Protoplasma

, Volume 236, Issue 1–4, pp 13–19 | Cite as

Poly(A) RNA a new component of Cajal bodies

  • Agnieszka Kołowerzo
  • Dariusz Jan Smoliński
  • Elżbieta Bednarska
Original Article

Abstract

In European larch microsporocytes, spherical structures 0.5 to 6 μm in diameter are present in which poly(A) RNA accumulates. There were one to several bodies per cell and they were often present in the vicinity of the nucleolus. No nascent transcripts were observed within them. Splicing factors of the SR family, including protein SC35, which participates in bringing the 3′ and 5′ sites closer in the splicing reaction, were also not observed. The absence of the above-mentioned elements within bodies containing poly(A) RNA disqualifies them as sites of synthesis and preliminary stages of primary transcript maturation. However, they contained abundant elements of the splicing machinery commonly occurring in Cajal bodies, i.e., Sm proteins or small nuclear RNA (snRNA). The molecular composition as well as the characteristic ultrastructure of bodies containing poly(A) RNA proves that these were Cajal bodies. This is the first report of such poly(A) RNA localization.

Keywords

Larix decidua Meiotic prophase I Nuclear bodies Coiled body pre-mRNA snRNP 

Introduction

In the nuclei of eukaryotic cells, structures called nuclear bodies are present. Many of them have been shown to be involved in RNA metabolism. The nuclear bodies in mammalian nerve tissue discovered by the Spanish scientist Ramón y Cajal belong to this category (Cajal 1903). Investigations using electron microscopy have shown that these bodies consist of coiled fibrils, resembling a coil of twisted thread, and, therefore, they have been called coiled bodies (CB; Monneron and Bernhard 1969). One hundred years after their discovery, they were named Cajal bodies (CB), in honor of their discoverer (Gall et al. 1999). Progresses in investigations of CBs were made possible by the discovery and characterization of a marker of these bodies, coilin, in animal cells (Raška et al. 1991). Using a double-labeling technique, the characteristic molecular composition of these structures was gradually identified. CBs were found to be rich in, among others, elements of the splicing system. All kinds of U RNAs linked to splicing are present here, such as U1–U5 in the mature form containing a trimethylguanosine cap −m3G at the 5′ end (Raška et al. 1991), U6, and immature forms of these small nuclear RNAs (snRNAs; Smith and Lawrence 2000). In these bodies, the presence of Sm proteins (Raška et al. 1991), which together with U snRNA make up the spliceosome (Lorković and Barta 2004), has been confirmed. It has also been demonstrated that active U1 and U2 snRNA genes are associated with Cajal bodies (Frey and Matera 2001). Unlike coilin in animal cell CBs, no CB marker common for all species has been found in plant cells. Therefore, the Sm proteins or U2 small nuclear ribonucleoproteins (snRNPs) are considered plant cell CB markers (Boudonck et al. 1999; Acevedo et al. 2002). Even though a gene has been found which could be a distant homolog of the animal coilin in Arabidopsis (Collier et al. 2006), it still cannot be considered a Cajal body marker, as the presence of this gene product in CB has not been demonstrated.

Despite the presence of splicing machinery elements and many transcription factors (Schul et al. 1998) in CBs, they are not believed to be a site of transcription and splicing, as nascent transcripts have not been found there and some important splicing factors such as SC35 and U2AF are also absent (Gama-Carvalho et al. 1997). Attempts to show the presence of heterogeneous ribonucleoprotein particles in CBs have also not been successful (Gall 2000). There are publications in which an attempt was made to evaluate whether poly(A) RNA is also present in nuclear domains that accumulate many splicing and transcription factors (Visa et al. 1993; Huang et al. 1994). These investigations performed using electron microscopy in somatic cells did not show the presence of poly(A) RNA in CBs.

Microsporocytes of larch are the cells characterized by a high degree of synchronization during anther development and a long meiosis lasting about 6 months, in which periodical increases and decreases in transcriptional activity occur (Smoliński et al. 2007). During prophase of the first meiotic division in microsporocytes of larch, poly(A) RNA accumulates within structures 0.5–6 µm in diameter. Because of the morphological characteristics of these bodies, including shape, number, and spatial relationship with the nucleolus, they resemble CBs. In this work, an attempt was made to determine whether poly(A) RNA accumulates within Cajal bodies.

