Journal of Pest Science

, Volume 90, Issue 4, pp 1287–1294 | Cite as

Assessing the use of antimicrobials to sterilize brown marmorated stink bug egg masses and prevent symbiont acquisition

  • Christopher Taylor
  • Veronica Johnson
  • Galen Dively
Original Paper
  • 430 Downloads

Abstract

The brown marmorated stink bug, Halyomorpha halys (Stål), is dependent on a beneficial obligate symbiont for successful development, survival, and fecundity. The bacteria are deposited on the egg mass surface by the female, and first instar nymphs become inoculated with the bacteria by feeding on the egg chorions upon hatching. Targeting the bacteria exposed on the egg mass surface may prove to be a viable management strategy for the stink bug. Egg masses were surface-treated with several antimicrobials and surfactants to determine whether exposure to these products adversely affected the fitness of newly hatched nymphs and/or sterilized the egg mass surface to prevent nymphal acquisition of the symbiont. Laboratory results showed that egg hatch rate was significantly reduced by Agri-Mycin and Naiad, nymphal survival was significantly impacted by AzaGuard and Naiad, and symbiont acquisition was significantly disrupted by Naiad, AzaGuard, and Liquid Copper Fungicide. Under field conditions, there were no significant treatment effects on nymphal survival or symbiont acquisition, but egg hatch rate was reduced by Naiad and Triton-X. Products with both antimicrobial effects and the ability to penetrate the coating covering the bacteria provided the best chance for disrupting symbiont acquisition.

Keywords

Stink bug Symbiont disruption Antimicrobials Surfactants 

Key message

  • Halyomorpha halys, brown marmorated stink bug, is a serious pest of agricultural crops.

  • It is dependent on obligate symbiont bacteria for successful development, survival, and fecundity.

  • Targeting the bacteria exposed on the egg mass surface may prove to be a viable management strategy.

  • We showed that egg mass exposure to several antimicrobials and surfactants reduced egg hatch, nymphal survival, and symbiont acquisition.

  • Products with both antimicrobial effects and the ability to penetrate the coating covering the bacteria provided the best chance for disrupting symbiont acquisition.

Introduction

Insect–microbe associations are very common across many orders of insects, including the Hemiptera, which contains many economically important insect pests that have associations with primary and secondary symbionts (Buchner 1965). These include: leafhoppers (Auchenorrhyncha: Cicadellidae: Moran et al. 2003, 2005; Takiya et al. 2006; Wu et al. 2006; Noda et al. 2012; Ferrater et al. 2013), aphids (Sternorrhyncha: Aphididae: Douglas 1998; Oliver et al. 2003; Donald et al. 2016; Enders and Miller 2016; Zhang et al. 2016), and whiteflies (Sternorrhyncha: Aleyrodidae: Zchori-Fein and Brown 2002; Himler et al. 2011; Bing et al. 2012). Within the Heteroptera, these associations are primarily documented for the superfamily Pentatomoidae (Abe et al. 1995; Fukatsu and Hosokawa 2002; Prado et al. 2006; Prado and Almeida 2009; Kaiwa et al. 2010; Taylor et al. 2014). With recent improvements in genetic identification techniques, more and more of these relationships are being recognized and characterized (Moran et al. 2008).

The brown marmorated stink bug, Halyomorpha halys (Stål), is an invasive pest from Southeast Asia (Hoebeck and Carter 2003) that has been steadily expanding its range in the USA since the mid-1990s (Haye et al. 2015). Originally detected in Allentown, Pennsylvania, it has become a severe agricultural pest in the mid-Atlantic states and surrounding areas (Leskey et al. 2012a). Recent studies have shown that this stink bug, like many other species in the family Pentatomidae, harbors a gammaproteobacteria in the fourth region of the midgut and is dependent on this symbiont for successful development, survival, and fecundity (Taylor et al. 2014). These bacteria, described as a new species Candidatus Pantoea carbekii, are free-living in special invaginations of the gut, referred to as crypts (Bansal et al. 2014). They are passed on from mother to offspring via a coating that is secreted on the eggs during oviposition and are located underneath and intercalated within this secretion (Kenyon et al. 2015). The first instars, upon hatching, become inoculated by immediately probing the egg chorions. Observations of depressions in the head capsule while probing indicate nymphal sucking behavior, so it is very likely that nymphs regurgitate onto the egg chorions and/or use existing moisture to take up the bacteria. This probing behavior only lasts for a few hours, and once the nymphs have fully sclerotized, the probing behavior ceases. This type of extracellular acquisition is common in other stink bug species (Otero-Bravo and Sabree 2015) and is in contrast to the method of transmission in the Auchenorrhyncha and Sternorrhyncha groups, whereby the bacteria are housed within special cells called bacteriocytes and passed on to the next generation transovarially (Buchner 1965; Moran and Telang 1998; Moran et al. 2008).

