Cell and Tissue Research

, Volume 325, Issue 3, pp 513–522 | Cite as

Elevated gene expression of MMP-1, MMP-10, and TIMP-1 reveal changes of molecules involved in turn-over of extracellular matrix in cyclosporine-induced gingival overgrowth

  • Bettina Dannewitz
  • Christina Edrich
  • Pascal Tomakidi
  • Annette Kohl
  • Olaf Gabbert
  • Peter Eickholz
  • Thorsten Steinberg
Regular Article

Abstract

In humans, pathogenesis in cyclosporine A (CsA)-induced gingival overgrowth (GO) includes the accumulation of extracellular matrix (ECM) constituents, viz., collagen type-1 and type-3 and proteoglycans, in subgingival connective tissue. However, whether this increase is associated with alterations of molecules pivotal for the turn-over of collagens and proteoglycans remains unclear. The present study explores the status of matrix metalloproteinase MMP-1 and MMP-10, which are important for fibrillar collagen and proteoglycan turn-over, and their tissue inhibitor TIMP-1, on their gene expression and protein levels in frozen sections derived from GO and matched normal tissue. In situ hybridization (ISH) revealed elevated levels of MMP-1 gene expression in the connective tissue of GO compared with normal tissue. This elevation also applied to MMP-10 and TIMP-1, the latter exhibiting the strongest gene transcription in the deep connective tissue. These differences detected by ISH were corroborated by quantitative reverse transcription/polymerase chain reaction; relative gene expression analysis indicated a 1.9-fold increase for MMP-1, a 2.3-fold increase for MMP-10, and a 4.8-fold increase for TIMP-1. Detection of the protein by indirect immunofluorescence showed that normal gingival tissue was devoid of all three proteins, although they were detectable in GO tissue, with emphasis on TIMP-1. Analysis of our data indicates elevated levels of MMP-1 and-10, and particularly TIMP-1. With respect to TIMP-1, this elevation may in turn lead to alterations in ECM turn-over by abrogating MMP-1 and MMP-10, thereby contributing to ECM accumulation associated with GO.

Keywords

Gingival overgrowth Cyclosporine A MMP-1 MMP-10 TIMP-1 Human 

Introduction

Cyclosporine A (CsA) is a potent immunosuppressant that is widely used to prevent organ rejection and to treat autoimmune disorders (Shevach 1985). The prominent side-effect of CsA therapy in oral tissue is gingival overgrowth (GO; Bennet and Christian 1982; Wysocki et al. 1983) with a prevalence ranging from 2% to 70% (Margiotta et al. 1996). However, the precise molecular mechanisms underlying this development are still not elucidated. Moreover, this process seems to be multifactorial in nature, involving genetics, plaque control, gingival inflammation, the dosage and duration of the administered drug, CsA blood concentration, the age of the patient, and the concomitant medical condition (Seymour and Jacobs 1992; Somacarrera et al. 1994). Histopathologically, GO is characterized by (1) thickening of the epithelium with prominent rete pegs (Spolidorio et al. 2004; Mariani et al. 2004), (2) enlargement of the gingival connective tissue (GCT) with an accumulation of fibroblasts, and (3) an increase of collagen fibers and amorphous ground substance (Mariani et al. 1993). The GCT consists of a dense network of fibrillar collagens, predominantly type-1 collagen (COL-1) but also type-3 collagen (COL-3), which provides firmness to the gingiva and attaches the gingiva to the tooth and the alveolar bone. It also contains extracellular matrix (ECM) proteoglycans including decorin, biglycan, perlecan, and versican (for a review, see Bartold et al. 2000). Experimental evidence obtained from humans, animal experiments, and cell-cultures indicate that not only interstitial COL-1 (Bolzani et al. 2000; Kataoka et al. 2000; Hyland et al. 2003) and COL-3 (Ceol et al. 2000), but also the proteoglycans (Gnoatto et al. 2003; Zebrowski et al. 1994) are targets of CsA. For collagens and proteoglycans, there is a growing body of evidence that altered turn-over is responsible for GO (Gnoatto et al. 2003; Zebrowski et al. 1994). ECM turn-over is important for the maintenance of matrix homeostasis, which is precisely regulated by its synthesis and degradation (Fornoni et al. 2001). Degradation of ECM components is conducted by a wide range of matrix metalloproteinases (MMPs) synthesized by a variety of cells including fibroblasts. MMPs are a family of zinc-dependent endopeptidases (Birkedal-Hansen 1993; Reynolds 1996) consisting of at least 23 members, which are grouped according to their substrate specificity (Kelly and Jarjour 2003; Visse and Nagase 2003) and their structure (Egeblad and Werb 2002). Collagenase-1 (MMP-1, interstitial collagenase) initiates the degradation of fibrillar collagens such as COL-1 and COL-3, followed by further breakdown mediated by gelatinases and stromelysins. Stromelysin-2 (MMP-10) is expressed in human keratinocytes and in mesenchymal cells (Windsor et al. 1993) and cleaves not only COL-3, but also non-collagenous ECM components including fibronectin, laminin, and proteoglycans (Sternlicht and Werb 2001). Moreover, MMP-10 has the capacity to activate pro-collagenases such as pro-MMP-1 (Nicholson et al. 1989; Nagase and Woessner 1999; Murphy et al. 1987). MMPs are tightly regulated at multiple levels, including (1) gene transcription, (2) activation of the latent enzyme, and (3) inactivation by specific inhibitors (Nagase and Woessner 1999; Sternlicht and Werb 2001). Tissue inhibitors of metalloproteinases (TIMPs) are the major endogenous regulators of MMP activities in tissue, and four homologous TIMPs (TIMPs 1–4) have been identified to date (Gomez et al. 1997). The activity of MMP-1 and MMP-10 is firmly controlled by their inhibitors, mainly TIMP-1 (Woessner 1991; Nakamura et al.1998), which is expressed in human fibroblasts (Domeij et al. 2004) and in human keratinocytes (Amano et al. 2005).

