Advertisement

Experimental and Applied Acarology

, Volume 68, Issue 3, pp 299–314 | Cite as

The natural infection of birds and ticks feeding on birds with Rickettsia spp. and Coxiella burnetii in Slovakia

  • Lenka Berthová
  • Vladimír Slobodník
  • Roman Slobodník
  • Milan Olekšák
  • Zuzana Sekeyová
  • Zuzana Svitálková
  • Mária Kazimírová
  • Eva ŠpitalskáEmail author
Article

Abstract

Ixodid ticks (Acari: Ixodidae) are known as primary vectors of many pathogens causing diseases in humans and animals. Ixodes ricinus is a common ectoparasite in Europe and birds are often hosts of subadult stages of the tick. From 2012 to 2013, 347 birds belonging to 43 species were caught and examined for ticks in three sites of Slovakia. Ticks and blood samples from birds were analysed individually for the presence of Rickettsia spp. and Coxiella burnetii by PCR-based methods. Only I. ricinus was found to infest birds. In total 594 specimens of bird-attached ticks were collected (451 larvae, 142 nymphs, 1 female). Altogether 37.2 % (16/43) of bird species were infested by ticks and some birds carried more than one tick. The great tit, Parus major (83.8 %, 31/37) was the most infested species. In total, 6.6 and 2.7 % of bird-attached ticks were infected with Rickettsia spp. and C. burnetii, respectively. Rickettsia helvetica predominated (5.9 %), whereas R. monacensis (0.5 %) was only sporadically detected. Coxiella burnetii was detected in 0.9 %, Rickettsia spp. in 8.9 % and R. helvetica in 4.2 % of bird blood samples. The great tit was the bird species most infested with I. ricinus, carried R. helvetica and C. burnetti positive tick larvae and nymphs and was found to be rickettsaemic in its blood. Further studies are necessary to define the role of birds in the circulation of rickettsiae and C. burnetii in natural foci.

Keywords

Birds Ixodes ricinus Rickettsia helvetica Rickettsia monacensis Coxiella burnetii Slovakia 

Introduction

Ixodid ticks (Acari: Ixodidae) are known as primary vectors of many pathogens causing diseases of humans and animals. The hard tick Ixodes ricinus is a common ectoparasite in Europe and birds are often hosts of subadult stages. Ixodes ricinus is associated with deciduous and mixed forests, and its distribution has significantly expanded over the past decades. Presently, its occurrence in city parks, cemeteries, gardens and peri-urban areas is not surprising (Mulder et al. 2013). It can transmit a number of viral, bacterial and protozoan microorganisms with medical and veterinary importance, such as the tick-borne encephalitis virus, Borrelia burgdorferi sensu lato, Anaplasma phagocytophilum, Candidatus Neoehrlichia mikurensis, Rickettsia helvetica, Rickettsia monacensis, Babesia divergens, Babesia venatorum and Babesia microti (Rizzoli et al. 2014).

Birds serve as maintenance hosts for tick larvae and nymphs, introducing and maintaining tick-borne pathogens. It is known that birds play a role as reservoirs of some species of B. burgdorferi s.l. (Ogden et al. 2008; Tarageľová et al. 2008; Dubská et al. 2009). The competence of vertebrates, including birds, to function as Rickettsia reservoirs capable to transmit and infect ticks with rickettsiae is still a subject of discussion and study (Ioannou et al. 2009; Špitalská et al. 2011; Hornok et al. 2013, 2014; Capligina et al. 2014; Lommano et al. 2014). Rickettsiae are Gram negative intracellular bacteria associated with eukaryotic cells within which they live, divide by binary fission and may cause diseases called rickettsioses. They are transmitted by various arthropod taxa such as ticks (Ixodida), mites (Mesostigmata), fleas (Siphonaptera) or blood-sucking lice (Anoplura). Ticks play the role of reservoirs and vectors of rickettsiae.

Coxiella burnetii is the causative agent of Q fever, a worldwide distributed zoonotic bacterial disease. Domestic ruminants (cattle, sheep, and goats) are considered as the main reservoirs for C. burnetii; they are often asymptomatic carriers, but the agent may also cause abortion in these animals. Many wild mammals and birds have been found to be hosts of the infectious microorganism. Among ectoparasites, ticks are considered to be the natural primary reservoirs of C. burnetii (Porter et al. 2011).

The purpose of this study was to assess tick infestation of birds, to evaluate the occurrence and prevalence of Rickettsia species and C. burnetii in bird-attached ticks and blood samples of birds, to evaluate whether birds can actually become infected/bacteraemic with Rickettsia sp., particularly with R. helvetica and C. burnetii, and to explore the potential role of avian hosts in the circulation and dissemination of Rickettsia species and C. burnetii in suburban and natural sites of Slovakia.

Materials and methods

Study sites

Birds were captured in three sites in Slovakia (Fig. 1). The first site, Bratislava (259 m above sea level, 48°10′N, 17°03′E), is part of a suburban forest (city forest park). It is characterized by deciduous woodlands, oaks in lower altitudes and beech in higher altitudes. The second site, Prievidza (289 m a.s.l., 48°47′N, 18°34′E), is a forest-steppe natural area with Carpathian oak-hornbeam woods. The third study site, Drienovec (181 m a.s.l., 48°10′N, 17°03′E), is part of the Slovak Karst National Park in South-East Slovakia. There is an ornithological (bird ringing) station located in submediterranean xero-thermophilous oak woods and colline limestone grasslands.
Fig. 1

Map showing study areas: 1—Bratislava, 2—Prievidza, 3—Drienovec (source of layers: ErasData-pro, 2004)

Sample collection

Birds were mist-netted during April–August 2012 and April–beginning of October 2013 (2012: for 3 days in June, 1 day in August in Bratislava, 1 day in April and 1 day in July in Prievidza, 3 days in April in Drienovec; 2013: for 2 days in May, 3 days in June, 1 day in September in Bratislava, as well as for 1 day in April, 1 day in May, 2 days in July, 1 day in September and 1 day in October in Prievidza). In Bratislava and Prievidza 70 m of bird mist nets with 16 × 16 mm mesh size were used, in Drienovec 174 m. The mist nets were exposed from early morning to noon. In each study site, the mist nets were hidden in a habitat where flying activity of birds is frequent, i.e., between groups of bushes and/or on the edge of forest and steppe. Each captured bird was identified according to Svensson (1992) and Hromádko et al. (1992, 1993, 1998), ringed and released. All birds were checked for the presence of ticks by inspecting the skin, especially on the head. Ticks were removed with fine forceps, preserved in 70 % ethanol, and stored individually. Ticks were identified to species and developmental stage according to Hillyard (1996). All birds were blood sampled (ca. 30 µl) from the vena ulnaris cutanea using a 1 ml X-tra-fine Needle, Insulin Syringes (Dispo Van, HMD Healthcare, UK) and stored in 96 % ethanol at 5–7 °C until analyses.