Materials and methods

Plant material, isolation of protoplasts, and preparation of material for electron microscopy studies

Anthers of Larix decidua Mill. were taken from the same tree in the diplotene stage of prophase of larch microsporocytes. Anthers were fixed in 4% paraformaldehyde solution in phosphate-buffered saline (PBS) buffer pH 7.2 for 6 h and then washed in PBS and resuspended in hydrolysing medium 4% cellulase Onozuka R10 (Serva, Heidelberg Germany) and 27 U/ml pectinase (Sigma) in 0.01 M citric buffer pH 4.8 for 45 min at 37°C. Anthers were then washed in PBS, squashed to obtain free meiocytes and suspended protoplast matter was spread on gelatine-coated slides placed on dry ice and air-dried. Then, the protoplasts were rinsed with 0.1% Triton X100 solution in PBS buffer pH 7.2 for 10 min and air-dried. After that, protoplasts were used for immunofluorescence and fluorescent in situ hybridization (FISH).

For transmission electron microscopy studies, the cells were fixed in 4% paraformaldehyde, 0.25% GA in Pipes overnight at room temperature, dehydrated in alcohols, and embedded in LRGold resin (Sigma). The material was cut using a Leica ultramicrotome, and sections were placed on nickel-formvar-coated grids.

Design of double-labeling reactions

Several double-labeling immunofluorescent–FISH or immunogold high-resolution in situ hybridization (HISH) reactions (Sm-poly(A) RNA; SC35-poly(A) RNA; bromouridine (BrU)-poly(A) RNA; m3G snRNA-poly(A) RNA) were performed as described below. In all of them, immunocytochemical methods always preceded in situ hybridization methods. This is because when in situ hybridization was applied first, the levels of immunofluorescent signals were very weak. In double-labeling FISH (U2 snRNA-poly(A) RNA), both probes were applied simultaneously in the hybridization medium.

Immunodetection of bromouridine incorporation before FISH in double-labeling reaction

Bromouridine incorporation was performed according to the method of Smoliński et al. 2007 with a long (90 min) incubation time. In immunolabeling experiments, protoplasts were blocked for 30 min with 1% bovine serum albumin (BSA) in PBS and then incubated with primary mouse anti-BrU antibodies (F. Hoffmann-LaRoche Ltd., Rotkreuz, Switzerland) in 1% BSA in PBS (diluted 1:100), pH 7.2, overnight at 4°C, and a goat antimouse secondary antibody conjugated with Alexa Fluor 488 in 0.2% BSA in PBS (diluted 1:500) for 1 h at 37°C. They were then washed in PBS and the FISH poly(A) detection method was applied. Finally, slides were washed in double-distilled water and mounted in Citifluor glycerol solution (Agar Scientific). The results were registered with an argon-ion laser emitting light with a wavelength of 488 nm (blue excitation and green fluorescence) and He-neon laser emitting light with a wavelength of 543 nm (green excitation and red fluorescence). A midpinhole, long exposure time (75 μs), and a ×60 (numerical aperture, 1.4) Plan Apochromat DIC H oil immersion lens were used. Pairs of images were collected simultaneously in the green (Alexa 488 or FITC fluorescence) and red (Cy3) channels. In order to minimize of bleed through between the fluorescence channels, low power of lasers (3–10% of maximum power) and control using single-channel collecting were applied. For bleed through analysis and control, Lucia G software was used (Laboratory Imaging, Prague, Czech Republic). The three-dimensional optical sections were acquired with a 0.7-μm step interval. For image processing and analysis, the EZ 2000 Viewer software package (Nikon Europe BV, Badhoevedorp, the Netherlands) was used. For 4',6-diamidino-2-phenylindole (DAPI) staining, a fluorescence-inverted Nikon Eclipse TE 300 microscope, equipped with a mercury lamp, UV-2EC UV narrow band filter, and DXM 1200 FX digital camera, was used.