In the context of CsA-induced GO, whether the accumulation of ECM is attributable to an increased synthesis of matrix components or changes in the expression of molecules contributing to ECM turn-over remains unclear. We have therefore analyzed the status of MMP-1, MMP-10, and TIMP-1 in specimens of GO and matched normal tissue with respect to relevant gene expression and protein levels.

Materials and methods

Patients and tissues

For tissue harvest, informed consent was obtained from our patients according to the Helsinki Declaration, and the protocol was approved by the institutional ethics committee. Four CsA-treated renal transplant patients (aged 29–61 years, four female), who attended the Department of Operative Dentistry and Periodontology (University of Heidelberg, Germany) were selected for the study. Specimens were taken from the interdental area, where the tissue revealed characteristic signs of GO.

Normal gingival tissue was obtained from four healthy patients (aged 18–55 years, four female), who underwent coronally advanced flap procedure aimed at covering recession defects (three patients), or during implant placement and implant uncovering (one patient). No relevant pre-existing medical or drug histories were cited during the previous 6 months, and the tissue was free from plaque-induced inflammation, which was tested by clinical parameters (plaque control record; gingival bleeding index).

Labeling of RNA probes and in situ hybridization

The technique was adapted from the simplified in situ hybridization (ISH) protocol developed by Braissant and Wahli (1998) with digoxigenin (DIG)-labeled riboprobes to detect abundant and rare mRNA on tissue sections. Gingival biopsies were taken and immediately stored in RNA stabilization solution (RNAlater, Ambion, Tex., USA). The expression of MMP-1, MMP-10, and TIMP-1 mRNA in tissue derived from normal gingiva and GO was assessed by ISH with a DIG-labeled sense/antisense riboprobe. DNA templates were prepared from total RNA derived from human periodontal ligament cells (PDL) by reverse transcription/polymerase chain reaction (RT-PCR). The PCR primer for MMP-1, MMP-10, and TIMP-1 contained the sequence of the SP6 (GATTTAGGTGACACTATAG) or T7 (TAATACGACTCACTATA) promotor and downstream the corresponding target sequences (Table 1). Riboprobes were labeled with DIG by in vitro transcription with SP6 or T7 polymerase and 4 μg DNA templates according to the manufacturer’s protocol (Roche Diagnostics, Mannheim, Germany). Cryosections of the specimens were cut at 10 μm thickness, fixed in phosphate-buffered 4% paraformaldehyde and 0.5% glutaraldehyde for 10 min at room temperature, digested with proteinase K (1 μg/ml) at 37°C for 30 min, and post-fixed with 4% phosphate-buffered paraformaldehyde for 5 min at 4°C. General precautions taken to prevent RNase contamination of samples and reagents included the baking of of all glassware for 8 h at 180°C and diethylpyrocarbonate treatment of all aqueous solutions. The hybridization experiment was carried out according to the manufacturer’s protocol (http://www.roche-applied-science.com). Colorimetric detection was performed according to the manufacturer’s instructions (DIG-Detection kit; Roche Diagnostics). For detection of hybridization, sections were incubated with blocking buffer containing anti-DIG antibodies conjugated with alkaline phosphatase (1:200, 150 mU/ml) for 2 h at room temperature. After the color reaction (NBT/BCIP), the sections were counterstained with 0.02% fast green FCF (Aldrich Chemical, Milwaukee, Wis., USA) for 1–2 min. Sections were mounted in 85% (v/v) glycerin and documented by light microscopy. Relative intensity was scored on a four-grade scale by two experienced examiners (− no mRNA transcripts, + presence of some mRNA transcripts, ++ readily detectable mRNA transcripts, +++ highest abundance of mRNA transcripts).
Table 1

