Advertisement

Cell and Tissue Research

, Volume 352, Issue 3, pp 599–610 | Cite as

Alterations in the secretory pattern of dermal dendritic cells following melanin uptake

  • Mareike Müller
  • Hans Peter ElsässerEmail author
Regular Article

Abstract

Under a variety of circumstances, melanin occurs in the dermal compartment of the skin, being mostly observed in cells that have been termed melanophages, some of which have been identified as dermal dendritic cells. We analysed changes in the expression and secretion pattern of cytokines by dendritic cells after the uptake of melanin from various sources. Dendritic cells were derived from human primary blood monocytes or from the human monocytic cell line THP-1. Melanin uptake increased the secretion of the chemokines MIP-1β (CCL4) and MCP-1 (CCL2). The higher MIP-1β secretion was accompanied by higher MIP-1β gene expression. Elevation of MIP-1β secretion was dependent on the uptake of melanin but could not be induced by the phagocytosis of latex beads, indicating that the phagocytic process itself was not sufficient to increase the secretion of this cytokine. The data thus show that the uptake of melanin changes the cytokine expression and secretion pattern of dendritic-like cells.

Keywords

Melanin Melanophages Dendritic cells MCP-1 MIP-1β Human 

Notes

Acknowledgment

The expert technical assistance of Brigitte Agricola (Institute of Cytobiology and Cytopathology, Philipps University of Marburg, Germany) and Michael Hellwig (Institute of Material Science, Philipps University of Marburg, Germany) is greatly acknowledged. The THP-1 cells were a generous gift from Andreas Kaufmann (Institute of Immunology, Philipps University of Marburg, Germany). The B16F1 cells were a generous gift from Svenja Meierjohann (Theodor Boveri Institute, Würzburg, Germany).

Supplementary material

441_2013_1577_Fig7_ESM.jpg (49 kb)
Fig. S1

Characterisation of dendritic-like cells generated from primary monocytes (MoDCs) or from THP-1 cells (THPDCs) A) After a 9 d (MoDCs) or 5 d (THPDC) incubation with 5000 U/ml (MoDCs) or 2000 U/ml (THPDCs) interleukin 4 and 1000 U/ml GM-CSF primary monocytes were analysed by FACS, using antibodies against factor XIIIa (FXIIIa) or DC-SIGN. For DC SIGN, stainings cells were blocked with 1 % BSA/PBS for 15 min on ice and incubated either with an affinity purified mouse monoclonal antibody against DC-SIGN (MR-1, AbD Serotec, Düsseldorf, Germany) or with a control isotype-matched irrelevant monoclonal antibody at the same concentration for 30 min at 4°C. Subsequently, a secondary anti-mouse IgG antibody labeled with phycoerythrin (PE) (eBioscience, Frankfurt, Germany) was applied. Cells were finally fixed in 3 % PFA/PBS for 15 min at RT. For intracellular staining of FXIIIA cells were first fixed in 3 % PFA/PBS for 10 min at RT and subsequently incubated 10 min with 20 mM Glycin/PBS and permeabilised 10 min with 0.1 % (v/v) Saponin/PBS. After blocking in 0.1 % (v/v) saponin/ PBS/PBS for 15 min at RT, cells were stained with the monoclonal antibody mouse-anti-FXIIIA (AC-1A1, Abcam, Cambridge, USA) or with the isotype control IgG1 (MOPC-21, Sigma Aldrich). After three washing steps primary antibody was visualised with goat-anti-mouse-IgG conjugated to Alexa488 (polyclonal, Invitrogen). Measurements were performed with the flow cytometer FACS Canto II and the Software BD FACSDiva (BD Bioscience, Heidelberg, Germany). Further analysis was done using the software WinMDI 2.9 (TSRI). B) Quantitative RT-PCR to evaluate the expression of FXIIIa, DC-SIGN and CD163 in THPDCs and MoDCs, respectively, compared to unstimulated THP 1 cells or primary monocytes. Note that only in MoDCs the macrophage marker CD163 is strongly down regulated. Primers: CD163: 5’ ctggcgtgacatgttctgat 3’ (forward)/5’ ggctgcctccacctctaagt 3’ (reverse); FXIIIA : 5’ ccttcctgttggatttggag 3’ (forward)/ 5’ ggccacaccgatacatgc 3’ (reverse); DC SIGN: 5’ acggctcacctctgttgc 3’ (forward)/ 5’ cagtcttcctccccaacg 3’ (reverse). C) Immunofluorescence microscopy of MoDCs using antibodies against DC-SIGN (green) and FXIIIa (red). Nuclei were counterstained with Hoechst dye. Bar: 20 µm. (JPEG 48 kb)