FISH in double-labeling reactions

For hybridization, the probe was resuspended in hybridization buffer (30% v/v formamide, 4× SSC, 5× Denhardt's buffer, 1 mM ethylenediaminetetraacetic acid, 50-mM phosphate buffer) at a concentration of 50 pmol/ml. Hybridization was performed overnight at 37°C. The following DNA oligonucleotides were used: antisense poly(A) RNA—5′ Cy3 T(T)29 3′; sense poly(A) RNA—5′ Cy3 A(A)29 3′ (IBB PAN, Warsaw, Poland); antisense 5′ Alexa 488 T(T)29 3′; sense 5′ Alexa 488 A(A)29 3′ (Sigma St. Louis, MO, USA); antisense U2 snRNA—5′ Cy3 ATATTAAACTGATAAGAACAGATACTACACTTG 3′; and sense U2 snRNA—5′ Cy3 CAAGTGTAGTATCTGTTCTTATCAGTTTAATAT (IBB PAN, Warsaw, Poland).

Immunofluorescent methods for double-labeling reactions

Immunofluorescent localization: SC35 protein–anti-SC35 antibody (Sigma) assays were performed according to the method of Zienkiewicz et al. 2008a and 3mG cap–anti-3mG antibody (Calbiochem, Bad Soden, Germany) assays were performed according to the method of Zienkiewicz et al. 2006. Sm proteins were detected via incubation with primary mouse anti-Sm Y12, according to the method of Zienkiewicz et al. 2008b or performed using primary human anti-Sm ANA no. 5 antibody (La Jolla Scripps Institute) in 0.2% acetylated BSA in PBS (1:100) in a humidified chamber at 8°C overnight and secondary antibodies: antihuman antibody fluorescein isothiocyanate (Sigma).

HISH immunogold monolabeling of poly(A) RNA and double labeling with Sm proteins

Ultrathin sections were pretreated with prehybridization buffer (hybridization buffer without probe composition the same as for FISH) for 1 h at room temperature and then incubated with antisense poly(A) RNA probe in hybridization buffer (the probe was labeled at the 3′ end with digoxigenin nucleotides and terminal deoxynucleotidyl transferase; Roche). Hybridization was performed in a sealed humidified chamber for 20 h at room temperature. Posthybridization washing was done according to Smoliński et al. 2007. Nonspecific antigens were blocked with high-salt PBS buffer containing 0.05% acetylated BSA for 0.5 h. DNA–RNA hybrids were localized by incubation with sheep antidigoxigenin antibody coupled to 10-nm-diameter colloidal gold particles (Orion Diagnostica, Espoo, Finland; 1: 30 in PBS buffer containing 0.02% acetylated BSA for 1 h at room temperature). Grids were then rinsed and contrasted according to Smoliński et al. 2007. The material was examined and photomicrographs were taken under a JEOL 1010 electron microscope at 80 kV.

In double-labeling reactions, immunogold localization of Sm proteins was performed (which precedes HISH) using primary human anti-Sm ANA no. 5 antibody (La Jolla Scripps Institute) in 0.2% acetylated BSA in PBS (1:100) at 8°C in a humidified chamber overnight and secondary antihuman antibody coupled to 15-nm-diameter colloidal gold particles (BioCell, Cardiff, UK).

Control reactions

For in situ hybridizations (high resolution) and immunofluorescent methods, control treatments consisting of incubations without the first antibody were performed. For the in situ hybridizations, high resolution and fluorescent, sense-labeled probes and ribonuclease-treated samples were used as additional controls. For detection of new transcripts, a control reaction was performed on sections by omitting the incubation with bromouridine. All control reactions produced negative results, or the result of the control reaction was very low compared with that of standard reactions (supplementary data-Fig. S2).

Results

The use of a probe for the poly(A) tail indicated a high level of poly(A) RNA both within the nucleus and the cytoplasm of diplotene larch microsporocytes. A particular accumulation of this type of RNA occurred in spherical nuclear bodies 0.5–6 µm in diameter (Figs. 1, 2, 3, 4, 5, and 6). These bodies, ranging from one to several per cell, were frequently observed in the vicinity of the nucleolus (Fig. 1).
Fig. 1

Double labeling of nascent transcript and poly(A) RNA.1a High levels of nascent transcript occurred in the form of clusters (arrows) within the cell nucleus (N, area marked with dashed line) and in the cytoplasm (C). Poly(A) RNA present in the nucleoplasm mainly in the dispersed form and within spherical bodies (arrowhead), in which the newly formed transcript was not localized. Bodies containing poly(A) RNA occurred in the vicinity of the nucleolus (Nu). 1b DAPI staining for DNA. Bar 10 μm