Because the bacteria are present on the surface of the egg mass for the duration of the pre-hatch period, they are exposed to the surrounding environment and thus may be easy to manipulate. In studies requiring aposymbiotic stink bugs to be generated, a sterilizing agent such as bleach on the egg mass was used to remove the bacteria from the surface and prevent the newly hatched nymphs from acquiring them (Prado et al. 2006; Prado and Almeida 2009). Although targeting or manipulating the symbiont has been suggested as a possible management strategy (Douglas 2007; Prado and Zucchi 2012), real world applications of an egg mass sterilization method are lacking in the literature. Mathews and Barry (2014) did show impacts on hatch rate and early instar survival when H. halys egg masses were treated with compost tea, but whether this impacted the symbionts on the egg mass surface was not verified. Many antimicrobial products are available commercially in crops and other commodities for the management of disease pathogens, such as bacterial blights, mildews, and fungi. Thus, it is reasonable that these products could have similar antimicrobial effects on the symbiont bacteria. Owing to the probing behavior of the first instars, it is also possible that any residues present on the egg masses that are inadvertently ingested by the nymphs may have direct effects on nymphal fitness. This may have accounted for the decreases in nymphal survival when compost tea was applied to egg masses (Mathews and Barry 2014). With the knowledge that H. halys is heavily reliant on these bacteria for survival (Taylor et al. 2014), the bacteria can be viewed as a weak link in the life history of this insect, and efforts to target the bacteria themselves may lead to effective management suppression of H. halys.

Reported here are studies to determine whether egg mass exposure to a number of commercially available products, including antimicrobials and surfactants, adversely affects the fitness of H. halys nymphs and/or sterilizes the egg mass surface to prevent nymphal acquisition of the symbiont. Replicated egg masses were surface-treated with each product in the laboratory and evaluated for egg hatchability, nymphal survival to the second instar, and nymphal inoculation rates. The most effective products were also evaluated by exposing egg masses to spray solutions delivered by simulated airblast application in a peach orchard under field conditions. We hypothesized that one or more of these products will have direct effects on nymphal fitness and symbiont acquisition.

Materials and methods

Laboratory study

Insect culture

H. halys adults were collected from field sites throughout the summer of 2014 at two University of Maryland Research and Education facilities (Beltsville and Keedysville, MD) and maintained in a laboratory colony for egg production. Adults were reared in mesh cages (60 × 30 × 35 cm) on 3-week old potted green bean plants, Phaseolus vulgaris L., and fed bean pods and raw sunflower seeds. Egg masses laid on the leaves of plants were removed within 48 h with a cork borer to produce a 15 mm leaf disk with each egg mass. Egg masses collected were randomly assigned to each treatment.

Products tested

Many antimicrobials and surfactants are commercially available as possible candidates for testing. However, we chose products that would be more applicable in organic operations and also more achievable in orchard systems, since many fruit growers rely on antimicrobials to manage fruit rots, and H. halys is a major pest of tree fruit crops (Leskey et al. 2012b). With these criteria for product selection, the following six commercial products were chosen for evaluation: (1) Naiad (Naiad Company, Inc.), a combination of non-ionic and ionic surfactants used as a wetting agent in turf, ornamentals, and agriculture. This product and other surfactants have been shown to reduce plant disease severity by acting as an antimicrobial agent (Stanghellini 1987, 1996; Stanghellini and Miller 1997; Irish et al. 2002; Mickler 2002); (2) AzaGuard (BioSafe Systems LLC), an insect growth regulator insecticide with the active ingredient azadirachtin (organically certified); (3) Ecotec (Brandt Consolidated, Inc.), an insecticide/miticide with a combination of essential oils as active ingredients (organically certified); (4) OxiDate 2.0 (BioSafe Systems LLC), an antimicrobial with active ingredients hydrogen dioxide and peroxyacetic acid (organically certified); (5) Agri-Mycin 17 (Nufarm Limited), an antimicrobial with active ingredient streptomycin sulfate; and (6) Liquid Copper Fungicide (Southern Agricultural Insecticides, Inc.), an antimicrobial with the active ingredient copper diammonia diacetate complex. Concentrations were based on the label rate of each product for use in orchard crops. For labels with directions for use by crop area, we used a diluted spray volume of 948 L per hectare, which represents the high range used commercially to achieve runoff in fruit orchards. Products were mixed with water in 100 mL aliquots according to the following concentrations: Naiad at 0.5% by volume (surfactants are typically used at 0.5–1% by volume); AzaGuard at 0.125% by volume (1.18 L per hectare); Ecotec at 0.5% by volume (4.74 L per hectare); OxiDate 2.0 at 0.25% by volume (1:400, volume:volume); Agri-Mycin at 100 ppm (60 mg per 100 mL); and Liquid Copper Fungicide at 0.78% by volume (29.6 ml per 3785 ml).

