Seoul hantavirus in Europe: first demonstration of the virus genome in wild Rattus norvegicus captured in France

  • P. Heyman
  • A. Plyusnina
  • P. Berny
  • C. Cochez
  • M. Artois
  • M. Zizi
  • J. P. Pirnay
  • A. Plyusnin
Article

Abstract

Although rats (Rattus rattus or Rattus norvegicus) worldwide have been found to carry Seoul hantavirus, there are at present only a very few reports of confirmed human Seoul hantavirus infections outside Asia, where the virus, in certain areas, is responsible for approximately 25% of the human hantavirus infections. In Europe, no confirmed human infections outside laboratories have been described, and although rats occasionally have been found to be antibody positive, the viral genome has not been demonstrated in these animals. The present report describes the first confirmed finding of Seoul hantavirus in R. norvegicus captured in Europe.

Introduction

Hantaviruses (genus Hantavirus, family Bunyaviridae) are enveloped viruses with tripartite RNA genome of negative polarity [1]. Hantaviruses are the etiological agents of hemorrhagic fever with renal syndrome (HFRS) in Europe and Asia and of hantavirus pulmonary syndrome in the Americas. HFRS is characterized by fever and renal dysfunction, sometimes with hemorrhagic manifestations [2]. At least five hantaviruses cause HFRS. Puumala hantavirus (PUUV), carried by Clethrionomys glareolus (bank vole) [3], is found in most of Europe and causes a milder form of HFRS known as nephropathia epidemica. Severe forms of HFRS are caused by Dobrava (DOBV) in Europe [4] and by Hantaan (HTNV) in Asia [5], with Apodemus flavicollis (yellow-necked mouse) and Apodemus agrarius (striped field mouse) as hosts, respectively. A. agrarius is so far the only Eurasian rodent known to carry two distinct hantaviruses, HTNV in Asia and Saaremaa virus (SAAV) in Europe [6, 7]; the latter one presumably causes a milder form of HFRS [2]. Microtus arvalis (common vole) is the major host for Tula hantavirus (TULV) in Europe [8, 9, 10, 11]. Although considered nonpathogenic to humans, TULV was recently reported in connection with cases of HFRS and/or hantavirus disease [12, 13]. In the Americas, Sigmodontinae-associated hantaviruses cause hantavirus pulmonary syndrome [14]. In the natural reservoir, hantaviruses establish a life-long, chronic infection, and the host develops a strong neutralizing antibody response against the virus [15].

Seoul hantavirus (SEOV), carried by Rattus rattus (black rat) and Rattus norvegicus (Norway, or brown, rat) [16], has been reported to cause milder disease as compared to HTNV and DOBV and is responsible for 25% of the HFRS cases in Asia [17]. It has been suggested that, as Rattus species are cosmopolitan, SEOV has the potential to cause human disease worldwide. SEOV was found in Japan, South Korea, Egypt, the USA, Brazil [18, and the references therein], and, most recently, in Cambodia [19] and Indonesia [20]. Although there have been occasional reports of SEOV antibody-positive rats worldwide, there are at present only a few reports of confirmed human SEOV infections outside Asia, i.e., in the USA [21] and Brazil [22]. In Europe, only laboratory outbreaks caused by SEOV have been reported so far [23, and references therein]. We present here the first genetic evidence of SEOV in R. norvegicus in Europe.

Materials and methods

The rats examined all belong to the species R. norvegicus. They were obtained from five colonies dedicated to the study of efficacy of various anticoagulant rodenticides. From each colony or subgroup, ten rats (labeled 50–59, 60–69, 70–79, 80–89, 90–99; 50 in total) were sacrificed, and blood, lungs, and kidneys were removed. Each of the five subgroups has been caught in the wild: subgroups I (50–59), II (60–69), and IV (80–89) were originally captured near Lyon, France. Subgroups III (70–79) and V (90–99) were originally captured near Orleans, France. Whole blood was immediately centrifuged, and serum was kept at −20°C. Lung and kidney tissue was flash-frozen and kept at −80°C. All animals were adults; numbers 87, 88, 98, and 99 were females, while all others were males. Sample 89 was not available for testing. Initial screening was performed using enzyme immunoassay (EIA) tests, and an immunofluorescence assay was applied to confirm EIA findings. Animals that were positive by these techniques were subsequently submitted to immunoblot tests for demonstration of the hantavirus antigen and reverse transcription-polymerase chain reaction (RT-PCR) for demonstration of the hantavirus genome.