Fig. 2

Double labeling of poly(A) RNA and SC35 proteins. 2a In the nucleoplasm, poly(A) RNA is present mainly in nuclear bodies (cb) located near the nucleolus (Nu), which does not contain the SC35 protein, and also in a dispersed form in the cytoplasm. SC35 was localized in the form of large irregular patches (sp) at the boundary of the nucleus and in small clusters within the cytoplasm. 2b Fragment of the nucleus from 2a localization of poly(A). In the area containing the SC35 protein (marked area), poly(A) is present in the form of a cluster of speckles (sp). 2c DAPI staining for DNA. Bar 10 μm

Fig. 3

Immunogold localization of poly(A) RNA in larch microsporocyte nuclei. a Large oval Cajal body (CB) labeled with numerous gold particles is visible. ab Magnified fragments of a. Within the area of the CB built of coiled fibers (barrows), gold particles occur mainly in the form of clusters and, less often, individually (b). In the nucleoplasm, labeling is slightly weaker but significant (c).Bar 0.5 μm

Fig. 4

Double labeling of poly(A) RNA and Sm proteins. a Accumulation of poly(A) RNA in nuclear bodies and in a dispersed form in the cytoplasm is visible. b Localization of Sm proteins in Cajal bodies (cb). c Merge. Colocalization of Sm proteins with poly(A) RNA within Cajal bodies (yellow color). d Optical sections of the body marked with an arrow. Poly(A) RNA (red) and Sm proteins (green) in colocalization (yellow) but in certain area of CB seem to be located independently. Bar 10 μm

Fig. 5

ac Double labeling of poly(A) RNA and m3G snRNA. a Poly(A) RNA present within nuclear bodies and in the dispersed form in nucleoplasm and cytoplasm. b Large accumulation of m3G in Cajal body (cb). Signal in the form of small agglomerations also localized within the nucleoplasm, often at the margins of the nucleus. c Merge. Colocalization of m3G snRNA and poly(A) RNA (yellow color) within nuclear bodies. Bar 10 μm

Fig. 6

ac Double labeling of poly(A) RNA and U2 snRNA. a In the nucleoplasm, poly(A) RNA was localized in a dispersed form and in nuclear bodies. A high level of signal was also observed in the cytoplasm. b U2 snRNA was mainly present in Cajal bodies (cb). c Merge. Cajal bodies labeled with U2 snRNA contain poly(A) RNA. Bar 10 μm

Fig. 7

Immunogold bilabeling of Sm proteins (15 nm) and poly(A) RNA (10 nm) in a small Cajal body (CB). Large gold particles indicating the presence of Sm proteins (yellow contour) occur in large amounts in the CB, whereas in the nucleoplasm their amount is lower. The level of labeling of CBs with small gold grains, indicating the localization of poly(A) RNA, is slightly smaller (white contour). Within the area of CB, Sm proteins and poly(A) RNA are not observed in close vicinity. Bar 0.5 μm

Because of the presence of poly(A) RNA in these bodies, they were examined to see whether they are the site of messenger RNA (mRNA) synthesis and maturation. The localization of the nascent transcript and poly(A) RNA, as identified by double labeling, indicated that BrU-RNA occurs in the form of clusters in the nucleoplasm and is absent in nuclear bodies containing poly(A) RNA. Even after a prolonged time of incubation with BrU up to 1.5 h—when the transcript was already visible in the area of the cytoplasm—the nascent transcript was not localized in nuclear bodies containing poly(A) RNA (Fig. 1). Thus, these bodies are not the site in which the synthesis of new transcripts occurs.

Because of numerous reports on the presence of poly(A) RNA within speckles, we investigated whether the accumulation of poly(A) RNA observed in larch microsporocytes corresponds to these same compartments. For this purpose, double labeling was performed to detect poly(A) and protein splicing factor SC35; SC35 is considered to be a marker for speckles. The results indicated that the SC35 factor does not occur in the area of spherical bodies containing poly(A) RNA (Fig. 2, a). The splicing factor analyzed accumulated in the nucleoplasm mainly in the form of large irregular areas at the boundary of the nucleus, which would correspond to speckles (Fig. 2, a). Apart from round nuclear bodies, speckles were the second nuclear compartment, an area in which poly(A) RNA was also observed (Fig. 2, b). Using the immunogold technique, the presence of poly(A) RNA in regions corresponding to speckles was confirmed at the ultrastructural level—interchromatin granules (supplementary data—Fig. S1).