Egg mass treatments

A total of 119 egg masses were collected over the course of 2 months on nine collection dates. At each date, egg masses were randomly allocated to seven treatments (one control and six products). The number of egg masses receiving each treatment varied with collection date, but collectively totaled 17 egg masses per treatment. Egg masses assigned to the control treatment were not manipulated in any way, whereas egg masses assigned to the products were treated with a diluted solution of each respective product. The treatment solutions were applied to the egg masses using a hobbyist paint sprayer (Master Airbrush Model Kit-G23-22), which produced a fine, even mist designed to mimic the small droplet size created by an airblast pesticide sprayer. In a fume hood, the paint sprayer was held at a 45° angle approximately 18 cm away from the leaf disk with the egg mass, and the sprayed solution was delivered for approximately 5 s in a sweeping hand motion until runoff was achieved. Between treatments, the sprayer was triple-rinsed with clean water and sprayed clear for 10 s to remove any remaining residual product.

Nymphal rearing

After treatment, the number of eggs per mass was recorded, and the leaf disk with each egg mass was placed individually on a leaf terminal of a green bean plant, which was inserted into a 15-mL floral water pick and placed in a clear plastic deli container (16 × 14 × 5 cm) with a screened opening in the lid. For additional food, a green bean was placed in each container. Containers were held in an environmental chamber under favorable rearing conditions (25 °C, 65–75% humidity, 16 h L:D diurnal cycle). Leaf terminals and green beans were replaced as needed to maintain consistent freshness of the food. Dishes were misted with water and observed for hatching on a daily basis. Once hatch occurred, the number of hatched eggs was recorded, and nymphs were then observed daily. Dead nymphs were removed each day, and survival was recorded until molt to the second instar. As nymphs molted to the second instar, they were killed in 100% ethanol and stored at −20° F until PCR analysis.

DNA extraction and PCR analysis

Due to time and budget restraints, it was not possible to analyze all nymphs surviving from each egg mass for the presence of the symbiont bacteria. Instead, a subset of 6–9 egg masses from the possible 17 masses per treatment was randomly selected. Of these egg masses, a random sample of 10 nymphs was analyzed individually by PCR to determine the percentage of nymphs inoculated with the symbiont bacteria (about 550 nymphs screened). Each second instar was rinsed in an ethanol bath before being shredded with tweezers and transferred to a collection tube for DNA extraction using a Qiagen DNEasy Extraction Kit. Because of their small size, whole second instars were used instead of attempting to separate the gut contents. Attempts were made to choose at least one egg mass from each of the nine collection dates in order to treat date as a random blocking factor; however, some egg masses did not hatch in a given collection date.

PCR and gel electrophoresis was used to determine the presence or absence of the symbiont which indicated whether the nymphs were able to successfully acquire the bacteria from the egg mass surface. Primers specific to Candidatus P. carbekii were available from the literature and used to screen each nymph (Fig. 1) (~930 bp, forward: GCATATAAAGATTTTACTCTTTAGGTGGC and reverse: CTCGAAAGCACCAATCCATTTCT) (Bansal et al. 2014). For samples that did not amplify symbiont DNA, positive control primers for stink bug mitochondrial DNA were used to determine that the symbiont was truly absent from a sample and not missing due to a sample quality (Fig. 2) (147 bp, forward: CGAATCCCATTGTTTGTGTG and reverse: AGGGTCTCCTCCTCCTGATG (Kumar and Hotopp, unpublished data). Any indication of a distinct rectangular gel band, no matter how faint, was considered ‘positive’ for all samples.
Fig. 1

Example of gel electrophoresis with PCR products using H. halys second instar DNA and Candidatus P. carbekii primers; 8 out of the 10 nymphs and the positive control sample tested positively for the symbiont in this screening of egg mass replicate one from the Ecotec treatment, and gel band amplification occurred at the appropriate location on the ladder for all nine positive samples (between the 850 and 1000 bp ladder bands) with no amplification in the extraction blank or PCR blank. Note that there were differences in gel band intensity

Fig. 2

Example of gel electrophoresis with PCR products using H. halys second instar DNA and mitochondrial DNA primers; all 10 nymphs from egg mass replicate 14 for the Naiad treatment in the sample tested negatively for the symbiont in a previous PCR using symbiont primers, but those same DNA samples tested positively for stink bug mitochondrial DNA, verifying sample quality. Gel band amplification for the mitochondrial DNA occurred at the appropriate location on the ladder (between the 100 and 200 bp ladder bands) with no amplification in the extraction blank or PCR blank

Field Study

Insect culture

Due to low H. halys populations at the University of Maryland research farms during the late summer months of 2015, adults were collected from farm sites in Virginia. The stink bugs were reared in the laboratory under the same conditions as described in the laboratory study. The egg masses used for this study were all collected on one day during peak egg production.