441_2013_1577_MOESM1_ESM.tif (700 kb)
High Resolution Image (TIFF 700 kb)
441_2013_1577_Fig8_ESM.jpg (30 kb)
Fig. S2

Uptake of Fluospheres and melanin by THPDCs. Low power light microscopical pictures of THPDCs in culture, incubated in medium only (PBS; a), or in medium containing Fluospheres (b), B16F1 melanin (c), synthetic melanin (d) or melanin from S. officinalis (e). Fluospheres (b) are documented by an overlay of a fluorescence microscopical image and a phase contrast image, the other pictures represent phase contrast images. Arrows indicate cells with engulfed Fluospheres or melanin, respectively. Bar in a (also representing magnification of b to e): 25 µm. (JPEG 29 kb)

441_2013_1577_MOESM2_ESM.tif (8.8 mb)
High Resolution Image (TIFF 9038 kb)
441_2013_1577_Fig9_ESM.jpg (170 kb)
Fig. S3

Uptake of Fluospheres by MoDCs. Low (a, c) and high (b, d) power electron microscopical images to illustrate the ultrastructure of the MoDcs (a, b), as well as the Fluospheres and their intracellular deposition (c, d). Arrow in d marks a vacuole containing a Fluosphere. N: Nucleus.; Bars in a, c: 2 µm; Bars in b, d: 0.5 µm. (JPEG 169 kb)

441_2013_1577_MOESM3_ESM.tiff (15.3 mb)
High Resolution Image (TIFF 15694 kb)
441_2013_1577_Fig10_ESM.jpg (173 kb)
Fig. S4

Uptake of Fluospheres by THPDCs. Low (a, c) and high (b, d) power electron microscopical images to illustrate the ultrastructure of the THPDCs (a, b), as well as the Fluospheres and their intracellular deposition (c, d). Arrowheads in c and d mark vacuoles containing Fluospheres. N: Nucleus.; Bars in a, c: 2 µm; Bars in b, d: 0.5 µm. (JPEG 173 kb)

441_2013_1577_MOESM4_ESM.tif (16.6 mb)
High Resolution Image (TIFF 17035 kb)
441_2013_1577_Fig11_ESM.jpg (184 kb)
Fig. S5

Uptake of melanin by THPDCs. Low (a, c, e)) and high (b, d, f) power electron microscopical images to illustrate the ultrastructure of the different melanins and their intracellular deposition. Intracellular B16F1 (a and b) and synthetic melanin (c and d) are surrounded by a membrane (small arrows in b, d, f). In the huge melanin aggregates from S. officinalis (f) a limiting membrane is partially missing (big arrow in f). N: Nucleus. Bar in a (also representing magnification of c and e): 2 µm; Bars in b (also representing magnification of d and f): 0.5 µm. (JPEG 183 kb)

441_2013_1577_MOESM5_ESM.tif (18.7 mb)
High Resolution Image (TIFF 19111 kb)
441_2013_1577_Fig12_ESM.jpg (56 kb)
Fig. S6