The localization of poly(A) RNA using electron microscopy indicated that a specific accumulation of this RNA class occurs in oval Cajal bodies built of coiled fibrils (Fig. 3a, b). In the area of CBs, a high level of labeling with gold particles, which often occurred in clusters, was observed (Fig. 3b). Similar cluster labeling was observed in the surrounding nucleoplasm (Fig. 3c). Mean density of gold particles over CB (14.7 ± 2.8/μm2) was over two times higher in comparison with mean density over nucleoplasm (6.3 ± 1.5/μm2).

The number, characteristic morphology, and frequent spatial relationship of nuclear bodies containing poly(A) RNA with the nucleolus, as observed by confocal microscopy, indicates that they are the same Cajal bodies in which poly(A) RNA was localized at the ultrastructural level. In order to confirm these findings, double labeling to detect poly(A) RNA and different splicing factors considered as plant markers of Cajal bodies was performed. The simultaneous localization of poly(A) RNA (Fig. 4a) and core spliceosomal Sm proteins (Fig. 4b) indicated that Cajal bodies containing Sm proteins are the same bodies in which poly(A) RNA is present (Fig. 4c). However, occasionally, the colocalization of poly(A) RNA and Sm proteins within a single CB was not complete; the analyzed molecules occurred independently of each other (Fig. 4d). Mature forms of snRNA localized using an antibody against the trimethylguanosine cap (m3G) demonstrated an accumulation specifically within Cajal bodies, whereas in the nucleoplasm they were localized in a dispersed form (Fig. 5b). Double labeling to detect m3G snRNA and poly(A) RNA (Fig. 5a) showed the colocalization of Cajal bodies and structures containing poly(A) RNA (Fig. 5c). We obtained a similar result when a pool of only one kind of snRNA—U2 snRNA—was analyzed (Fig. 6a–c). In some cases, it was observed that CB did not contain poly(A) RNA, or, in bodies where poly(A) RNA was present, one of the splicing factors did not occur (data not shown).

The method of double labeling was also used to detect ultrastructural colocalization of poly(A) RNA and one of the CB markers—the Sm proteins. The immunogold technique showed that gold particles indicating the presence of poly(A) RNA were localized within CB individually and in the form of clusters (Fig. 7). Gold particles indicating the presence of Sm proteins were also localized in the same nuclear body. The level of Sm protein labeling in CB was much higher than that of poly(A) RNA (Fig. 7).

Discussion

The investigations performed herein have demonstrated that in larch diplotene microsporocytes poly(A) RNA accumulates in nuclear bodies which demonstrate a regular spherical shape and range from 0.5 to 6 µm in diameter. Reports on the spatial organization of successive stages of pre-mRNA maturation indicate that poly(A) RNA is concentrated in areas corresponding to nuclear speckles (Shopland et al. 2002). Within speckles, factors necessary for mRNA synthesis, maturation, and export are present, including the SC35 protein (considered a marker of speckles), snRNP, hyperphosphorylated RNA polymerase II, and mRNA export factors (Reed and Magni 2001), among others. This could suggest that the accumulations of poly(A) RNA in the form of bodies in larch microsporocyte nuclei represent nuclear speckles. Data from the literature indicate that speckles do not have such regular shapes (Ali et al. 2003) as the spherical bodies in larch microsporocytes. Thus, the properties of larch nuclear bodies, such as shape and, in particular, the absence of SC35 protein, do not correspond to the characteristics of speckles.

The structures—similar to speckles containing SC35 and poly(A) RNA observed in larch microsporocyte nuclei—are distinct from the spherical regular bodies in which poly(A) RNA accumulates. The difference of these two nuclear structures in the larch microsporocytes was confirmed by ME investigations. The speckles are visible under an electron microscope as clusters of interchromatin granules which are thought to be the sites of storage and recycling of snRNPs and SR proteins (Lamond and Spector 2003). Poly(A) RNA presence in the larch microsporocytes was noted both in the area of clusters of interchromatin granules (additional data) as well as in nuclear bodies whose ultrastructure and molecular composition prove that they are CB. Their frequent spatial association with the nucleolus is an additional property which is characteristic of Cajal bodies (Ochs et al. 1994).