Product information

The field study tested four treatments, including a water control, Naiad, AzaGuard, and Triton-X. Naiad and AzaGuard were chosen based on their overall ability to sterilize egg masses in the laboratory study. Another surfactant, Triton-X-100, was included because results from a preliminary trial with OxiDate 2.0 in combination with Triton-X-100 showed an increase in the ability to sterilize egg masses, whereas OxiDate 2.0 alone did not. Concentrations were used as follows: Naiad at 1% by volume (2× the concentration by volume used in the laboratory study); Triton-X-100 at 1% by volume; and AzaGuard at 1.67 L per hectare (the high range of the recommended label rate).

Field experimental design

The field study was conducted at the University of Maryland Wye Research and Education facility (Queenstown, MD) in a peach orchard. Four rows of trees were selected within the orchard, each separated by at least one row of trees. In each row, four trees were selected with at least two trees between them to avoid spray drift exposure. Trees within each row were assigned different treatments in a Latin-square design for a total of 16 trees. Each tree was treated as a replicate unit.

Egg mass preparation and treatment application

A total of 36 egg masses on leaf disks were removed from the rearing colony on one day during peak egg production. Double-sided photo album tape was used to secure each egg mass to a 5 × 5 cm index card cutout. Sand was poured over the exposed adhesive surface of the tape, so that nymphs would not become stuck upon hatching. Owing to a limited supply of egg masses from the colony, groups of two egg masses were randomly allocated to three replicate trees and three egg masses to one replicate tree for each treatment. Egg masses were attached with a staple to the underside of randomly chosen leaves in the outer canopy on one side of the respective tree, about 1.5 m above the ground at eye level. Egg masses within a tree were treated as subsamples.

Product mixtures were applied using a backpack mist sprayer (Solo, Newport News, VA), set to deliver a spray volume of 3.44 L per minute. Given this output rate, the spray volume per hectare was estimated by measuring the amount of water required to spray several trees until runoff. The spray volume was 630 L per hectare based on an average of 1.7 L per tree, each occupying 27 m2 of a hectare. This amount represented approximately the mid-range spray volume used in tree fruit applications with a commercial airblast sprayer. Once calibrated, each product was mixed in the holding tank of the sprayer with 11.4 L of water at the appropriate concentration and applied to runoff to one side of each replicate tree assigned to that treatment. Treatments were applied one product at a time to all four trees. The holding tank was triple-rinsed between treatments. Egg masses were collected approximately 30 min later, once the foliage had dried, and brought back to the laboratory.

Nymphal rearing and PCR analysis

Egg masses were reared under the same conditions as described in the laboratory study, except that the two or three egg masses per replicate were reared together in one deli container. The number of hatched eggs was recorded for each egg mass and then averaged over all masses per replicate. The newly hatched nymphs in each container were reared to determine the number surviving to the second instar. As nymphs molted to the second instar, they were killed in 100% ethanol and stored at −28.9 °C until PCR analysis. Random samples of five nymphs per replicate per treatment were selected for PCR analysis to determine the presence or absence of the symbiont. DNA extraction and PCR was conducted according to the same methods described in the laboratory study.

Statistical analyses

Data from the laboratory study were summarized as percent egg hatch, percent survival to the second instar, and percent of nymphs with symbiont inoculation. Each variable was analyzed as a one-way ANOVA using the Proc Mixed function in SAS Version 9.4 (SAS Institute 2013) to test for treatment effects. Because each egg mass was individually treated with a new product solution, egg mass was treated as the replicate unit. The collection date was considered a random blocking factor to remove possible variance due to conditions when the egg masses were collected from the colony. For data from the field study, the Proc Mixed function was used to test for treatment differences in the percentage of hatched eggs, survival to the second instar, and percent symbiont inoculation. Row and column tree positions were used as blocking factors but the mixed model removed these random factors if they did not significantly contribute to the total variance.