Bird species were grouped (1) based on their relationship to humans into synanthropic (cohabiting with humans) and non-synanthropic birds (Johnston 2001), and (2) according to foraging strategy to ground-foraging birds, birds of medium foraging level and birds of high foraging level (Table 1). Ground-foraging species regularly feed on the ground, birds of medium foraging level could also feed on the ground, and thus birds of these groups could be often in contact with ticks.
Table 1

Numbers of captured birds and their infestation with Ixodes ricinus tick larvae (L), nymphs (N) or adults (A)

Bird species

Total

Bratislava

Prievidza

Drienovec

No. of captured/tick infested birds/ticks

No. of captured/tick infested birds (L/N/A)

No. of captured/tick infested birds (L/N/A)

No. of captured/tick infested birds (L/N/A)

Synanthropic

    

 Aegithalos caudatus a

 Long-tailed Tit

1/0

 

1/0

 

 Carduelis carduelis

 European Goldfinch

15/0

 

4/0

11/0

 Carduelis chloris

 European Greenfinch

26/2/2

 

26/2 (0/2/0)

 

 Coccothraustes coccothraustes

 Hawfinch

3/0

  

3/0

 Cyanistes caeruleus a

 Eurasian Blue Tit

13/3/6

6/2 (2/1/0)

3/1 (1/2/0)

4/0

 Dendrocopos major b

 Great Spotted Woodpecker

5/0

4/0

1/0

 

 Emberiza citronella

 Yellowhammer

5/0

 

1/0

4/0

 Erithacus rubecula

 European Robin

52/22/66

2/2 (12/2/0)

8/1 (11/0/0)

42/17 (16/25/0)

 Falco tinnunculus b

 Common Kestrel

1/0

 

1/0

 

 Ficedula albicollis b

 Collared Flycatcher

1/0

 

1/0

 

 Ficedula hypoleuca b

 European pied Flycatcher

1/0

  

1/0

 Fringilla coelebs

 Common Chaffinch

9/2/15

1/0

5/2 (13/2/0)

3/0

 Hippolais icterina b

 Icterine Warbler

1/0

 

1/0

 

 Lanius collurio

 Red-backed Shrike

1/0

 

1/0

 

 Luscinia megarhynchos

 Common Nightingale

1/0

  

1/0

 Muscicapa striata b

 Spotted Flycatcher

1/1/2

1/1 (2/0/0)

  

 Parus major b

 Great Tit

37/31/380

25/23 (319/32/0)

12/8 (17/12/0)

 

 Passer montanus

 Eurasian Tree Sparrow

7/1/2

 

5/1 (2/0/0)

2/0

 Phoenicurus phoenicurus b

 Common Redstart

1/0

 

1/0

 

 Phylloscopus collybita a

 Common Chiffchaff

3/2/2

 

3/2 (0/2/0)

 

 Poecile palustris b

 Marsh tit

2/1/1

 

2/1 (1/0/0)

 

 Prunella modularis

 Dunnock

7/3/14

 

6/2 (7/2/0)

1/1 (0/5/0)

 Serinus serinus

 European Serin

19/0

 

17/0

2/0

 Sitta europaea b

 Eurasian Nuthatch

11/7/26

10/7 (24/1/1)

1/0

 

 Streptopelia turtur

 European Turtle Dove

1/0

 

1/0

 

 Sylvia atricapilla b

 Eurasian Blackcap

60/1/1

1/0

27/1 (1/0/0)

32/0

 Sylvia borin b

 Garden Warbler

1/0

 

1/0

 

 Sylvia communis b

 Common Whitethroat

1/0

 

1/0

 

 Sylvia curruca

 Lesser Whitethroat

7/0

 

3/0

4/0

 Turdus merula

 Common Blackbird

13/8/63

2/1 (6/3/0)

7/3 (2/16/0)

4/4 (6/30/0)

 Turdus philomelos

 Song Thrush

3/3/3

 

2/2 (1/1/0)

1/1 (0/1/0)

Subtotal

309/87/583

52/36 (365/39/1)

142/28 (56/39/0)

115/23 (22/61/0)

Non-synanthropic

    

 Acrocephalus palustris b

 Marsh Warbler

2/0

 

2/0

 

 Alcedo athis b

 Common Kingfisher

1/0

 

1/0

 

 Anthus trivialis

 Tree Pipit

1/0

 

1/0

 

 Certhia familiaris b

 Eurasian Treecreeper

1/0

 

1/0

 

 Emberiza cia

 Rock Bunting

2/1/2

  

2/1 (0/2/0)

 Emberiza schoeniclus

 Common Reed Bunting

17/0

 

15/0

2/0

 Locustella naevia

 Common Grasshopper Warbler

1/0

  

1/0

 Parus montanus

 Willow Tit

6/4/9

5/4 (8/1/0)

1/0

 

 Phylloscopus trochilus a

 Willow warbler

2/0

 

2/0

 

 Picus viridis

 European Green Woodpecker

2/0

2/0

  

 Remiz pendulinus b

 Eurasian Penduline Tit

2/0

 

2/0

 

 Scolopax rusticola

 Eurasian Woodcock

1/0

 

25/0

1/0

Subtotal

38/5/11

7/4 (8/1/0)

 

6/1 (0/2/0)

Total

347/92/594

59/40 (373/40/1)

167/28 (56/39/0)

121/24 (22/63/0)

aBirds of high foraging level, b birds of medium foraging level

DNA isolation

Ticks were washed with 70 % ethanol and sterile water, dried, transferred to individual tubes and crushed with a sterile Carbon Steel Surgical Scalpel Blade (Surgeon, JAI Surgicals, India). A volume of 100–150 µl of each blood sample was transferred with sterile pipette tip to germ-free 1.5-ml Eppendorf tube and incubated with open lids at 56 °C to evaporate residual ethanol completely. DNA extractions from ticks and blood were performed using NucleoSpin® Tissue (Macherey–Nagel, Germany) following the manufacturer’s recommendation. The quantity and quality of DNA was assessed by NanoPhotometer Pearl (Implen, Germany). DNA samples were stored at −20 °C until subsequent analyses. Ticks and blood samples were screened by PCR-based methods for the presence of tick-borne pathogens, Rickettsia spp. and C. burnetii.