This is the first report on the presence of poly(A) RNA within Cajal bodies. The localization of poly(A) RNA—on the basis of electron microscope studies in mammalian somatic cells—did not indicate the presence of this type of RNA in CBs (Visa et al. 1993; Huang et al. 1994). So far, similar investigations have not been performed on plant specimen. The discrepancy of the results obtained here with data from the literature could indicate: (1) a difference between CBs in plant and animal cells or (2) an undetectable level of poly(A) RNA (particularly at the level of the electron microscope) in somatic cells, in which this type of RNA constitutes only 1–2% of the total cellular RNA pool (Lequarre et al. 2004). The analyzed microsporocytes are cells of the generative cell line in the meiotic prophase. In generative cells, the poly(A) RNA may rise to levels that represent up to 10–20% of the total RNA pool (Lequarre et al. 2004). The investigations performed here indicate that, in the analyzed microsporocytes, the level of this particular RNA is high. Thus, it cannot be excluded that its detection was easier than in somatic cells.

The question arises whether the observed poly(A) RNA accumulation in Cajal bodies is linked to a high level of transcription or whether these bodies are the site of storage and/or modification of transcripts with a poly(A) tail. The investigations performed herein have shown that, even after 1.5 h of incubation of larch microsporocytes with bromouridine, poly(A) RNA is not present in CBs as newly synthesized RNA. In animals, a common phenomenon is the accumulation of “long-lived mRNA” in oocyte cytoplasm. In mouse oocytes, as much as 8% of total RNA occurs in the form of poly(A) RNA (Picton et al. 1998). It seems that, in plants, the situation is different; poly(A) RNA accumulation may occur in cells of the male germ line and not the female one. In the hyacinth, the mature egg cell is almost completely deprived of poly(A) RNA (Pięciński et al. 2008). In contrast, in the mature pollen grain, in which RNA polymerase II is present in an inactive form (Zienkiewicz et al. 2008c), a large pool of poly(A) RNA transcripts is present (Tuppy 1982; Zienkiewicz et al. 2006). During larch microsporocyte development, the volume is increased several times (Smoliński et al. 2007), and, after the end of metaphase, it divides into four cells (tetrads). The long-lived RNA that is synthesized earlier and accumulates in CBs during the prophase period could thus be used during successive stages of meiosis, which are accompanied by an increase in cell volume.

It cannot be excluded that part of the poly(A) RNA detected in this study are noncoding “mRNA-like” transcripts (Inagaki et al. 2005). They are transcribed by RNA polymerase II and undergo polyadenylation and splicing. Their role is not completely understood, but they are believed to participate in gene regulation and regulation of transcription factors and have an important role in organogenesis and cell differentiation.

It is not known whether poly(A) RNA accumulation in the nucleus in CBs represents an atypical developmental strategy in larch or whether this is a more common process. Thus far, there are no reports on similar phenomena during microsporogenesis in other higher plants. The lack of data on this subject may be due to the fact that the localization of poly(A) RNA during microsporogenesis has not been performed to date, and investigations on Cajal bodies in these cells are still fragmentary (Seguí-Simarro et al. 2006; Niedojadło et al. 2008). The role of poly(A)-RNA-rich CBs in RNA metabolism in larch microsporocyte development requires further detailed investigations.

Notes

Acknowledgments

We thank J. Niedojadło for critical reading of the manuscript. This work was supported by a UMK Grant (project 321-B) and by the grant of Polish Ministry of Science and Higher Education no. N303 290434.

Supplementary material

709_2009_42_Fig1_ESM.gif (202 kb)
Fig. S1

Immunogold localization of poly(A) RNA in larch microsporocyte nuclei. Several clusters of interchromatin granules (IG) labeled with gold grains occur mainly in the form of single or double grains. In the surrounding nucleoplasm, the labeling is clearly much weaker. Bar 0.5 μm. Fig. S2 a–e. Control reactions performed with omission of the primary antibodies against : BrU-RNA (a), SC35 protein (b), Sm proteins (c), m3G snRNA (d), and control hybridization with the sense-labeled probes to: poly(A) RNA (ae) and U2 snRNA (e). No labeling in the microsporocytes were observed (nuclear area marked with dashed line). Bars: 10 μm. f Control reaction for in situ hybridization with the sense-labeled probe to poly(A) RNA on electron microscopy level. No labeling or only a few gold particles are visible. Bar: 1 μm (GIF 202 kb)