Results

Laboratory study

ANOVA results showed a significant treatment effect on the percentage of hatched eggs [F(6,105) = 5.56, p < 0.001], survival of nymphs to the second instar [F(6,100) = 4.4, p < 0.001], and percentage of second instars inoculated with the symbiont bacteria [F(6,41.5) = 7.3, p < 0.0001]. Average hatch rate (±SE) of the control treatment was considered normal at 91.3% ± 3.7, and not significantly different from the Ecotec treatment (90.8% ± 2.3), AzaGuard (84.7% ± 3.6), OxiDate 2.0 (88.7% ± 4.6), or Liquid Copper Fungicide (92.3% ± 1.9) (Fig. 3). However, the surfactant Naiad (60.0% ± 9.2) and Agri-Mycin (74.4% ± 8.2) significantly reduced the rate of egg hatch by 18.5–34.2%. Average percent survival (±SE) to the second instar was significantly reduced by the Naiad treatment (65.9% ± 9.0) compared to the control survival at 82.0% ± 4.7 (Fig. 4). Although AzaGuard had no effect on egg hatch, this insect growth regulator significantly reduced nymphal survival (63.0% ± 5.9). Survival of nymphs from the Agri-Mycin-treated egg masses was numerically lower (88.0% ± 3.0) but not significantly different from that of the control treatment. Treatments of Ecotec (87.0% ± 3.5), OxiDate 2.0 (85.3% ± 3.8), and Liquid Copper Fungicide (78.1% ± 4.0) (Fig. 4) had no effect on nymphal survival. Overall, 89% (±4.5 SE) of second instars surviving from untreated egg masses were inoculated with the symbiont bacteria (Fig. 5). Although numerically lower, the inoculation rates of second instars from egg masses treated with Ecotec (67.5% ± 12.5), Agri-Mycin (75.7% ± 6.5), and OxiDate 2.0 (73.7% ± 12.1) were not significant different from that of the control treatment. Egg mass treatments of Naiad (23.6% ± 12.3), AzaGuard (24.1% ± 9.5), and Liquid Copper Fungicide (35.6% ± 11.0) significantly reduced the percentage of inoculated second instars by as much as 73.5% compared to the control treatment (Fig. 5).
Fig. 3

Effects on the percentage of H. halys eggs that hatched by selected antimicrobials and surfactants in water solutions sprayed on egg masses in the laboratory. Comparisons of means (±SE) with the same letter are not significantly different (p = 0.05). Means for each treatment are based on 17 replicate egg masses

Fig. 4

Effects on the percentage of H. halys nymphs that survived to the second instar by selected antimicrobials and surfactants in water solutions sprayed on egg masses in the laboratory. Comparisons of means (±SE) with the same letter are not significantly different (p = 0.05). Means for each treatment are based on 17 replicate egg masses

Fig. 5

Effects on the percentage of H. halys nymphs that successfully acquired their symbiont by selected antimicrobials and surfactants in water solutions sprayed on egg masses in the laboratory. Comparisons of means (±SE) with the same letter are not significantly different (p = 0.05). Means for each treatment are based on either six (AzaGuard), seven (Agri-Mycin 17), eight (Naiad, Ecotec, OxiDate 2.0), or nine (Control, Liquid Copper Fungicide) replicate egg masses

Field study

One-way ANOVA indicated a significant treatment effect on egg hatch rate [F(3,12) = 5.32, p ≤ 0.015], by both surfactants, Naiad and Triton-X-100, resulting in a 10–16% reduction in the number of eggs successfully hatching from egg masses on treated trees compared to the hatch rate of untreated egg masses (94.5% ± 2.7 SE). The hatch rate of egg masses on AzaGuard-treated trees was not affected. Although there were lower survival rates of second instars from egg masses on trees treated with Naiad and Triton-X, nymphal survival, including the AzaGuard treatment, was not statistically different from that of the untreated egg masses [F(3,12) = 1.1, p = 0.39]. Similarly, none of the treatments had any significant impact on acquirement of symbiont bacteria from the surface of the egg masses [F(3,6) = 0.2, p = 0.89].

Discussion

This study is the first to evaluate the effects of antimicrobial and surfactant applications on egg hatchability and fitness of H. halys nymphs. Taken altogether, laboratory and field results support the hypothesis that egg mass exposure to these products can cause direct effects on H. halys egg hatch rate and subsequent nymphal survival, as well as lessen the success that newly hatched nymphs have at obtaining the necessary symbiont from the egg mass surface. In the laboratory study, hatch rate was significantly reduced by two of the six treatments (Agri-Mycin and Naiad), survival was significantly impacted by two of the six treatments (AzaGuard and Naiad), and symbiont acquisition success was disrupted by three of the six treatments (Naiad, AzaGuard, and Liquid Copper Fungicide). Under field conditions, there were no significant differences among treatments on nymphal survival or symbiont acquisition; however, significant reductions in average hatch rate were detected for the two surfactant treatments (Naiad and Triton-X) when compared to that of the control egg masses.