Endotoxin content in the melanin and Fluosphere suspensions. Endotoxin concentrations were measured with the ToxinSensorTM chromogenic LAL Endotoxin Assay Kit (GenScript, Piscataway, USA). (A) Standard curve taken from samples shown in the panel below the graph. (B) Table summarizing the endotoxin concentration in the stock solutions of the melanins used and of the Fluospheres, as well as the concentration in the cell culture medium after appropriate dilution. –LAL: blank; +LAL: sample. The concentration was obtained from the standard curve using the absorption at 545 nm from the sample, corrected with the absorption at 545 nm of the blank. n.d.: not detectable. (JPEG 55 kb)

441_2013_1577_MOESM6_ESM.tif (1021 kb)
High Resolution Image (TIFF 1021 kb)
441_2013_1577_MOESM7_ESM.docx (21 kb)
Table S1 MIP-1β secreted by MoDCs incubated without and with melanin. Cell culture media from MoDCs derived from 10 different donors were analysed by an ELISA. Samples were taken after 6 h and 12 h of incubation without and with different melanins, with Fluospheres or with endotoxin (0.001 EU/ml). The medium was changed at time 0 h of incubation for cells from donors 10 to 13. Cells from the other donors received the indicated substances without prior medium change. Numbers given are in pg/ml as mean value ± standard deviation. Bold numbers are fold induction of MIP-1β secretion with versus without melanin, Fluospheres or endotoxin, respectively. Depending on the amount of cells available 1 to 6 separate samples per donor were analysed (donor 4-10: n = 1; donor 11: n = 5 for 6 h and n = 3 for 12 h; donor 12: n = 5 for 6 h and n = 3 for 12 h; donor 13: n = 4). For each sample MIP-1ß concentration was measured in triplicates. (DOCX 21.3 kb)
441_2013_1577_MOESM8_ESM.docx (42 kb)
Table S2 MIP-1β secreted by THPDCs incubated without and with melanin. Cell culture media from 4 different experiments were analysed by an ELISA. Samples were taken after 12 h and 24 h of incubation without and with different melanins, with Fluospheres or with endotoxin (0.001 EU/ml). Numbers given are in pg/ml as mean value ± standard deviation. Bold numbers are fold induction of MIP-1β secretion with versus without melanin, Fluorospheres or endotoxin, respectively. For each sample MIP-1β concentration was measured in triplicates. (DOCX 41.5 kb)
441_2013_1577_MOESM9_ESM.docx (64 kb)
Table S3 MCP-1 secreted by MoDCs incubated without and with melanin. Cell culture media from MoDCs derived from 10 different donors were analysed by an ELISA. Samples were taken after 6 h and 12 h of incubation without and with different melanins, with Fluospheres or with endotoxin (0.001 EU/ml). The medium was changed at time 0 h of incubation for cells from donors 10 to 13. Cells from the other donors received the indicated substances without prior medium change. Numbers given are in pg/ml as mean value ± standard deviation. Bold numbers are fold induction of MCP-1 secretion with versus without melanin, Fluospheres or endotoxin, respectively. Depending on the amount of cells available 1 to 6 separate samples per donor were analysed (donor 4-10: n = 1; donor 11: n = 5 for 6 h and n = 3 for 12 h; donor 12: n = 5 for 6 h and n = 3 for 12 h; donor 13: n = 4). For each sample MCP-1 concentration was measured in triplicates. (DOCX 64 kb)
441_2013_1577_MOESM10_ESM.docx (43 kb)
Table S4 MCP-1 secreted by THPDCs incubated without and with melanin. Cell culture media from 4 different experiments were analysed by an ELISA. Samples were taken after 12 h and 24 h of incubation without and with different melanins, with Fluospheres or with endotoxin (0.001 EU/ml). Numbers given are in pg/ml as mean value ± standard deviation. Bold numbers are fold induction of MCP-1 secretion with versus without melanin, Fluorospheres or endotoxin, respectively. For each sample MCP-1 concentration was measured in triplicates. (DOCX 43 kb)