709_2009_42_Fig1_ESM.tif (33.2 mb)
High-resolution image (TIFF 33984 kb)

References

  1. Acevedo R, Samaniego R, Díaz M, de la Espina S (2002) Coiled bodies in nuclei from plant cells evolving from dormancy to proliferation. Chromosoma 110:559–569PubMedCrossRefGoogle Scholar
  2. Ali GS, Glovkin M, Reddy AS (2003) Nuclear localization and in vivo dynamics of a plant-specific serine/arginine-rich protein. Plant J 36:883–93PubMedCrossRefGoogle Scholar
  3. Boudonck K, Dolan L, Shaw PJ (1999) The movement of coiled bodies visualized in living plant cells by the green fluorescent protein. Mol Biol Cell 10:2297–2307PubMedGoogle Scholar
  4. Cajal SRY (1903) Un sencillo metodo de coloracion seletiva del reticulo protoplasmatico y sus efectos en los diversos organos nerviosos de vertebrados e invertebrados. Trab Lab Invest Biol (Madrid) 2:129–221Google Scholar
  5. Collier S, Pendle A, Boudonck K, van Rij T, Dolan L, Shaw P (2006) A distant coilin homologue is required for the formation of Cajal bodies in Arabidopsis. Mol Biol Cell 17(7):2942–51PubMedCrossRefGoogle Scholar
  6. Frey MR, Matera AG (2001) RNA-mediated interaction of Cajal bodies and U2 snRNA genes. J Cell Biol 154:499–509PubMedCrossRefGoogle Scholar
  7. Gall JG (2000) Cajal bodies: the first 100 years. Annu Rev Cell Dev Bio l16:273–300CrossRefGoogle Scholar
  8. Gall JG, Bellini M, Wu Z, Murphy CH (1999) Assembly of the nuclear transcription and processing machinery: Cajal bodies (coiled bodies) and transcriptosomes. Mol Biol Cell 10:4385–4402PubMedGoogle Scholar
  9. Gama-Carvalho M, Krauss RD, Chiang L, Valcárcel J, Green MR, Carmo-Fonseca M (1997) Targeting of U2AF65 to sites of active splicing in the nucleus. J Cell Biol 137:975–87PubMedCrossRefGoogle Scholar
  10. Huang S, Deerinck TJ, Ellisman MH, Spector DL (1994) In vivo analysis of the stability and transport of nuclear poly(A) + RNA. J Cell Biol 4:877–899CrossRefGoogle Scholar
  11. Inagaki S, Numata K, Kondo T, Tomista M, Yasuda K, Kanai A, Kageyama Y (2005) Identification and expression analysis of putative mRNA-like non-coding RNA in Drosophila. Genes Cells 10:1163–1173PubMedCrossRefGoogle Scholar
  12. Lamond AI, Spector DL (2003) Nuclear speckles: a model for nuclear organelles. Mol Cell Biol 4:605–612Google Scholar
  13. Lequarre AS, Traverso JM, Marchandise J, Donnay I (2004) Poly(A) RNA is reduced by half during bovine oocyte maturation but increases when meiotic arrest is maintained with CDK inhibitors. Biol Reprod 71:425–431PubMedCrossRefGoogle Scholar
  14. Lorković ZJ, Barta A (2004) Compartmentalization of the splicing machinery in plant cell nuclei. Trends Plant Sci 9:555–568Google Scholar
  15. Monneron A, Bernhard W (1969) Fine structural organization of the interphase cell nucleus of some mammalian cells. J Ultrastruct Res 27:266–288PubMedCrossRefGoogle Scholar
  16. Niedojadło J, Dominowska K, Bednarska E (2008) Nuclear bodies in microspore of Douglas fir (Pseudotsuga menziesii Mirb.) microspores. Protoplasma 234:77–85PubMedCrossRefGoogle Scholar
  17. Ochs RL, Stein TW, Tan EM (1994) Coiled bodies in the nucleolus of breast cancer cells. J Cell Sci 107:85–399Google Scholar
  18. Picton H, Briggs D, Gosde R (1998) The molecular basis of oocyte growth and development. Mol Cell Endocrinol 145:27–37PubMedCrossRefGoogle Scholar