Detection and typing of Rickettsia spp. and Coxiella burnetii

Rickettsia spp. were identified in tick and blood samples by a PCR targeting fragment of the citrate synthase (gltA) and sca4 (encoding an intracytoplasmic protein) genes (Regnery et al. 1991; Sekeyová et al. 2001; Labruna et al. 2004). The primer pair CBCOS, CBCOE (Špitalská and Kocianova 2003) targeting the com1 gene encoding an approximately 27-kDa outer membrane-associated immunoreactive protein of C. burnetii was employed for the detection of C. burnetii in tick and blood samples. Both positive (R. slovaca from Dermacentor marginatus tick and C. burnetii originated from the deposit of the Institute of Virology, Bratislava) and negative controls were included in all PCR amplifications. For detection of Rickettsia spp. PCR amplifications in final volume of 20 µl were carried out using the DyNAzymeTM PCR Master Mix (Finnzymes, Finland) on thermocycler PTC-200 Peltier Thermal Cycler (MJ Research, Canada) as recommended by the manufacturer. The HOT FIREPol® DNA Polymerase (Solis BioDyne, Estonia) and the thermocycler Labcycler (SensoQuest, Germany) was used in order to detect C. burnetii. PCR amplifications were followed by gel electrophoresis (1.0 % agarose).

Rickettsia-positive tick samples were screened for the presence of R. helvetica using TaqMan PCR assay targeting a 65-bp fragment of the 23S rRNA gene using DyNAmo™ Probe qPCR (Finnzymes) on Bio-Rad CFX96™ Real-Time System as previously described by Boretti et al. (2009). Each run of TaqMan PCR reactions included a negative template control, a positive control, and DNA standards containing 3 × 100–3 × 106 target copies with a sensitivity of three copies of the DNA.

The presence of rickettsiae in blood samples was also evaluated by three TaqMan PCRs, detecting part of the gltA and 16S rRNA genes of Rickettsia spp., and part of the 23S rRNA gene of R. helvetica as described by Boretti et al. (2009) and Melničáková et al. (2013). Samples were considered positive when minimum two tests were positive and Ct < 38. All primers and probes are listed in Table 2 and were synthesised by Microsynth (Switzerland).
Table 2

Primers and probes used in this study

Targeted organism/gene

Primers and probes

Sequences (5′-3′)

References

Rickettsia sp./gltA

CS78

CS323

GCAAGTATCGGTGAGGATGTA

GCTTCCTTAAAATTCAATAAATC

Labruna et al. (2004)

Rickettsia sp./gltA

RPCS877

RPCS1258

GGGGACCTGCTCACGGCGG

ATTGCAAAAAGTACAGTGAACA

Regnery et al. (1991)

Rickettsia sp./sca4

D767f

D1390r

CGATGGTAGCATTAAAAGCT

CTTGCTTTTCAGCAATATCAC

Sekeyová et al. (2001)

Rickettsia sp./gltA

CS-P

FAM-TGCAATAGCAAGAACCGTAGGCTGGATG-BHQ

Boretti et al. (2009)

CS-F

TCGCAAATGTTCACGGTACTTT

 

CS-R

TCGTGCATTTCTTTCCATTGTG

 

Rickettsia sp./16S rRNA

RcqPCR F

RcqPCR R

RcqPCR P

GCTTAACCTCGGAATTGCTT

CGTCAGTTGTAGCCCAGATG

HEX-CCTTCGCCACCGGTGTTCCT-TAMRA

Melničáková et al. (2003)

R. helvetica/23S rRNA

Rickhelv.170p

Rickhelv.147f

Rickhelv.211r

6FAM-AACCGTAGCGTACACTTA-MGBNFQ

TTTGAAGGAGACACGGAACACA

TCCGGTACTCAAATCCTCACGTA

Boretti et al. (2009)

Coxiella burnetii/com1

CBCOS

CBCOE

GCTGTTTCTGCCGAACGTAT

AGACAACGCGGAGGTTTTTA

Špitalská et al. (2003)

Rickettsia-positive amplicons which were simultaneously negative for R. helvetica by TaqMan PCR were purified and analysed by sequencing both DNA strands by Macrogen (The Netherlands; http://www.macrogen.com). DNA sequences were compared with available databases in GenBank using the Basic Local Alignment Search Tool (BLAST) on http://blast.ncbi.nlm.nih.gov/.

Data and statistical analysis

We determined tick infestation prevalence (P), intensity of parasitization (I), standard deviation (SD), median (Med) and interquartile ranges (IQR). Tick infestation prevalence is the proportion between the number of birds with ticks and the number of captured birds. Intensity of parasitization is the number of ticks per infested bird. Differences in the tick infestation prevalence on birds between study sites and groups of birds and in the prevalences of pathogens in tick larvae and nymphs between study sites were analysed by Fisher’s exact test (α = 0.05) using Past v.2.17b software (Hammer et al. 2001).

Results

Tick infestation of birds

During this study, 347 birds (59 in suburban area, Bratislava; 167 in natural area, Prievidza; 121 in natural area with ornithological station, Drienovec) representing 43 species from 19 families were captured (Table 1). Overall, the most frequently captured bird species was the Eurasian blackcap (17.3 %). Per site, the most frequently captured bird species were the great tit (42.4 %), Eurasian blackcap (16.2 %) and European robin (34.7 %) in Bratislava, Prievidza and Drienovec, respectively.

In total, 594 I. ricinus specimens were collected from 92 birds representing 16 species. No other tick species was found. A total of 451 larvae was collected from 70 birds representing 15 species. A total of 142 nymphs was collected from 49 birds of 12 species. A female I. ricinus was removed from Eurasian Nuthatch. The overall number of ticks removed from one bird ranged from 1 to 42. Twenty-six birds (28.3 %) were infested with one tick, 66 of tick-infested birds (71.7 %) were infested with two or more ticks. In total 21 birds (22.8 %) of nine species were coinfested with nymphs and larvae.