Immunofluorescence assay

Screening for SEOV IgG antibodies was performed by applying a standard immunofluorescence assay technique (Progen Biotechnik, Heidelberg, Germany). In brief, 10-well slides coated with SEOV-infected cells (strain R22) were rehydrated, and to each well 25 μl of a 1/64 dilution of rat serum was added. After appropriate incubation, slides were washed and 25 μl of anti-rat IgG FITC-labeled conjugate was added to each well. After incubation and washing, the slides were examined under a fluorescent microscope. Samples showing a positive reaction at a 1/64 dilution were further diluted and tested until the endpoint titer was obtained.

Enzyme immunoassay

Screening was performed by applying a standard EIA technique (C. de Carvalho-Nicacio and Å. Lundkvist, unpublished), using native irradiation-inactivated viral antigens (SEOV strain R22VP30, kindly provided by Dr T. Avsic-Zupanc) and recombinant N-antigens (PUUV strain Kazan, and DOBV strain Slovenia, kindly provided by Dr Å. Lundkvist), for detection of IgG antibodies. In brief, 96-well microtiter plates were coated with antigen and incubated overnight at 4°C. Unsaturated binding sites were blocked, after which rodent sera diluted at 1:200 was incubated at 37°C for 1 h. Peroxidase-(Sigma, St Louis, MO, USA) or alkaline-phosphatase-labeled (Jackson, West Grove, PA, USA) anti-rat IgG antisera and, where appropriate, anti-mouse IgG antisera, were incubated for 1 h. Subsequently, 3,3′,5,5′ tetramethylbenzidine (TMB) or p-nitrophenyl substrates (Sigma) were added, and, after color development, the reaction was stopped with 2 M H2SO4 (for TMB substrate). The optical density (OD) was determined at 450 nm or 405 nm against a reference wavelength of 620 nm.

Immunoblotting

Eight lung tissue samples were submitted to immunoblotting. Tissue samples 50 and 67 were used as negative controls, while the remaining six (56, 83, 87, 90, 92, and 98) were SEOV antibody positive in the EIA.

Immunoblotting was performed essentially as described earlier [9]. Briefly, lung tissue samples were homogenized in Laemmli sample buffer, separated by electrophoresis in 10% sodium dodecyl sulfate-polyacrylamide gels, and immunoblotted with rabbit polyclonal antibodies raised against DOBV (courtesy of Dr Å. Lundkvist), which cross-react with SEOV antigen. Mouse anti-rabbit antibodies conjugated with horseradish peroxidase (Dako, Glostrup, Denmark) were used as secondary antibodies.

RT-PCR and sequencing

RNA was extracted from the eight lung tissue samples (numbers 50, 56, 67, 83, 87, 90, 92, and 98) with the TriPure reagent (Boehringer Mannheim, Germany) according to the manufacturer’s instructions. Tissue samples 50 and 67, negative by both EIA and immunoblot, belonged to subgroups I and II and were intended as negative controls. Tissue samples 56, 83, 87, 90, 92, and 98 (from subgroups I, IV, and V) were antibody positive, except for sample 92, which was positive by EIA and negative by Western blot.