  19. Pięciński SZ, Smoliński DJ, Zienkiewicz K, Bednarska E (2008) Changes in poly(A) RNA and TMG snRNA distribution in the embryo sac of Hyacinthus orientalis L. before and after fertilization. Sex Plant Reprod 21:247–257CrossRefGoogle Scholar
  20. Raška I, Andrade LEC, Ochs RL, Chan EKL, Chang CM (1991) Immunological and ultrastructural studies of the nuclear coiled body with autoimmune antibodies. Exp Cell Res 195:27–37PubMedCrossRefGoogle Scholar
  21. Reed R, Magni K (2001) A new view of mRNA export: separating the wheat from the chaff. Nat Cell Biol 3:E201–E204PubMedCrossRefGoogle Scholar
  22. Shopland LS, Johnson CV, Lawrence JB (2002) Evidence that all SC-35 domains contain mRNAs and that transcripts can be structurally constrained within these domains. J Cell Biol 140:131–139Google Scholar
  23. Schul W, van Driel R, de Jong L (1998) Coiled bodies and U2 snRNA genes adjacent to coiled bodies are enriched in factors required for snRNA transcription. Mol Biol Cell 9:1025–1036PubMedGoogle Scholar
  24. Seguí-Simarro JM, Bárány I, Suárez R, Fadón B, Testillano PS, Risueño MC (2006) Nuclear bodies domain changes with microspore reprogramming to embryogenesis. Eur J Histochem 50:35–44PubMedGoogle Scholar
  25. Smith KP, Lawrence JB (2000) Interactions of U2 gene loci and their nuclear transcripts with Cajal (coiled) bodies: evidence for preU2 within Cajal bodies. Mol Biol Cell 11:2987–2998PubMedGoogle Scholar
  26. Smoliński DJ, Niedojadło J, Noble A, Górska-Brylass A (2007) Additional nucleoli and NOR activity during meiotic prophase I in larch (Larix decidua Mill.). Protoplasma 232:109–120PubMedCrossRefGoogle Scholar
  27. Tupy J (1982) Alternation in polyadenylated RNA during pollen maturation and generation. Biol Plant 24:331–340CrossRefGoogle Scholar
  28. Visa N, Puvion-Dutilleul F, Harper F, Bachellerie JP, Puvion E (1993) Intranuclear distribution of poly(A) RNA determined by electron microscope in situ hybridization. Exp Cell Res 1:19–34CrossRefGoogle Scholar
  29. Zienkiewicz K, Smoliński DJ, Bednarska E (2006) Distribution of poly(A) RNA and splicing machinery elements in mature Hyacinthus orientalis L. pollen grains and pollen tubes growing in vitro. Protoplasma 227:95–103PubMedCrossRefGoogle Scholar
  30. Zienkiewicz K, Zienkiewicz A, Rodriguez-Garcia MI, Smoliński DJ, Swidziński M, Bednarska E (2008a) Transcriptional activity and distribution of splicing machinery elements during Hyacinthus orientalis L. pollen tube growth. Protoplasma 233(1–2):129–39PubMedCrossRefGoogle Scholar
  31. Zienkiewicz K, Zienkiewicz A, Smoliński DJ, Świdziński M, Bednarska E (2008b) Intracellular organization of the pre-mRNA splicing machinery during Hyacinthus orientalis L. pollen development. Sex Plant Reprod 21:217–231CrossRefGoogle Scholar
  32. Zienkiewicz K, Zienkiewicz A, Smoliński DJ, Rafińska K, Świdziński M, Bednarska E (2008) Transcriptional state and distribution of poly(A) RNA and RNA polymerase II in differentiating Hyacinthus orientalis L. pollen grains. Sex Plant Reprod 21:233–245CrossRefGoogle Scholar

Copyright information

© Springer-Verlag 2009

Authors and Affiliations

  • Agnieszka Kołowerzo
    • 1
  • Dariusz Jan Smoliński
    • 1
  • Elżbieta Bednarska
    • 1
  1. 1.Department of Cell Biology, Institute of General and Molecular BiologyNicolaus Copernicus UniversityToruńPoland

Personalised recommendations