The average intensity of parasitization (I) was 6.5 ticks per bird (Med = 2; IQR = 3.2), 5.3 larvae/bird (Med = 2; IQR = 2.6) and 1.7 nymphs/bird (Med = 1; IQR = 1). The average intensity of parasitization per site was as follows: 10.4 (Med = 3.7; IQR = 5.9) in Bratislava, 3.4 (Med = 2.5; IQR = 3.1) in Prievidza, and 3.5 (Med = 2.4; IQR = 3) in Drienovec. The most tick-infested bird species was the great tit (I = 12.3) followed by common blackbird (I = 7.9) and the common chaffinch (I = 7.5). The great tit (I = 15.3), common chaffinch (I = 7.5) and common blackbird (I = 9.0) were the most tick-infested bird species in Bratislava, Prievidza and Drienovec, respectively. The average intensity of parasitization of synantrophic and non-synanthropic birds was 6.7 (Med = 2; IQR = 3.6) and 2.2 (Med = 2.15; IQR = 0) ticks/bird, respectively. Considering foraging strategy, the average intensity of parasitization was 3.8 ticks/bird (Med = 2.3; IQR = 2.7) in ground-foraging birds, 10.0 ticks/bird (Med = 2; IQR = 2.7) in birds of medium foraging level and 1.6 ticks/bird (Med = 1.5; IQR = 0) in birds of high foraging level.

Total tick infestation prevalence (P ± SD) on birds was 26.5 ± 2.4 %, with the highest value of 83.8 % (31/37) on the great tit (the song thrush was excluded because only three specimens were captured). The tick infestation prevalence on birds was 67.8 ± 6.1 % in Bratislava, 16.8 ± 2.9 % in Prievidza and 19.8 ± 3.6 % in Drienovec. The tick infestation prevalence on synanthropic and non-synanthropic birds was 28.2 ± 2.6 and 13.2 ± 5.5 %, respectively (Fischer’s exact test: p = 0.04). The tick infestation prevalence was 23.1 ± 3.0, 31.8 ± 4.1, and 26.3 ± 10.1 % on ground-foraging birds, on birds of medium foraging level and on birds of high foraging level, respectively.

Infections in ticks

All 594 I. ricinus collected from birds were tested for rickettsial and C. burnetii infections by PCR-based methods. In total, Rickettsia infection (%, mean ± SD) was detected in 6.6 ± 1.0 % (39/594) of ticks: 5.8 ± 1.1 % (27/451) in larvae, 8.5 ± 2.3 % (12/142) in nymphs and in one female. Rickettsia-positive I. ricinus larvae were collected from great tit, European robin, common chaffinch and Rickettsia-positive nymphs from great tit, Eurasian nuthatch, dunnock, European robin and common blackbird. All Rickettsia-positive ticks were removed from synanthropic bird species (Table 3). The prevalence rate in larvae and nymphs did not differ significantly (Fischer’s exact test: p = 0.24). Rickettsia spp. DNA was confirmed in 6.0 % (25/414) of the ticks from birds in Bratislava, 8.4 % (8/95) of the ticks in Prievidza and 7.1 % (6/85) of the ticks in Drienovec (Table 3). Rickettsia helvetica was the dominant species found in 35 out of 39 Rickettsia-positive tick larvae and nymphs. Ticks positive for R. helvetica were removed from birds captured in all study sites. Rickettsia monacensis was identified in three nymphs from Drienovec. Unidentified Rickettsia sp. was found in a single I. ricinus female (Table 3). Partial sequencing of the gltA gene of this unidentified Rickettsia sp. showed 100 % identity with Candidatus Rickettsia vini strain 4GA09/32 (accession no. JF803266). Partial sequencing of the sca4 gene of this unidentified Rickettsia sp. showed 99 % identity with Rickettsia sp. AUS118 (accesion no. KF666473) and 98.6 % identity with Rickettsia peacockii str. Rustic (accesion no. CP001227).
Table 3

Rickettsia spp. and Coxiella burnetii infections in ticks collected from birds

Bird species

Bratislava

Prievidza

Drienovec

Larvae

Nymphs

Adult

Larvae

Nymphs

Larvae

Nymphs

Synanthropic

 Erithacus rubecula

 

0/0/1/2a

 

1/0/0/11

 

1/0/0/16

0/2/0/25

 Fringilla coelebs

   

4/0/0/13

   

 Parus major

20/0/10/319

3/0/1/33

     

 Prunella modularis

    

1/0/0/2

  

 Sitta europaea

0/0/2/24

1/0/0/1

1b/1

    

 Turdus merula

    

2/0/0/16

 

2/1/0/30

Non-synanthropic

 Parus montanus

0/0/1/8

0/0/1/1

     

Total

20/0/13/351

4/0/3/37

1b/1

5/0/0/24

3/0/0/18

1/0/0/16

2/3/0/55

a R. helvetica-positive ticks/R. monacensis-positive ticks/C. burnetii-positive ticks/No. of tested ticks, b unidentified Rickettsia sp

Coxiella burnetii DNA was found in 2.7 ± 0.7 % of ticks (16/594; 2.9 % of larvae, 2.1 % of nymphs). Four species of birds harboured C. burnetii–positive ticks, i.e., European robin, great tit, willow tit and Eurasian nuthatch. Most of C. burnetii–positive ticks were removed from synanthropic birds (87.5 %). All of them were captured in Bratislava (Table 3).

No tick was infected by Rickettsia sp. and C. burnetii simultaneously. However, two individuals of great tit carried both Rickettsia sp.- and C. burnetii-positive ticks at the same time.

Infections in bird blood samples

In total 336 blood samples from 22 tick-infested and 314 tick-free birds were analysed for the presence of Rickettsia spp. and C. burnetii. Rickettsia spp. was found in 8.9 ± 1.6 % (30/336) of blood samples. Rickettsia helvetica was identified in 4.2 ± 1.1 % (14/336) of blood samples: in great tit (n = 3), Eurasian blackcap (n = 2), Eurasian blue tit (n = 2), common chaffinch (n = 2) and in one specimen of dunnock, common blackbird, European robin, common reed bunting and Eurasian tree sparrow. Rickettsia helvetica-positive birds were captured in all study sites.