References

  1. Alviano DS, Franzen AJ, Travassos LR, Holandino C, Rozental S, Ejzemberg R, Alviano CS, Rodrigues ML (2004) Melanin from Fonsecaea pedrosoi induces production of human antifungal antibodies and enhances the antimicrobial efficacy of phagocytes. Infect Immun 72:229–237PubMedCrossRefGoogle Scholar
  2. Angel P, Szabowski A (2002) Function of AP-1 target genes in mesenchymal-epithelial cross-talk in skin. Biochem Pharmacol 64:949–956PubMedCrossRefGoogle Scholar
  3. Deleuran M, Buhl L, Ellingsen T, Harada A, Larsen CG, Matsushima K, Deleuran B (1996) Localization of monocyte chemotactic and activating factor (MCAF/MCP-1) in psoriasis. J Dermatol Sci 13:228–236PubMedCrossRefGoogle Scholar
  4. Deshmane SL, Kremlev S, Amini S, Sawaya BE (2009) Monocyte chemoattractant protein-1 (MCP-1): an overview. J Interferon Cytokine Res 29:313–326PubMedCrossRefGoogle Scholar
  5. Distler JHW, Akhmetshina A, Schett G, Distler O (2009) Monocyte chemoattractant proteins in the pathogenesis of systemic sclerosis. Rheumatology (Oxford) 48:98–103CrossRefGoogle Scholar
  6. Ebihara T, Nakayama H (1997) Pigmented contact dermatitis. Clin Dermatol 15:593–599PubMedCrossRefGoogle Scholar
  7. Fidler IJ, Nicolson GL (1976) Organ selectivity for implantation survival and growth of B16 melanoma variant tumor lines. J Natl Canc Inst 57:1199–1202Google Scholar
  8. Giacaman RA, Nobbs AH, Ross KF, Herzberg MC (2007) Porphyromonas gingivalis selectively up-regulates the HIV-1 coreceptor CCR5 in oral keratinocytes. J Immunol 179:2542–2550PubMedGoogle Scholar
  9. Gilliet M, Cao W, Liu Y-J (2008) Plasmacytoid dendritic cells: sensing nucleic acids in viral infection and autoimmune diseases. Nat Rev Immunol 8:594–606PubMedCrossRefGoogle Scholar
  10. Gros E, Bussmann C, Bieber T, Förster I, Novak N (2009) Expression of chemokines and chemokine receptors in lesional and nonlesional upper skin of patients with atopic dermatitis. J Allergy Clin Immunol 124:753–760PubMedCrossRefGoogle Scholar
  11. Haniffa M, Ginhoux F, Wang X-N, Bigley V, Abel M, Dimmick I, Bullock S, Grisotto M, Booth T, Taub P, Hilkens C, Merad M, Collin M (2009) Differential rates of replacement of human dermal dendritic cells and macrophages during hematopoietic stem cell transplantation. J Exp Med 206:371–385PubMedCrossRefGoogle Scholar
  12. Hennen J, Aeby P, Goebel C, Schettgen T, Oberli A, Kalmes M, Blömeke B (2011) Cross talk between keratinocytes and dendritic cells: impact on the prediction of sensitization. Toxicol Sci 123:501–510PubMedCrossRefGoogle Scholar
  13. Hoeller D, Volarevic S, Dikic I (2005) Compartmentalization of growth factor receptor signalling. Curr Opin Cell Biol 17:107–111PubMedCrossRefGoogle Scholar
  14. Hori Y, Kawashima M, Oohara K, Kukita A (1984) Acquired, bilateral nevus of Ota-like macules. J Am Acad Dermatol 10:961–964PubMedCrossRefGoogle Scholar
  15. Ito S, Karnovsky MJ (1968) Formaldehyde-glutaraldehyde fixatives containing trinitro compounds. J Cell Biol 39:168–169Google Scholar
