conflict of interest

The authors declare no conflict of interests.

Ethical approval

This article does not contain any studies with human participants or animals performed by any of the authors.

References

  1. Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, Zhang F (2013) Multiplex genome engineering using CRISPR/Cas systems. Science 339:819–823CrossRefGoogle Scholar
  2. Donohoue PD, Barrangou R, May AP (2017) Advances in industrial biotechnology using CRISPR-Cas systems. Trends Biotechnol 36:2Google Scholar
  3. Fan D, Liu TT, Li CF, Bo J, Shuang L, Yishu H, Keming L (2015) Efficient CRISPR/Cas9-mediated targeted mutagenesis in Populus in the first generation. Sci Rep 5:12217CrossRefGoogle Scholar
  4. Gao X, Chen J, Dai X, Zhang D, Zhao Y (2016) An effective strategy for reliably isolating heritable and Cas9-free Arabidopsis mutants generated by CRISPR/Cas9-mediated genome editing. Plant Physiol 171:1794CrossRefGoogle Scholar
  5. Hu CH, Deng GM, Sun X-X (2017) Establishment of an efficient CRISPR/Cas9-mediated gene editing system in banana. Sci Agric Sin 50:1294–1301Google Scholar
  6. Jinek M, Chylinski K, Fonfara L, Hauer M, Doudna JA, Chanrpentier E (2012) A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337:816–821CrossRefGoogle Scholar
  7. Liu TT, Fan D, Ran LY (2015) Highly efficient CRISPR/Cas9-mediated targeted mutagenesis of multiple genes in Populus. Hereditas 37:1044–1052PubMedGoogle Scholar
  8. Liu Y, Merrick P, Zhang Z, Ji C, Yang B, Fei S (2018) Targeted mutagenesis in tetraploid switchgrass (Panicum virgatum L.) using CRISPR/Cas9. Plant Biotechnol 16:381–393CrossRefGoogle Scholar
  9. Mali P, Yang L, Esvelt KM, Aach J, Guell M, DiCarlo JE, Norville JE, Church GM (2013) RNA-guided human genome engineering via Cas9. Science 339:823–826CrossRefGoogle Scholar
  10. Mao Y, Botella JR, Zhu JK (2017) Heritability of targeted gene modifications induced by plant-optimized CRISPR systems. Cell Mol Life Sci 74:1075–1093CrossRefGoogle Scholar
  11. Ouyang LJ, Yuan YM, Li LM, Chen KZ, Dai F (2018) Construction of Eucalyptus grandis miR156 family CRISPR/Cas9 vector. J For Environ 38:488–493Google Scholar
  12. Wang P, Zhang J, Sun L, Ma Y, Xu J, Liang S (2018a) High efficient multisites genome editing in allotetraploid cotton (Gossypium hirsutum) using CRISPR/Cas9 system. Plant Biotechnol J 16:137–150CrossRefGoogle Scholar
  13. Wang Y, Li XG, Qiu LJ (2018b) Advances in the study of off-target phenomena in genome-targeted editing of CRISPR/Cas9. Bull Bot 4:528–541Google Scholar
  14. Yang CX, Xu M, Wang MX, Huang MR (2014) Advance on miR160 /miR167 /miR390 family and its target genes in plants. J Nanjing For Univ 38(3):155–159Google Scholar
  15. Yang T, Wang Y, Teotia S, Wang Z, Shi C, Sun H, Gu Y, Zhang Z, Tang G (2019) The interaction between miR160 and miR165/166 in the control of leaf development and drought tolerance in Arabidopsis. Sci Rep 9(1):2832CrossRefGoogle Scholar

Copyright information

© The Author(s) 2019

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.

Authors and Affiliations

  1. 1.College of Biological and Food EngineeringGuangdong University of Petrochemical TechnologyMaomingChina

Personalised recommendations