On the 14 R. helvetica-positive birds four R. helvetica-positive larvae and four nymphs, one R. monacensis-positive nymph and 59 Rickettsia-negative larvae and 38 nymphs were found. Table 4 shows infestation of infected birds with infected and uninfected ticks. On the 322 R. helvetica-negative birds 22 R. helvetica-positive larvae and five nymphs, two R. monacensis-positive nymphs and an unidentified Rickettsia sp.-positive female were found (Table 5). The range of Ct values (33–38) reflected low to medium levels of bacterial loads. The pathogen loads were up to 103 copy numbers per sample.
Table 4

Rickettsia spp. infection in ticks collected from individual birds with Rickettsia spp.-positive blood

 

Birds with Rickettsia spp.-positive

Birds with Rickettsia helvetica-positive

Blood

Ticks/no. of removed ticks

Blood

Ticks/no. of removed ticks

Bratislava

E. rubecula

0 (1a)/12

C. caeruleus

0

P. major

0/9

C. caeruleus

0/1

P. viridis

0

P. major

1/20

  

P. major

5/19

  

P. major

0

Prievidza

S. serinus

0

S. atricapilla

0

S. serinus

0

F. coelebs

0

S. atricapilla

0

F. coelebs

0

S. atricapilla

0

E. schoeniclus

0

S. atricapilla

0

Passer montanus

0

E. rubecula

0

P. modularis

1/8

C. chloris

0

  

P. major

0/5

  

P. major

0

  

P. major

0

  

Drienovec

E. rubecula

0/1

E. rubecula

0

S. atricapilla

0

S. atricapilla

0

T. philomelos

0/1

T. merula

1 (1b)/21

Total

 

0/28

 

8/69

aOne C. burnetii-positive tick, b one R. monacensis-positive tick

Table 5

Rickettsia spp. infection in ticks collected from birds with Rickettsia spp.-positive or -negative blood

Birds

Ticks

Rickettsia spp.-positive

Rickettsia spp.-negative

Total

Rickettsia spp.-positive blood

9

97

106

Rickettsia spp.-negative blood

30

458

488

Total

39

555

594

Coxiella burnetii was present in 0.9 % (3/336) blood samples. All three C. burnetii-positive birds (two European robin and one Eurasian blackcap) were captured during spring migration in Drienovec in 2012. None of C. burnetii-positive birds carried C. burnetii-positive ticks.

Discussion

In this study, we have investigated bird-attached I. ricinus specimens and blood samples of birds in three sites of Slovakia for the presence of tick-borne pathogens, Rickettsia spp. and C. burnetii. Ixodes ricinus is an ectoparasite of reptiles, birds and mammals. Unlike birds, the locomotion activity of reptiles and mammals is limited. Being able to fly, birds can easily cross barriers and transport ticks for long distances. The transport of ticks harbouring tick-borne pathogens by migratory birds from endemic areas to new regions can occur every year during spring and autumn migrations (e.g. Capligina et al. 2014), but birds also contribute to the spread of potentially infected ticks to urban parks and gardens (Hornok et al. 2014; Rizzoli et al. 2014).

In our study, mostly larvae (75.9 %), many nymphs (23.9 %) and a single adult female of I. ricinus were collected from 92 birds of 16 species. These results are in contrast with previous studies where nymphs feeding on birds were more common than larvae (Špitalská et al. 2006, 2011; Tarageľová et al. 2008; Franke et al. 2010). But in Switzerland also more I. ricinus larvae than nymphs and one female were collected from birds (Lommano et al. 2014). The most parasitized birds considering the number of ticks per bird were those feeding on the ground or medium foraging level such as the great tit, song thrush, the blackbird, the common chaffinch, dunnock, European robin, which are most likely to come into contact with ticks. Similar data were also previously recorded by Tarageľová et al. (2005), Špitalská et al. (2006, 2011) and Hornok et al. (2014).

Detection of rickettsiae in ticks collected from wild birds dates back to 1964, when Somov and Soldatov (1964) isolated Rickettsia sibirica from Haemyphysalis concinna in the Far East. Recently, European robin was found as a carrier of a Rickettsia-positive I. ricinus nymph in Slovakia (Špitalská et al. 2006). Rickettsia helvetica was found in an I. ricinus nymph from dunnock and undescribed Rickettsia spp. were detected in I. arboricola larvae and a nymph collected from great tit in the Czech Republic (Špitalská et al. 2011). Sekeyová et al. (2012) provided the first evidence of the presence of Rickettsia africae in Ceratophyllus garei fleas, collected from Eurasian reed warbler, Acrocephalus scirpaceus passing Slovakia during spring migration. In the present study, both larvae and nymphs of I. ricinus were found positive for Rickettsia sp. and C. burnetii, without significant difference in infection numbers. Similar data were recorded by Hornok et al. (2014) from Hungary. In contrast, Špitalská et al. (2011) and Lommano et al. (2014) found a higher rate of Rickettsia-infected bird-feeding larvae than nymphs in the Czech Republic and Switzerland, respectively. In these studies from Central Europe, Rickettsia-positive I. ricinus subadults were mostly collected from great tit, Eurasian nuthatch, European robin, dunnock and common blackbird, comparable with results of the present study. Rickettsia species in ticks captured from these birds were identified as R. helvetica and R. monacensis. Both rickettsiae are associated with human diseases. Some human cases caused by R. helvetica have been reported from Sweden, France, Switzerland, and Italy and two human cases of R. monacensis infections were reported in Spain (Nilsson et al. 1999, 2010; Fournier et al. 2000, 2004; Baumann et al. 2003; Jado et al. 2007; Nilsson 2009). Rickettsia helvetica and a novel strain of Rickettsia sp. (sister taxon of R. bellii) were also found in I. ricinus ticks collected from the common nightingale in the Czech Republic (Dubská et al. 2012). Rickettsia helvetica- and R. monacensis-infected I. ricinus larvae and nymphs were found to be carried by European robin, redwing Turdus iliacus, common blackbird, song thrush and great tit captured in Germany, Hungary, on a bird conservation island in the Baltic Sea and in Switzerland (Franke et al. 2010; Hildebrandt et al. 2010; Hornok et al. 2013; Lommano et al. 2014). Rickettsia helvetica was also identified in H. concinna from European robin; Rickettsia aeschlimannii in Hyalomma marginatum from European robin was identified for the first time in Hungary (Hornok et al. 2013). Moreover, Elfving et al. (2010) identified Rickettsia infections in I. ricinus and Ixodes lividus larvae and nymphs from Eurasian blue tit and redwing captured in Sweden. In Portugal, R. helvetica was identified in male Ixodes ventalloi collected from the short-eared owl Asio flammeus; R. aeschlimannii was found in three nymphs of Hy. marginatum collected from common kingfisher Alcedo athis, little owl Athene noctua, and Eurasian eagle owl Bubo bubo; and Rickettsia massiliae was found in female Rhipicephalus turanicus from the common buzzard Buteo buteo (Santos-Silva et al. 2006). All these results throughout Europe indicate extensive distribution of different Rickettsia species transmitted by Ixodid ticks and disseminated by birds.