  16. Jiang Z, Xu J, Long M, Tu Z, Yang G, He G (2009) 2, 3, 5, 4′-Tetrahydroxystilbene-2-O-beta-D-glucoside (THSG) induces melanogenesis in B16 cells by MAP kinase activation and tyrosinase upregulation. Life Sci 85:345–350PubMedCrossRefGoogle Scholar
  17. Kaburagi Y, Shimada Y, Nagaoka T, Hasegawa M, Takehara K, Sato S (2001) Enhanced production of CC-chemokines (RANTES, MCP-1, MIP-1alpha, MIP-1beta, and eotaxin) in patients with atopic dermatitis. Arch Dermatol Res 293:350–355PubMedCrossRefGoogle Scholar
  18. Klechevsky E, Morita R, Liu M, Cao Y, Coquery S, Thompson-Snipes L, Briere F, Chaussabel D, Zurawski G, Palucka AK, Reiter Y, Banchereau J, Ueno H (2008) Functional specializations of human epidermal Langerhans cells and CD14+ dermal dendritic cells. Immunity 29:497–510PubMedCrossRefGoogle Scholar
  19. Koelink PJ, Overbeek SA, Braber S, de Kruijf P, Folkerts G, Smit MJ, Kraneveld AD (2012) Targeting chemokine receptors in chronic inflammatory diseases: an extensive review. Pharmacol Ther 133:1–18PubMedCrossRefGoogle Scholar
  20. Kolattukudy PE, Niu J (2012) Inflammation, endoplasmic reticulum stress, autophagy, and the monocyte chemoattractant protein-1/CCR2 pathway. Circ Res 110:174–189PubMedCrossRefGoogle Scholar
  21. Kroeze KL, Boink MA, Sampat-Sardjoepersad SC, Waaijman T, Scheper RJ, Gibbs S (2012) Autocrine regulation of re-epithelialization after wounding by chemokine receptors CCR1, CCR10, CXCR1, CXCR2, and CXCR3. J Invest Dermatol 132:216–225PubMedCrossRefGoogle Scholar
  22. Kurban AK, Morrison PR, Trainor SW, Tan OT (1992) Pulse duration effects on cutaneous pigment. Lasers Surg Med 12:282–287PubMedCrossRefGoogle Scholar
  23. Lacz NL, Vafaie J, Kihiczak NI, Schwartz RA (2004) Postinflammatory hyperpigmentation: a common but troubling condition. Int J Dermatol 43:362–365PubMedCrossRefGoogle Scholar
  24. Lagonigro MS, De Cecco L, Carninci P, Di Stasi D, Ranzani T, Rodolfo M, Gariboldi M (2004) CTAB-urea method purifies RNA from melanin for cDNA microarray analysis. Pigment Cell Res 17:312–315PubMedCrossRefGoogle Scholar
  25. Lever WF (1967) Histopathology of the skin. Pitman Medical, LondonGoogle Scholar
  26. Liu GY, Nizet V (2009) Color me bad: microbial pigments as virulence factors. Trends Microbiol 17:406–413PubMedCrossRefGoogle Scholar
  27. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods 25:402–408PubMedCrossRefGoogle Scholar
  28. Masu S, Seiji M (1981) Ultrastructural studies in the development of pigmentary incontinence in fixed drug eruption. In: Fitzpatrick TB (ed) Biology and diseases of dermal pigmentation. University of Tokyo Press, Tokyo, pp 133–149Google Scholar
  29. Masu S, Seiji M (1983) Pigmentary incontinence in fixed drug eruptions. Histologic and electron microscopic findings. J Am Acad Dermatol 8:525–532PubMedCrossRefGoogle Scholar
  30. Masutani M (1994) The histological mechanisms of incontinentia pigmenti. In: Ishibashi Y, Nakagawa H, Suzuki H (eds) Electron microscopy in dermatology—basic and clinical research. Elsevier, Amsterdam, pp 399–406Google Scholar
  31. Matsumoto M, Oshiumi H, Seya T (2011) Antiviral responses induced by the TLR3 pathway. Rev Med Virol (in press)Google Scholar