RNA was then subjected to a nested RT-PCR that yielded a 324-bp PCR amplicon from the M segment (nucleotides 1979–2302, primers excluded) or a 320-bp amplicon [24] from the S-segment (nucleotides 509–782, primers excluded). RT-PCR on the M segment was performed with primers 5′GTGGACTCTTCTTCTCATTATTG3′ and 5′TGGGCAATCTGGGGGGTTGCA3′. For nested PCR, two additional primers, 5′TGGGC(A/G)GCAAGTGCAGCAGA3′ and 5′GCATTTTGCAGTGTGCCATGG3′, were used. PCR amplicons were gel-purified using the QIAquick Gel Extraction Kit (Qiagen, Valencia, CA, USA) and sequenced automatically using either ABI PRISM Dye Terminator or ABI PRISM M13F and M13R Dye Primer sequencing kits (Applied Biosystems, Foster City, CA, USA).

Phylogenetic analysis

Multiple nucleotide and amino acid sequence alignments were prepared manually using the SeqApp 1.9a169 sequence editing program. To infer phylogenies, the PHYLIP program package (version 3.5c, http://evolution.genetics.washington.edu/phylip.html) was used. One thousand bootstrap replicates (Seqboot program) were fed to the distance matrices algorithm (Dnadist, with Kimura’s two-parameter option), and distance matrices were analyzed with the neighbor-joining tree-fitting algorithm (Neighbor); the bootstrap support values were calculated with the Consensus program (part of the PHYLIP package). For comparison, the hantavirus sequences listed below were used.

M-segment sequences

Puumala virus (PUUV), strain Sotkamo (GeneBank accession no. X61034); Tula virus (TULV), strain Moravia/02v (Z69993); Dobrava virus (DOBV), strain Dobrava (L33685); Saaremaa virus (SAAV), strain Saaremaa/160v (AJ009774); Da Bie Shan virus (DBSV), strain NC167 (AB027115); Thailand virus (THAIV) (L08756); Hantaan virus (HTNV), strains HV114 (L08753), A9 (AF035831), 76-118 (M14627), HoJo (D00376), and Lee (D00377); and Seoul virus (SEOV), strains Gou3 (AB027521), Baltimore (U00151), Brazil (U00460), IR461 (AF458104), J12 (AB027082), HB55 (AF035832), L99 (AF035833), NM39 (AB027080), Wan (AB027081), Henan (AB027083), Shanxi (AB027084), Z37 (AF187081), c3 (AB027088), Hebei4 (AB027089), CD10 (AB027092), SD227 (AB027091), Tchoupitoulas (U00473), 80-39 (S47716), Hubei1 (S72343), SR11 (M34882), KI-88-15 (D17594), KI-83-262 (D17592), KI-85-1 (D17593), KI-262 (U00466), B1 (X53861), Jakarta137 (AJ620583), Egypt (U00463), Girard Point (U00464), Houston (U00465), HN71-L (AB027085), Guang199 (AB027086), and Beijing-Rn (AB027087).

S-segment sequences

PUUV, strain Sotkamo (X61035); TULV, strain Moravia/02v (Z69991); DOBV, strain Dobrava (L41916); SAAV, strain Saaremaa/160v (AJ009773); HTNV, strains A16 (AB027099), A9 (AF329390), 76-118 (M14626), Maaji (AF321095), Solovey/AP63/1999 (AB071184), and Solovey/AP61/1999 (AB071183); DBSV, strains NC167 (AB027523), AH211 (AF288647), and AH09 (AF285264); and SEOV, strains Gou3 (AF184988), Gou3v9 (AB027522), Cambodia (Camb)117 (AJ427511), Camb96 (AJ427512), Camb174 (AJ427513), Hb8610 (AF288643), L99 (AF288299), R22 (AF288295), Z37 (AF187082), IR461 (AF329388), Tchoupitoulas (AF329389), SR11 (M34881), zy27 (AF406965), Pf26 (AY006465), Camb175 (AJ427505), Camb41 (AJ427501), Camb32 (AJ427508), Camb58 (AJ427510), and Camb180 (AJ427506).