Kenyon et al. (2015) showed that the symbiotic bacteria required by H. halys are indeed located on the egg mass surface, but also revealed that the eggs are covered in a secretion, with the bacteria located underneath and intercalated within this secretion. The fact that these gut-inhabiting bacteria are not merely exposed on the surface of the egg mass is probably the main reason they are able to survive on the egg mass surface for about a week until nymphs hatch and acquire them. The secreted coating that apparently protects the bacteria also makes it difficult for any chemical application approach to target the bacteria as a method of controlling H. halys. Although egg masses were sufficiently exposed to treatments in the laboratory study, several antimicrobial products tested were ineffective at preventing symbiont acquisition, and this was most likely due to the inability to penetrate the extracellular coating to contact the bacteria. It is unknown how newly hatched nymphs bypass this coating to inoculate themselves, but they likely regurgitate saliva to break down the coating in order to imbibe it along with the symbiont. Results of this study showed an adverse impact on survival to the second instar, so it seems that the nymphs while inoculating themselves were also orally exposed to treatment residues on the egg mass surface, as evident by the AzaGuard treatment, which mainly requires ingestion to be effective.

Evidence from the laboratory study suggests that surfactants may be the most likely products to explore in future work, owing to their ability to remove or penetrate the secreted coating. Egg mass treatments of the surfactant Naiad not only significantly impacted hatch rate and survival to the second instar, but also reduced symbiont acquisition. Not surprisingly, insect growth regulator AzaGuard significantly impacted survival to the second instar but also significantly reduced symbiont acquisition. It should be noted that this product is formulated with surfactants, which might explain in part its ability to successfully kill the bacteria. Surfactants have also been shown to work as antimicrobials for plant diseases (Stanghellini 1987, 1996; Stanghellini and Miller 1997; Irish et al. 2002; Mickler 2002) by disrupting certain cell membranes of fungal structures. Clearly, products with both antimicrobial effects and the ability to penetrate the coating covering the bacteria provide the best chance for disrupting symbiont acquisition.

In contrast to the laboratory study, there was less evidence of treatment effects when products were applied to egg masses on peach trees to simulate a commercial airblast application. The two surfactants did affect egg hatch to a small but significant degree but had no detectable effects on nymphal survival or symbiont acquisition for several possible reasons. First, although the treatment solutions were sprayed on trees to run-off, actual exposure to the attached egg masses may not have been sufficient enough to affect the egg mass coating and the bacteria underneath. Secondly, the supply of colony-reared egg masses was unfortunately limited at the time of the field study, and there was some evidence of disease infection in the laboratory colony which could have affected nymphal fitness. Additionally, given the high variance in the data, the level of replication and precision in the field study was not adequate enough to statistically detect differences. Nevertheless, the combined results support the hypothesis that antimicrobials and surfactants can adversely affect H. halys egg and nymphal fitness and disrupt symbiont acquisition and thus have the potential to be used as a management tool. However, further research is needed to more rigorously evaluate different treatments applied under field conditions, particularly possible synergistic combinations of antimicrobials and surfactants to improve the ability of a treatment to penetrate the egg mass coating and sterilize the bacteria.

Author contributions

CT and GD conceived, designed, and analyzed the research. VJ assisted in the PCR and gel electrophoresis aspects of the research. CT wrote the manuscript. All authors read and approved the manuscript.

Notes

Acknowledgements

We thank Dr. Kathryn Everts for her assistance in choosing the products tested in the study, as well as Dr. Julie Dunning-Hotopp and Nikhil Kumar for providing the positive control primers used to test the quality of the DNA samples. We also thank Dr. Thomas Kuhar for providing locations in Virginia to collect H. halys adults when populations were low in Maryland. This work was funded by the following grant: United States Department of Agriculture-National Institute of Food and Agriculture (USDA-NIFA) Specialty Crop Research Initiative (SCRI) #2011-51181-30937: Biology, Ecology, and Management of Brown Marmorated Stink Bug in orchard Crops, Small Fruit, Grapes, Vegetables and Ornamentals. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Compliance of ethical standards

Conflict of interest

The authors declare that they have no conflict of interest.