Another significant result of the present study is the molecular evidence of bacteraemia in birds caused by R. helvetica. Similar studies on molecular evidence of Rickettsia spp. and C. burnetii were carried out by Stańczak et al. (2009), Ioannou et al. (2009), Špitalská et al. (2010) and Hornok et al. (2014). Stańczak et al. (2009) evaluated blood samples collected from birds, cervids and rodents in Poland for the presence of rickettsiae, but none were found positive. In Cyprus, Ioannou et al. (2009) recorded 1.5 % of pooled bird blood samples PCR positive for unknown rickettsiae and 25.2 % for C. burnetii. Špitalská et al. (2010) recorded Rickettsia infection in blood samples of coal tit Periparus ater, great tit, Eurasian blue tit and European greenfinch that originated from Slovakia, Austria and the Czech Republic. Great tit and Eurasian blue tit were bacteraemic also in the present study. Hornok et al. (2014) by using the same TaqMan PCR method as in our study, found 4.7 % (CI 1.7–9.9 %) blood-sampled birds PCR positive for R. helvetica in Hungary: they were robins and dunnock, with a range of Ct values 33–40, reflecting low to medium levels of bacterial loads. The values for rickettsial infections in blood and the representation of infected bird species are comparable to our study. The infected bird species and their ticks are known for their synanthropic life. Hornok et al. (2014) suggested that rickettsaemia persists after detachment of the vector tick in relevant avian hosts and rickettsaemic birds may provide a source of infection for I. ricinus, but with low efficacy. Data of our study support these suggestions.

The great tit was the most infested bird species with I. ricinus, carried R. helvetica and C. burnetti positive larvae and nymphs and was found to be rickettsaemic in its blood. Although our results did not confirm significantly higher infection of ticks on infected birds compared to non-infected ones, based on rickettsial infection detected in ticks feeding on birds and in bird blood samples, our previous results (Špitalská et al. 2010) and findings of Hornok et al. (2013, 2014), we hypothesize that synanthropic birds could play a role of carrier of infected ticks and thus could ensure the geographical distribution and maintenance of Rickettsia spp. and C. burnetii in nature. To prove birds as reservoirs of tick-borne pathogens of the genus Rickettsia is not easy. A reservoir host is defined by its capacity to infect ticks feeding on it (Kahl et al. 2002). One method that helps to identify reservoirs in nature is the comparison of infection rates in questing larvae and nymphs with larvae fed on the suspected host in the same habitat. A higher infection rate in larvae feeding on an examined host is a strong indication that the host is a reservoir, particularly when the pathogen is not transmitted transovarially from the female to its eggs. But this is not the case of Rickettsia spp. which are transmitted transovarially. Moreover, for xenodiagnostic studies on birds which could be the aim of next investigations, special permissions are required.

Notes

Acknowledgments

This study was financially supported by the Project VEGA No. 2/0061/13 from the Scientific Grant Agency of Ministry of Education and Slovak Academy of Sciences and by Projects Nos. 0280-12 and DO7RP–0014–11 from the Slovak Research and Development Agency. The study was partly funded by EU Grant FP7-261504 EDENext and is catalogued by the EDENext Steering Committee as EDENext392 (http://www.edenext.eu). The contents of this publication are the sole responsibility of the authors and don’t necessarily reflect the views of the European Commission. This contribution is also the result of using infrastructure acquired by the project implementation (code ITMS: 26240220044), supported by the Research & Development Operational Programme funded by the ERDF. The authors thank Dr. Veronika Rusňáková-Tarageľová and Dr. Elena Kocianová for their help with identification of ticks.

Compliance with ethical standards

The experiments presented in this paper comply with current laws of the Slovak Republic. Birds were captured, ringed, blood sampled and released under the permission of the Ministry of Environment of the Slovak Republic No. 9368/2011-2.2.

Conflict of interest

No competing financial interest exist. The authors declare no conflict of interest.