Results

Screening of serum and tissue samples for the presence of hantavirus markers

All rats from subgroups II and III were SEOV antibody negative by EIA; one rat from subgroup I (no. 56) was antibody positive. Of the rats from subgroups IV and V, 15 of 19 (78.9%) were SEOV antibody positive. As expected, cross-reactions with PUUV and DOBV antigens were noted. Immunofluorescence assay results confirmed the EIA results for 100% of the samples.

Eight lung tissue samples were submitted to immunoblotting with DOBV antigen. Cross-reactivity of this test with SEOV antibodies was apparently sufficient (data not shown). Tissue samples no. 50 and no. 67 were taken from antibody-negative rats and therefore served as negative controls and were found negative by the immunoblot as well. Of six samples taken from antibody-positive rats (56, 83, 87, 90, 92, and 98) all except no. 92 were N-antigen-positive (with no. 87 producing a very weak band).

Genetic analysis

PCR amplicons of 324 bp from the hantavirus M segment were recovered from the lung tissue samples nos. 83 and 90. Nucleotide sequences of the two amplicons (nucleotides 2017–2301 of the M segment, primer sequences excluded) were identical and showed the highest level of similarity (98.2%) to the recently described Jakarta137 strain of SEOV from Indonesia [20]. Deduced G2 protein sequences of SEOV strains from France and Indonesia were identical. Phylogenetic analysis of the M-segment sequences positioned the wild-type SEOV strain from France (designated as SEO/France/Rn90/2003, or France90, for short) within the genetic lineage no. 7, together with the above-mentioned strain Jakarta137 and strain B1, which originated from Japan (Fig. 1a). Other SEOV genetic lineages, nos. 1–6 and no. 8, were as described earlier [18, 20]. Lineages no. 1 and no. 3 include strains from China. The second lineage, besides three Chinese strains, also contains Houston strain from the USA. The fourth lineage includes strains from South Korea (80–39), China (Hubei1), and North America (Tchoupitoulas). The fifth lineage is represented by strain Gou3 (China), carried by R. rattus [18]. The sixth lineage includes strains from Africa (Egypt) and North America (Girard Point, PA). The eighth lineage is comprised of four closely related strains from Japan.
Fig. 1

a M-segment phylogenetic tree. b S-segment phylogenetic tree

Simultaneously, 320-bp amplicons from the hantavirus S segment were recovered from sample nos. 83, 90, and 92. Nucleotide sequences of all three amplicons (nucleotides 509–782 of the S segment, primers excluded) were identical and showed the highest level of similarity (98.2–99.6%) to the recently described wild-type SEOV strains 032, 041, 058, 175, and 180 from Cambodia, all carried by R. norvegicus [19]. Deduced N-protein sequences of all these SEOV strains were identical. On the phylogenetic tree calculated for the S-segment sequences, the French strain was located within the genetic lineage formed by the Cambodian strains 032, 041, 058, 175, and 180 (Fig. 1b). This lineage was moderately supported (bootstrap support value of 64% for 1,000 replicates).

Of the eight genetic lineages seen on the M tree (Fig. 1a), only three (nos. 1, 5, and 7) can be recognized on the S tree, most probably due to the fact that the S-segment sequences were not reported for all SEOV strains presented on the M tree. Instead, there are two additional genetic lineages: no. 9, formed by two Chinese strains of unknown origin, zy27 and pf26, and no. 10, which includes three strains from Cambodia carried by either R. rattus or unclassified Rattus species [19].

Discussion

We present here the first confirmed finding of the SEOV genome in R. norvegicus captured in Europe. Earlier findings of SEOV antibodies in humans were based on the results of highly cross-reactive immunofluorescence assays, which are also known to be prone to false-positive reactions, and have never been confirmed by reliable methods such as the focus reduction neutralization test. SEOV-caused laboratory outbreaks have been reported in Belgium, France, the Netherlands, and the UK (reviewed by Lee [25]), and the strain of SEOV virus from the English outbreak has been genetically characterized [23], but the SEOV genome was never found in the local wild rats. Neither was there clear evidence of SEOV-related HFRS cases in Europe outside the laboratories.