  32. Maurer M, von Stebut E (2004) Macrophage inflammatory protein-1. Int J Biochem Cell Biol 36:1882–1886PubMedCrossRefGoogle Scholar
  33. Menten P, Wuyts A, Van Damme J (2002) Macrophage inflammatory protein-1. Cytokine Growth Factor Rev 13:455–481PubMedCrossRefGoogle Scholar
  34. Murray PJ, Wynn TA (2011) Protective and pathogenic functions of macrophage subsets. Nat Rev Immunol 11:723–737PubMedCrossRefGoogle Scholar
  35. Mustoe TA, Gurjala A (2011) The role of the epidermis and the mechanism of action of occlusive dressings in scarring. Wound Repair Regen 19 (Suppl 1):s16–s21PubMedCrossRefGoogle Scholar
  36. Nagao S, Ito N, Suzuki M, Satoh N, Iijima S (1986) Electron microscopic study of histological pigmentary incontinence—methods of melanosome translocation from the epidermis to the dermis. Fukushima J Med Sci 32:141–153PubMedGoogle Scholar
  37. Nestle FO, Nickoloff BJ (2007) Deepening our understanding of immune sentinels in the skin. J Clin Invest 117:2382–2385PubMedCrossRefGoogle Scholar
  38. Nestle FO, Zheng XG, Thompson CB, Turka LA, Nickoloff BJ (1993) Characterization of dermal dendritic cells obtained from normal human skin reveals phenotypic and functionally distinctive subsets. J Immunol 151:6535–6545PubMedGoogle Scholar
  39. Noblesse E, Nizard C, Cario-André M, Lepreux S, Pain C, Schnebert S, Taïeb A, Kurfurst R (2006) Skin ultrastructure in senile lentigo. Skin Pharmacol Physiol 19:95–100PubMedCrossRefGoogle Scholar
  40. Nomura I, Gao B, Boguniewicz M, Darst MA, Travers JB, Leung DY (2003) Distinct patterns of gene expression in the skin lesions of atopic dermatitis and psoriasis: a gene microarray analysis. J Allergy Clin Immunol 112:1195–1202PubMedCrossRefGoogle Scholar
  41. Oberg F, Haseeb A, Ahnfelt M, Pontén F, Westermark B, El-Obeid A (2009) Herbal melanin activates TLR4/NF-kappaB signaling pathway. Phytomedicine 16:477–484PubMedCrossRefGoogle Scholar
  42. Oberländer U, Pletinckx K, Döhler A, Müller N, Lutz M, Arzberger T, Riederer P, Gerlach M, Koutsilieri E, Scheller C (2011) Neuromelanin is an immune stimulator for dendritic cells in vitro. BMC Neurosci 12:116PubMedCrossRefGoogle Scholar
  43. Ochoa MT, Loncaric A, Krutzik SR, Becker TC, Modlin RL (2008) “Dermal dendritic cells” comprise two distinct populations: CD1+ dendritic cells and CD209+ macrophages. J Invest Dermatol 128:2225–2231PubMedCrossRefGoogle Scholar
  44. Page S, Chandhoke V, Baranova A (2011) Melanin and melanogenesis in adipose tissue: possible mechanisms for abating oxidative stress and inflammation? Obes Rev 12:e21–e31PubMedCrossRefGoogle Scholar
  45. Pedrosa E, Carretero-Iglesia L, Boada A, Colobran R, Faner R, Pujol-Autonell I, Palou E, Esteve A, Pujol-Borrell R, Ferrándiz C, Juan M, Carrascosa J-M (2011) CCL4L polymorphisms and CCL4/CCL4L serum levels are associated with psoriasis severity. J Invest Dermatol 131:1830–1837PubMedCrossRefGoogle Scholar
  46. Prota G, D’ischia M, Napolitano A (1998) The chemistry of melanins and related metabolites. In: Nordlund JJ, Boissy RE, Hearing VJ, King RA, Ortonne J-P (eds) The pigmentary system. Oxford University Press, New York, pp 307–332Google Scholar