References

  1. Baumann D, Pusterla N, Péter O, Grimm F, Fournier PE, Schär G, Bossart W, Lutz H, Weber R (2003) Fever after a tick bite: clinical manifestations and diagnosis of acute tick-borne infections in north-eastern Switzerland. Dtsch Med Wochenschr 128:1042–1047CrossRefPubMedGoogle Scholar
  2. Boretti FS, Perreten A, Meli MM, Cattori V, Willi B, Wengi N, Hornok S, Honegger H, Hegglin D, Woelfel R, Reusch CE, Lutz H, Hofmann-Lehmann R (2009) Molecular investigation of Rickettsia helvetica infection in dogs, foxes, humans, and Ixodes ticks. Appl Environ Microbiol 75:3230–3237PubMedCentralCrossRefPubMedGoogle Scholar
  3. Capligina V, Salmane I, Keišs O, Vilks K, Japina K, Baumanis V, Ranka R (2014) Prevalence of tick-borne pathogens in ticks collected from migratory birds in Latvia. Ticks Tick Borne Dis 5(1):75–81CrossRefPubMedGoogle Scholar
  4. Dubská L, Literák I, Kocianová E, Tarageľová E, Sychra O (2009) Differential role of Passerine birds in distribution of Borrelia spirochetes, based on data from ticks collected from birds during the postbreeding migration period in Central Europe. Appl Environ Microbiol 75:596–602PubMedCentralCrossRefPubMedGoogle Scholar
  5. Dubská L, Literak I, Kverek P, Roubalova E, Kocianova E, Taragelova V (2012) Tick-borne zoonotic pathogens in ticks feeding on the common nightingale including a novel strain of Rickettsia sp. Ticks Tick Borne Dis 3:265–268CrossRefPubMedGoogle Scholar
  6. Elfving K, Olsen B, Bergstrom S, Waldenstrom J, Lundkvist A, Sjostedt A, Mejlon H, Nilsson K (2010) Dissemination of spotted fever rickettsia agents in Europe by migrating birds. PLoS ONE 5:e8572PubMedCentralCrossRefPubMedGoogle Scholar
  7. Fournier PE, Grunnenberger F, Jaulhac B, Gastinger G, Raoult D (2000) Evidence of Rickettsia helvetica infection in humans, eastern France. Emerg Infect Dis 6:389–392PubMedCentralCrossRefPubMedGoogle Scholar
  8. Fournier PE, Allombert C, Supputamongkol Y, Carusso G, Brouqui P, Raoult D (2004) Aneruptive fever associated with antibodies to Rickettsia helvetica in Europe and Thailand. J Clin Microbiol 42:816–818PubMedCentralCrossRefPubMedGoogle Scholar
  9. Franke J, Meier F, Moldenhauer A, Straube E, Dorn W, Hildebrandt A (2010) Established and emerging pathogens in Ixodes ricinus ticks collected from birds on a conservation island in the Baltic Sea. Med Veter Entomol 24:425–432CrossRefGoogle Scholar
  10. Hammer O, Harper DAT, Ryan PD (2001) PAST: paleontological statistics software package for education and data analysis. Palaeontol Electron 4:9Google Scholar
  11. Hildebrandt A, Franke J, Meier F, Sachse S, Dorn W, Straube E (2010) The potential role of migratory birds in transmission cycles of Babesia spp., Anaplasma phagocytophilum, and Rickettsia spp. Ticks Tick borne Dis 1:105–107CrossRefPubMedGoogle Scholar
  12. Hillyard PD (1996) Ticks of North-West Europe. Field Studies Council, ShrewsburyGoogle Scholar
  13. Hornok S, Csörgő T, de la Fuente J, Gyuranecz M, Privigyei C, Meli ML, Kreizinger Z, Gönczi E, Fernández de Mera IG, Hofmann-Lehmann R (2013) Synanthropic birds associated with high prevalence of tick-borne rickettsiae and with the first detection of Rickettsia aeschlimannii in Hungary. Vector Borne Zoonotic Dis 13(2):77–83CrossRefPubMedGoogle Scholar
  14. Hornok S, Kováts D, Csörgő T, Meli ML, Gönczi E, Hadnagy Z, Takács N, Farkas R, Hofmann-Lehmann R (2014) Birds as potential reservoirs of tick-borne pathogens: first evidence of bacteraemia with Rickettsia helvetica. Parasites Vectors 7:128PubMedCentralCrossRefPubMedGoogle Scholar
  15. Hromádko M, Horáček J, Chytil J, Pithart K, Škopek J (1992) Guide to the determination of our passerines 1. Publisher ZUV, Hradec Králové (in Czech) Google Scholar
  16. Hromádko M, Horáček J, Chytil J, Pithart K, Škopek J (1993) Guide to the determination of our passerines 2. Publisher ZUV, Hradec Králové (in Czech) Google Scholar
  17. Hromádko M, Horáček J, Chytil J, Pithart K, Škopek J (1998) Guide to the determination of our passerines 3. Publisher ZUV, Hradec Králové (in Czech) Google Scholar
  18. Ioannou I, Chochlakis D, Kasinis N, Anayiotos P, Lyssandrou A, Papadopoulos B, Tselentis Y, Psaroulaki A (2009) Carriage of Rickettsia spp., Coxiella burnetii and Anaplasma spp. by endemic and migratory wild birds and their ectoparasites in Cyprus. Clin Microbiol Infect 15(Suppl 2):158–160CrossRefPubMedGoogle Scholar
  19. Jado I, Oteo JA, Aldámiz M, Gil H, Escudero R, Ibarra V, Portu J, Portillo A, Lezaun MJ, García-Amil C, Rodríguez-Moreno I, Anda P (2007) Rickettsia monacensis and human disease, Spain. Emerg Infect Dis 13:1405–1407PubMedCentralCrossRefPubMedGoogle Scholar
  20. Johnston RF (2001) Synanthropic birds of North America. In: Marzluff JM, Bowman R, Donnelly R (eds) Avian ecology and conservation in an urbanizing world. Springer, New York, pp 49–67CrossRefGoogle Scholar
  21. Kahl O, Gern L, Eisen L, Lane RS (2002) Ecological research on Borrelia burgdorferi sensu lato: terminology and some methodological pitfalls. In: Gray J, Kahl O, Lane RS, Stanek G (eds) Lyme Borreliosis: biology, epidemiology and control. CAB International, Wallingford, pp 29–46CrossRefGoogle Scholar
  22. Labruna MB, Whitworth T, Horta MC, Bouyer DH, McBride JW, Pinter A, Popov V, Gennari SM, Walker DH (2004) Rickettsia species infecting Amblyomma cooperi ticks from an area in the state of Sao Paulo, Brazil, where Brazilian spotted fever is endemic. J Clin Microbiol 42:90–98PubMedCentralCrossRefPubMedGoogle Scholar
  23. Lommano E, Dvořák C, Vallotton L, Jenni L, Gern L (2014) Tick-borne pathogens in ticks collected from breeding and migratory birds in Switzerland. Ticks Tick Borne Dis 5:871–882CrossRefPubMedGoogle Scholar