Very recently, we became aware of the data of Lundkvist et al. on the presence of SEOV-neutralizing antibodies in convalescent serum of a French HFRS patient (Å. Lundkvist, personal communication). Combined with our data, these observations show that SEOV is present in France and has reached humans outside the laboratories. To evaluate the seroprevalence of SEOV-neutralizing antibodies in France, a large-scale seroepidemiological study should be conducted.

It is of interest that the newly described SEOV strain from France is most closely related to the Indonesian wild-type strain Jakarta137 (Fig. 1a) and the Cambodian wild-type strains 32, 41, 58, 175, and 180 (Fig. 1b), all associated with R. norvegicus, but it is quite distinct from Cambodian wild-type strains 96, 117, and 174 carried by R. rattus or unidentified Rattus species [19]. Unfortunately, neither S-segment sequences from the Indonesian SEOV strains nor M-segment sequences from the Cambodian strains were recovered; therefore, analysis of their phylogenetic relationships has yet to be performed. Close relationships between the French SEOV strain, on one hand, and the Indonesian and Cambodian strains, on the other, may reflect major trade routes or could be related to the historical connections between these regions and France.

Throughout history, R. norvegicus has been one of the most harmful mammal species to mankind. Rat-borne diseases have probably taken more human lives than all the wars in human history combined, and control attempts directed against Norway rats invariably fail. In the UK, R. norvegicus was found to harbor no less than 13 zoonotic agents and ten nonzoonotic parasite species [26].

Norway rats originated on the plains of Asia, probably in what is now northern China and Mongolia, where wild rats today still live in burrows [27, 28]. They arrived in Europe most probably during the 16th century [28]. Along its journey, R. norvegicus developed human-dependent behavior: Norway rats easily access human habitation, and it is therefore important for modern public health systems to maintain surveillance of the species. Asia excluded, SEOV does not seem to be a major public health threat, which is in contradiction with its worldwide spread. A possible explanation could be that, in a given region, testing of human sera for SEOV is not done on the same scale as for the “locally” most plausible serotype. When, however, testing for the presence of SEOV antibodies in human sera is included in the test panel, a certain level of seropositivity is invariably encountered.

Data from this study add SEOV to the existing list of European hantavirus pathogens that currently includes PUUV, DOBV, TULV, and SAAV. This important addition should be taken into consideration for improving both diagnostics and clinical awareness of physicians.

Notes

Acknowledgments

This study was made possible by grants STE/R and T WB11 from the Belgian Ministry of Defence, and grants RFA915 and 202012 from the Academy of Finland. The collection of rats was carried out during a preliminary research program on PUUV infection in bank voles (AER 2002), a program supported by the Veterinary School of Lyon in collaboration with Claude Bernard University, Lyon, and the Pasteur Institute, Paris. The experiments described comply with current European Union laws and regulations.