  47. Pugh ND, Balachandran P, Lata H, Dayan FE, Joshi V, Bedir E, Makino T, Moraes R, Khan I, Pasco DS (2005) Melanin: dietary mucosal immune modulator from Echinacea and other botanical supplements. Int Immunopharmacol 5:637–647PubMedCrossRefGoogle Scholar
  48. Quatresooz P, Paquet P, Hermanns-Lê T, Piérard GE (2008) Molecular mapping of Factor XIIIa-enriched dendrocytes in the skin. Int J Mol Med 22:403–409PubMedGoogle Scholar
  49. Rottman JB, Ganley KP, Williams K, Wu L, Mackay CR, Ringler DJ (1997) Cellular localization of the chemokine receptor CCR5. Correlation to cellular targets of HIV-1 infection. Am J Pathol 151:1341–1351PubMedGoogle Scholar
  50. Rowden G, Sulica VI, Butler TP, Manz HJ (1980) Malignant melanoma with melanosis. Ultrastructural and histological studies. J Cutan Pathol 7:125–139PubMedCrossRefGoogle Scholar
  51. Sallusto F, Lanzavecchia A (1994) Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor alpha. J Exp Med 179:1109–1118PubMedCrossRefGoogle Scholar
  52. Sallusto F, Lanzavecchia A (2009) Human Th17 cells in infection and autoimmunity. Microbes Infect 11:620–624PubMedCrossRefGoogle Scholar
  53. Schamburg-Lever G, Lever WF (1973) Electron microscopy of incontinentia pigmenti. J Invest Dermatol 61:151–158PubMedCrossRefGoogle Scholar
  54. Schmittgen TD, Livak KJ (2008) Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc 3:1101–1108PubMedCrossRefGoogle Scholar
  55. Tsuchiya S, Yamabe M, Yamaguchi Y, Kobayashi Y, Konno T, Tada K (1980) Establishment and characterization of a human acute monocytic leukemia cell line (THP-1). Int J Cancer 26:171–176PubMedCrossRefGoogle Scholar
  56. Unver N, Freyschmidt-Paul P, Hörster S, Wenck H, Stäb F, Blatt T, Elsässer H-P (2006) Alterations in the epidermal-dermal melanin axis and factor XIIIa melanophages in senile lentigo and ageing skin. Br J Dermatol 155:119–128PubMedCrossRefGoogle Scholar
  57. Yamamoto T (2008) Pathogenic role of CCL2/MCP-1 in scleroderma. Front Biosci 13:2686–2695PubMedCrossRefGoogle Scholar
  58. Yang K, Wang XQ, He YS, Lu L, Chen QJ, Liu J, Shen WF (2010) Advanced glycation end products induce chemokine/cytokine production via activation of p38 pathway and inhibit proliferation and migration of bone marrow mesenchymal stem cells. Cardiovasc Diabetol 9:66PubMedCrossRefGoogle Scholar
  59. Zaba LC, Fuentes-Duculan J, Steinman RM, Krueger JG, Lowes MA (2007) Normal human dermis contains distinct populations of CD11c+BDCA-1+ dendritic cells and CD163+FXIIIA+ macrophages. J Clin Invest 117:2517–2525PubMedCrossRefGoogle Scholar
  60. Zaba LC, Krueger JG, Lowes MA (2009) Resident and “inflammatory” dendritic cells in human skin. J Invest Dermatol 129:302–308PubMedCrossRefGoogle Scholar
  61. Zlotnik A, Yoshie O (2000) Chemokines: a new classification system and their role in immunity. Immunity 12:121–127PubMedCrossRefGoogle Scholar

Copyright information

© Springer-Verlag Berlin Heidelberg 2013

Authors and Affiliations

  1. 1.Department of Cytobiology and CytopathobiologyPhilipps University of MarburgMarburgGermany

Personalised recommendations