  24. Melničáková J, Derdáková M, Barák I (2013) A system to simultaneously detect tick-borne pathogens based on the variability of the 16S ribosomal genes. Parasites Vectors 6:269PubMedCentralCrossRefPubMedGoogle Scholar
  25. Mulder S, van Vliet AJH, Bron WA, Gassner F, Takken W (2013) High risk of tick bites in Dutch gardens. Vector Borne Zoonotic Dis 13:865–871CrossRefPubMedGoogle Scholar
  26. Nilsson K (2009) Septicaemia with Rickettsia helvetica in a patient with acute febrile illness, rash and myasthenia. J Infect 58:79–82CrossRefPubMedGoogle Scholar
  27. Nilsson K, Lindquist O, Pahlson C (1999) Association of Rickettsia helvetica with chronic perimyocarditis in sudden cardiac death. Lancet 354:1169–1173CrossRefPubMedGoogle Scholar
  28. Nilsson K, Elfving K, Páhlson C (2010) Rickettsia helvetica in patient with meningitis, Sweden 2006. Emerg Infect Dis 16:490–492PubMedCentralCrossRefPubMedGoogle Scholar
  29. Ogden NH, Lindsay LR, Hanincová K, Barker IK, Barker IK, Bigras-Poulin M, Charron DF, Heagy A, Francis CM, O’Callaghan CJ, Schwartz I, Thompson RA et al (2008) Role of migratory birds in introduction and range expansion of Ixodes scapularis ticks and of Borrelia burgdorferi and Anaplasma phagocytophilum in Canada. App Environ Microbiol 74:1780–1790CrossRefGoogle Scholar
  30. Porter SR, Czaplicki G, Mainil J, Guattéo R, Saegerman C (2011) Q fever: current state of knowledge and perspectives of research of a neglected zoonosis. Int J Microbiol (Article ID 248418)Google Scholar
  31. Regnery RL, Spruill CL, Plikaytis BD (1991) Genotypic identification of rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsial genes. J Bacteriol 173:1576–1589PubMedCentralPubMedGoogle Scholar
  32. Rizzoli A, Silaghi C, Obiegala A, Rudolf I, Hubalek Z, Foldvari G, Plantard O, Vayssier-Taussat M, Bonnet S, Špitalská E, Kazimírová M (2014) Ixodes ricinus and its transmitted pathogens in urban and peri-urban areas in Europe: new hazards and relevance for public health. Front Public Health 2:251PubMedCentralCrossRefPubMedGoogle Scholar
  33. Santos-Silva MM, Sousa R, Santos AS, Melo P, Encarnação V, Bacellar F (2006) Ticks parasitizing wild birds in Portugal: detection of Rickettsia aeschlimannii, R. helvetica and R. massiliae. Exp Appl Acarol 39:331–338CrossRefPubMedGoogle Scholar
  34. Sekeyová Z, Roux V, Raoult D (2001) Phylogeny of Rickettsia spp. inferred by comparing sequences of ‘gene D’, which encodes an intracytoplasmic protein. Int J Syst Evol Microbiol 51:1353–1360CrossRefPubMedGoogle Scholar
  35. Sekeyová Z, Mediannikov O, Roux V, Subramanian G, Špitalská E, Krištofík J, Darolová A, Raoult D (2012) Identification of Rickettsia africae and Wolbachia sp. in Ceratophyllus garei fleas from Passerine birds migrated from Africa. Vector Borne Zoonotic Dis 12:539–543PubMedCentralCrossRefPubMedGoogle Scholar
  36. Somov GP, Soldatov GM (1964) On the role of birds in circulation of tick-borne spotted typhus in nature. Zhurnal Mikrobiol Epidemiol Immunobiol 1:126–129Google Scholar
  37. Špitalská E, Kocianova E (2003) Detection of Coxiella burnetii in ticks collected in Slovakia and Hungary. Eur J Epidemiol 18:263–266CrossRefPubMedGoogle Scholar
  38. Špitalská E, Literák I, Sparagano OAE, Golovchenko N, Kocianová E (2006) Ticks (Ixodidae) from passerine birds in the Carpathian region. Wien Klin Wochenschr 118(23–24):759–764CrossRefPubMedGoogle Scholar
  39. Špitalská E, Kocianová E, Darolová A, Krištofík J, Literák I, Sekeyová Z (2010) The role of birds in transmittion of rickettsiae. Joint protection of human and animal health. Reviewed proceedings (In Slovak: Úloha vtákov v cirkulácii rickettsií. Spoločná ochrana zdravia ľudí a zdravia zvierat. Recenzovaný zborník), pp 108–111Google Scholar
  40. Špitalská E, Literák I, Kocianová E, Tarageľová V (2011) The importance of Ixodes arboricola in transmission of Rickettsia spp., Anaplasma phagocytophilum, and Borrelia burgdorferi sensu lato in the Czech Republic, Central Europe. Vector Borne Zoonotic Dis 11:1235–1241CrossRefPubMedGoogle Scholar
  41. Stańczak J, Racewicz M, Michalik J, Cieniuch S, Sikora B, Skoracki M (2009) Prevalence of infection with Rickettsia helvetica in feeding ticks and their hosts in western Poland. Clin Microbiol Infect 15(Suppl 2):328–329CrossRefPubMedGoogle Scholar
  42. Svensson L (1992) Identification guide to European passerines, 4th edn. Lars Svensson, StockholmGoogle Scholar
  43. Tarageľová V, Koči J, Hanincová K, Olekšák M (2005) Songbirds as hosts for ticks (Acari, Ixodidae) in Slovakia. Biológia 60:529–537Google Scholar
  44. Tarageľová V, Koči J, Hanincová K, Kurtenbach K, Derdáková M, Ogden NH, Literák I, Kocianová E, Labuda M (2008) Blackbirds and song thrushes constitute a key reservoir of Borrelia garinii, the causative agent of borreliosis in central Europe. Appl Environ Microbiol 74:1289–1293CrossRefGoogle Scholar

Copyright information

© Springer International Publishing Switzerland 2015

Authors and Affiliations

  • Lenka Berthová
    • 1
  • Vladimír Slobodník
    • 2
  • Roman Slobodník
    • 3
  • Milan Olekšák
    • 4
  • Zuzana Sekeyová
    • 1
  • Zuzana Svitálková
    • 5
  • Mária Kazimírová
    • 5
  • Eva Špitalská
    • 1
    Email author
  1. 1.Institute of VirologySlovak Academy of SciencesBratislavaSlovakia
  2. 2.State Nature Conservancy of the Slovak RepublicPrievidzaSlovakia
  3. 3.Raptor Protection of SlovakiaBratislavaSlovakia
  4. 4.National Park Slovak KarstBrzotínSlovakia
  5. 5.Institute of ZoologySlovak Academy of SciencesBratislavaSlovakia

Personalised recommendations