References

  1. Abe Y, Mishiro K, Takanashi M (1995) Symbiont of brown-winged green bug, Plautia stali Scott. Jpn J Appl Entomol Zool 39(2):109–115CrossRefGoogle Scholar
  2. Bansal R, Michel AP, Sabree ZL (2014) The crypt-dwelling primary bacterial symbiont of the polyphagous pentatomid pest Halyomorpha halys (Hemiptera: Pentatomidae). Environ Entomol 43(3):617–625CrossRefPubMedGoogle Scholar
  3. Bing X, Yang J, Zchori-Fein E, Wang X, Liu S (2012) Characterization of a newly discovered symbiont of the whitefly Bemisia tabaci (Hemiptera: Aleyrodidae). Appl Environ Microbiol 79(2):569–575CrossRefPubMedGoogle Scholar
  4. Buchner P (1965) Endosymbionts of animals with plant microorganisms. Interscience, New YorkGoogle Scholar
  5. Donald KJ, Clarke HV, Mitchell C, Cornwell RM, Hubbard SF, Karley AJ (2016) Protection of pea aphids associated with coinfecting bacterial symbionts persists during superparasitism by a braconid wasp. Microbiol Ecol 71(1):1–4CrossRefGoogle Scholar
  6. Douglas AE (1998) Nutritional interactions in insect-microbial symbioses: aphids and their symbiotic bacteria Buchnera. Annu Rev Entomol 43(1):17–37CrossRefPubMedGoogle Scholar
  7. Douglas AE (2007) Symbiotic microorganisms: untapped resources for insect pest control. Trends Biotechnol 25(8):338–342CrossRefPubMedGoogle Scholar
  8. Enders LS, Miller NJ (2016) Stress-induced changes in abundance differ among obligate and facultative endosymbionts of the soybean aphid. Ecol Evol 6(3):818–829CrossRefPubMedPubMedCentralGoogle Scholar
  9. Ferrater JB, de Jong PW, Dicke M, Chen YH, Horgan FG (2013) Symbiont-mediated adaptation by planthoppers and leafhoppers to resistant rice varieties. Arthropod Plant Interact 7(6):591–605CrossRefGoogle Scholar
  10. Fukatsu T, Hosokawa T (2002) Capsule-transmitted gut symbiotic bacterium of the Japanese common plataspid stinkbug, Megacopta punctatissima. Appl Environ Microbiol 68(1):389–396CrossRefPubMedPubMedCentralGoogle Scholar
  11. Haye T, Gariepy T, Hoelmer K, Rossi J, Streito J, Tassus X, Desneux N (2015) Range expansion of the invasive brown marmorated stinkbug, Halyomorpha halys: an increasing threat to field, fruit and vegetable crops worldwide. J Pest Sci 88(4):665–673CrossRefGoogle Scholar
  12. Himler AG, Adachi-Hagimori T, Bergen JE, Kozuch A, Kelly SE, Tabashnik BE, Chiel E, Duckworth VE, Dennehy TJ, Zchori-Fein E, Hunter MS (2011) Rapid spread of a bacterial symbiont in an invasive whitefly is driven by fitness benefits and female bias. Science 332(6026):254–256CrossRefPubMedGoogle Scholar
  13. Hoebeck ER, Carter ME (2003) Halyomorpha halys (Stål) (Heteroptera: Pentatomidae): a polyphagous plant pest from Asia newly detected in North America. Proc Entomol Soc Wash 105(1):225–237Google Scholar
  14. Irish BM, Correll JC, Morelock TE (2002) The effect of synthetic surfactants on disease severity of white rust on spinach. Plant Dis 86(7):791–796CrossRefGoogle Scholar
  15. Kaiwa N, Hosokawa T, Kikuchi Y, Nikoh N, Meng XY, Kimura N, Ito M, Fukatsu T (2010) Primary gut symbiont and secondary, Sodalis-allied symbiont of the scutellerid stinkbug Cantao ocellatus. Appl Environ Microbiol 76(11):3486–3494CrossRefPubMedPubMedCentralGoogle Scholar
  16. Kenyon LJ, Meulia T, Sabree ZL (2015) Habitat visualization and genomic analysis of “Candidatus Pantoea carbekii”, the primary symbiont of the brown marmorated stink bug. Genome Biol Evol 7(2):620–635CrossRefPubMedPubMedCentralGoogle Scholar
  17. Leskey TC, Hamilton GC, Nielsen AL et al (2012a) Pest status of the brown marmorated stink bug, Halyomorpha halys in the USA. Outlooks Pest Manag 23(5):218–226CrossRefGoogle Scholar
  18. Leskey TC, Short BD, Butler BR, Wright SE (2012b) Impact of the invasive brown marmorated stink bug, Halyomorpha halys (Stål), in mid-Atlantic tree fruit orchards in the United States: case studies of commercial management. Psyche 2012:1–14Google Scholar
  19. Mathews CR, Barry S (2014) Compost tea reduces egg hatch and early-stage nymphal development of Halyomorpha halys (Hemiptera: Pentatomidae). Fla Entomol 97(4):1726–1732CrossRefGoogle Scholar