References

  1. 1.
    Elliott RM, Bouloy M, Calisher CH, Goldbach R, Moyer JT, Nichol ST, Pettersson R, Plyusnin A, Schmaljohn CS (2000) Bunyaviridae. In: van Regenmortel MHV, Fauquet CM, Bishop DHL, Carsten EB, Estes MK, Lemon SM, Maniloff J, Mayo MA, McGeoch DJ, Pringle CR, Wickner RB (eds) Virus taxonomy. VII report of the international committee on taxonomy of viruses. Academic, San Diego, pp 599–621Google Scholar
  2. 2.
    Vapalahti O, Mustonen J, Lundkvist Å, Henttonen H, Plyusnin A, Vaheri A (2003) Hantavirus infections in Europe. Lancet Infect Dis 3:653–661CrossRefPubMedGoogle Scholar
  3. 3.
    Brummer-Korvenkontio M, Henttonen H, Vaheri A (1982) Hemorrhagic fever with renal syndrome in Finland: ecology and virology of nephropathia epidemica. Scand J Infect Dis 36(Suppl):88–91Google Scholar
  4. 4.
    Avsic-Zupanc T, Xiao SY, Stojanovic R, Gligic A, van der Groen G, Leduc JW (1992) Characterization of Dobrava virus: a hantavirus from Slovenia, Yugoslavia. J Med Virol 38:132–137PubMedGoogle Scholar
  5. 5.
    Lee HW, Lee PW, Johnson KM (1978) Isolation of the etiologic agent of Korean hemorrhagic fever. J Infect Dis 137:298–308PubMedGoogle Scholar
  6. 6.
    Nemirov K, Vapalahti O, Lundkvist A, Vasilenko V, Golovljova I, Plyusnina A, Niemimaa J, Laakkonen J, Henttonen H, Vaheri A, Plyusnin A (1999) Isolation and characterization of Dobrava hantavirus carried by the striped field mouse (Apodemus agrarius) in Estonia. J Gen Virol 80(Pt 2):371–379PubMedGoogle Scholar
  7. 7.
    Plyusnin A, Morzunov SP (2001) Virus evolution and genetic diversity of hantaviruses and their rodent hosts. Curr Top Microbiol Immunol 256:47–75PubMedGoogle Scholar
  8. 8.
    Plyusnin A, Vapalahti O, Lankinen H, Lehvaslaiho H, Apekina N, Myasnikov Y, Kallio-Kokko H, Henttonen H, Lundkvist A, Brummer-Korvenkontio M (1994) Tula virus: a newly detected hantavirus carried by European common voles. J Virol 68:7833–7839Google Scholar
  9. 9.
    Plyusnin A, Cheng Y, Vapalahti O, Pejcoch M, Unar J, Jelinkova Z, Lehväslaiho H, Lundkvist Å, Vaheri A (1995) Genetic variation in Tula hantaviruses: sequence analysis of the S and M segments of strains from Central Europe. Virus Res 39:237–250PubMedGoogle Scholar
  10. 10.
    Sibold C, Meisel H, Labuda M, Kozuch O, Lysy J, Pejcock M, Krüger DH, Vaheri A, Plyusnin A (1999) Recombination in Tula hantavirus evolution: analysis of genetic lineages from Slovakia. J Virol 73:667–675PubMedGoogle Scholar
  11. 11.
    Heyman P, Klingstrom J, de Jaegere F, Leclercq G, Rozenfeld F, Escutenaire S, Vandenvelde C, Zizi M, Plyusnin A, Lundkvist A (2002) Tula hantavirus in Belgium. Epidemiol Infect 128:251–256PubMedGoogle Scholar
  12. 12.
    Klempa B, Meisel H, Rath S, Bartel J, Ulrich R, Kruger DH (2003) Occurrence of renal and pulmonary syndrome in a region of northeast Germany where Tula hantavirus circulates. J Clin Microbiol 41:4894–4897Google Scholar
  13. 13.
    Schultze D, Lundkvist A, Blauenstein U, Heyman P (2002) Tula virus infection associated with fever and exanthema after a wild rodent bite. Eur J Clin Microbiol Infect Dis 21:304–306Google Scholar
  14. 14.
    Schmaljohn C, Hjelle B (1997) Hantaviruses: a global disease problem. Emerg Infect Dis 3:95–104PubMedGoogle Scholar
  15. 15.
    Chu YK, Rossi C, Leduc JW, Lee HW, Schmaljohn CS, Dalrymple JM (1994) Serological relationships among viruses in the Hantavirus genus, family Bunyaviridae. Virology 198:196–204CrossRefPubMedGoogle Scholar
  16. 16.
    Lee HW, Baek LJ, Johnson KM (1982) Isolation of Hantaan virus, the etiologic agent of Korean hemorrhagic fever, from wild urban rats. J Infect Dis 146:638–644PubMedGoogle Scholar
  17. 17.
    Kim YS, Ahn C, Han JS, Kim S, Lee JS, Lee PW (1995) Hemorrhagic fever with renal syndrome caused by the Seoul virus. Nephron 71:419–427PubMedGoogle Scholar
  18. 18.
    Wang H, Yoshimatsu K, Ebihara H, Ogino M, Araki K, Kariwa H (2000) Genetic diversity of hantaviruses isolated in China and characterization of novel hantaviruses isolated from Niviventer confucianus and Rattus rattus. Virology 278:332–345CrossRefPubMedGoogle Scholar
  19. 19.
    Reynes JM, Soares JL, Hue T, Bouloy M, Sun S, Kruy SL, Flye Sainte Marie F, Zeller H (2003) Evidence of the presence of Seoul virus in Cambodia. Microbes Infect 5:769–773CrossRefPubMedGoogle Scholar
  20. 20.
    Plyusnina A, Ibrahim I-N, Winoto I, Porter KR, Gotama IBI, Lundkvist Å, Vaheri A, Plyusnin A (2004) Identification of Seoul hantavirus in Rattus norvegicus in Indonesia. Scand J Inf Dis 36:356–359CrossRefPubMedGoogle Scholar
  21. 21.
    Glass GE, Watson AJ, Leduc JW, Childs JE (1994) Domestic cases of hemorrhagic fever with renal syndrome in the United States. Nephron 68:48–51Google Scholar
  22. 22.
    Iversson LB, da Rosa AP, Rosa MD, Lomar AV, Sasaki MG, Leduc JW (1994) Human infection by Hantavirus in southern and southeastern Brazil. Rev Assoc Med Bras 40:85–92PubMedGoogle Scholar
  23. 23.
    Shi X, McCaughey C, Elliott RM (2003) Genetic characterisation of a hantavirus isolated from a laboratory-acquired infection. J Med Virol 71:105–109CrossRefPubMedGoogle Scholar
  24. 24.
    Kariwa H, Kimura M, Yoshizumi S, Arikawa J, Yoshimatsu K, Takashima I, Hashimoto N (1996) Modes of Seoul virus infections: persistency in newborn rats and transiency in adult rats. Arch Virol 141:2327–2338Google Scholar
  25. 25.
    Lee HW (1996) Epidemiology and pathogenesis of hemorrhagic fever with renal syndrome. In: Elliott RM (ed) The Bunyaviridae. Plenum, New York, pp 253–267Google Scholar
  26. 26.
    Webster JP, Macdonald DW (1995) Parasites of wild brown rats (Rattus norvegicus) on UK farms. Parasitology 111(Pt 3):247–255PubMedGoogle Scholar
  27. 27.
    Mitchell-Jones AJ, Amori G, Bogdanowicz W, Krystufek B, Reijnders PJH, Spitzenberger F, Stubbe M, Thissen JBM, Vohralik V, Zima J (1999) The atlas of European mammals. Academic, San Diego, pp 278Google Scholar
  28. 28.
    Krinke GJ (2000) The laboratory rat. Academic Press, San DiegoGoogle Scholar

Copyright information

© Springer-Verlag 2004

Authors and Affiliations

  • P. Heyman
    • 1
  • A. Plyusnina
    • 2
  • P. Berny
    • 3
  • C. Cochez
    • 4
  • M. Artois
    • 5
  • M. Zizi
    • 6
  • J. P. Pirnay
    • 6
  • A. Plyusnin
    • 2
  1. 1.Research Laboratory for Vector-Borne DiseasesQueen Astrid Military HospitalBrusselsBelgium
  2. 2.Department of Virology, Haartman InstituteUniversity of HelsinkiHelsinkiFinland
  3. 3.Pharmacy—Toxicology DepartmentEcole Nationale Vétérinaire de LyonMarcy l’EtoileFrance
  4. 4.National Reference Center for Hantavirus InfectionsQueen Astrid Military HospitalBrusselsBelgium
  5. 5.Infectious Diseases and Epidemiology UnitEcole Nationale Vétérinaire de LyonMarcy l’EtoileFrance
  6. 6.ACOS WB, Epidemiology and BiostatisticsQueen Astrid Military HospitalBrusselsBelgium

Personalised recommendations