  20. Mickler CJ (2002) Evaluation of surfactants and new oomycete fungicides for the control of Phytophthora root rot of citrus, caused by Phytophthora parasitica, Doctoral Dissertation. OCLC Number 802370720Google Scholar
  21. Moran NA, Telang A (1998) Bacteriocyte-associated symbionts of insects. Bioscience 48(4):295–304CrossRefGoogle Scholar
  22. Moran NA, Dale C, Dunbar H, Smith WA, Ochman H (2003) Intracellular symbionts of sharpshooters (Insecta: Hemiptera: Cicadellinae) form a distinct clade with a small genome. Environ Microbiol 5(2):116–126CrossRefPubMedGoogle Scholar
  23. Moran NA, Tran P, Gerardo NM (2005) Symbiosis and insect diversification: an ancient symbiont of sap-feeding insects from the bacterial phylum Bacteroidetes. Appl Environ Microbiol 71(12):8802–8810CrossRefPubMedPubMedCentralGoogle Scholar
  24. Moran NA, Mccutcheon JP, Nakabachi A (2008) Genomics and evolution of heritable bacterial symbionts. Annu Rev Genet 42(1):165–190CrossRefPubMedGoogle Scholar
  25. Noda H, Watanabe K, Kawai S, Yukuhiro F, Miyoshi T, Tomizawa M, Koizumi Y, Nikoh N, Fukatsu T (2012) Bacteriome-associated endosymbionts of the green rice leafhopper Nephotettix cincticeps (Hemiptera: Cicadellidae). Appl Entomol Zool 47(3):217–225CrossRefGoogle Scholar
  26. Oliver KM, Russell JA, Moran NA, Hunter MS (2003) Facultative bacterial symbionts in aphids confer resistance to parasitic wasps. Proc Natl Acad Sci USA 100(4):1803–1807CrossRefPubMedPubMedCentralGoogle Scholar
  27. Otero-Bravo A, Sabree ZL (2015) Inside or out? Possible genomic consequences of extracellular transmission of crypt-dwelling stinkbug mutualists. Front Ecol Evol 3:64CrossRefGoogle Scholar
  28. Prado SS, Almeida RP (2009) Role of symbiotic gut bacteria in the development of Acrosternum hilare and Murgantia histrionica. Entomol Exp Appl 132(1):21–29CrossRefGoogle Scholar
  29. Prado SS, Zucchi TD (2012) Host-symbiont interactions for potentially managing heteropteran pests. Psyche 2012:1–9CrossRefGoogle Scholar
  30. Prado SS, Rubinoff D, Almeida RP (2006) Vertical transmission of a pentatomid caeca-associated symbiont. Ann Entomol Soc Am 99(3):577–585CrossRefGoogle Scholar
  31. SAS Institute Inc. (2013) The SAS System, Release 9.4. Cary, NCGoogle Scholar
  32. Stanghellini ME (1987) Inhibitory and lytic effects of a nonionic surfactant on various asexual stages in the life cycle of Pythium and Phytophthora species. Phytopathology 77(1):112CrossRefGoogle Scholar
  33. Stanghellini ME (1996) Control of root rot of peppers caused by Phytophthora capsica with a nonionic surfactant. Plant Dis 80(10):1113CrossRefGoogle Scholar
  34. Stanghellini ME, Miller RM (1997) BIOSURFACTANTS: Their identity and potential efficacy in the biological control of zoosporic plant pathogens. Plant Dis 81(1):4–12CrossRefGoogle Scholar
  35. Takiya DM, Tran PL, Dietrich CH, Moran NA (2006) Co-cladogenesis spanning three phyla: leafhoppers (Insecta: Hemiptera: Cicadellidae) and their dual bacterial symbionts. Mol Ecol 15(13):4175–4191CrossRefPubMedGoogle Scholar
  36. Taylor CM, Coffey PL, Delay BD, Dively GP (2014) The importance of gut symbionts in the development of the brown marmorated stink bug, Halyomorpha halys (Stål). PLoS One 9(3):e90312CrossRefPubMedPubMedCentralGoogle Scholar
  37. Wu D, Daugherty SC, Van Aken SE, Pai GH, Watkins KL, Khouri H, Tallon LJ, Zaborsky JM, Dunbar HE, Tran PL, Moran NA, Eisen JA (2006) Metabolic complementarity and genomics of the dual bacterial symbiosis of sharpshooters. PLoS Biol 4(6):e188CrossRefPubMedPubMedCentralGoogle Scholar
  38. Zchori-Fein E, Brown JK (2002) Diversity of prokaryotes associated with Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae). Ann Entomol Soc Am 95(6):711–718CrossRefGoogle Scholar
  39. Zhang Y, Cao W, Zhong L, Godfray HC, Liu X (2016) Host plant determines the population size of an obligate symbiont Buchnera aphidicola in aphids. Appl Environ Microbiol 82(8):2336–2346CrossRefPubMedPubMedCentralGoogle Scholar

Copyright information

© Springer-Verlag Berlin Heidelberg 2016

Authors and Affiliations

  • Christopher Taylor
    • 1
  • Veronica Johnson
    • 1
  • Galen Dively
    • 1
  1. 1.Department of EntomologyUniversity of MarylandCollege ParkUSA

Personalised recommendations