Primer sequences of MMP-1, MMP-10, TIMP-1, and the housekeeping genes (HKG; Vandesompele et al. 2002) used for in situ hybridization (ISH) and quantitative polymerase chain reaction (qPCR). Efficiency values (E) are also given

Molecules

Primer sequences

Amplicon (bp)

Annealing temp (°C)

MMP-1; matrix metalloproteinase 1 (interstitial collagenase), NM_002421.1 (E=1.99)

qPCR

Biomol, Hamburg (PPH00120A)

155

55

ISH

T7 Antisense: 5′-ACTAATACGACTCACTA AAGCTC AACTTCCGGGTAGAA-3′

142

59

Sp6 Sense: 5′-GATTTAGGTGACACTATAGG CTCAGGATGACATTGATGG-3′

61

MMP-10; matrix metalloproteinase 10 (stromelysin 2), NM_002425.1 (E=1.97)

qPCR

Sense: 5′ATCCAAGAGGCATCCATACC3′

199

56

Antisense: 5′TCAACCTTAGGCTCAACTCC3′

 

ISH

T7 Antisense: 5′-ACTAATACGACTCAC TATAGGCTCAACTCCTGGAAAGTC-3′

335

60

Sp6 Sense: 5′-GATTTAGGTGACACTATAGG CCAT CAGAGGAAATGAGGT-3′

61

TIMP-1; tissue inhibitor of metalloproteinase 1 (erythroid potentiating activity, collagenase inhibitor), NM_003254.2 (E=1.93)

qPCR

Sense: 5′CACCCACAGACGGCCTTCT3′

346

57

Antisense: 5′CTTCTGGTGTCCGCACGAA3′

ISH

T7 Antisense: 5′-CTAATTAATACGACTCACT ATATGCAGTTTTCCAGCAATGAG-3′

170

59

Sp6 Sense: 5′-CGATTTAGGTGACACTATA AATTCCGACCTCGTCATCAG-3′

61

HKG

GAPDH; glyeraldehyde-3-phopshate dehydrogenase, NM_002046.2 (E=1.99)

qPCR

Sense: 5′TGCACCACCAACTGCTTAGC3′

87

58

Antisense: 5′GGCATGGACTGTGGTCATGAG3′

HPRT1; hypoxanthine phosphoribosyltransferase 1 (Lesch-Nyhan syndrome) NM_000194.1 (E =1.98)

qPCR

Sense: 5′TGACACTGGCAAAACAATGCA3′

94

55.3

Antisense: 5′GGTCCTTTTCACCAGCAAGCT3′

HMBS; hydroxymethylbilane synthase NM_000190.3 (E=1.97)

qPCR

Sense: 5′GGCAATGCGGCTGCAA3′

64

55.5

Antisense: 5′GGGTACCCACGCGAATCAC3′

RNA extraction and quantitative real-time PCR analysis

Total RNA was extracted from sections of deep-frozen tissue by using the RNeasy mini kit (Qiagen, Valencia, Calif., USA). Sufficient material was available from four patients with GO or normal gingival. RNA concentration was determined by absorbance at 260 nm.

First-strand cDNA was synthesized from a 1 μg total RNA aliquot in a reaction mixture containing random hexamer primer by performing the RevertAid reverse transcription protocol (K1622; Fermentas, Hanover, Md., USA). cDNA concentration was determined by fluorometry by using a fluorescent dye (PicoGreen; Molecular Probes) and adjusted to 0.5 ng/μl. PCR analysis was performed with the iCycler Real-Time PCR Detection System (BioRad Laboratories, Philadelphia, Pa., USA) according to the manufacturer’s instructions. The standard temperature profile included initial denaturation for 3 min at 95°C, followed by 40 cycles of denaturation at 94°C for 40 s, annealing at 55°C to 57°C (primer-dependent) for 30 s, and extension at 72°C for 40 s. Sequences of the primers (designed with Beacon Designer 5.0 Software; BioRad Laboratories), and probes used are listed in Table 1. Several housekeeping genes (HKG), viz., glyeraldehyde-3-phosphate dehydrogenase (GAPDH), YHWAZ, hydroxymethylbilane synthase (HMBS), hypoxanthine phosphoribosyltransferase 1 (HPRT1), actin beta (ACTB; Vandesompele et al. 2002) were tested for their expression stability, and a weighted expression index was calculated on the basis of the expression data of the three most stable HKG (GAPDH, HPRT1, HMBS). The target gene expression level was normalized to this index and calculated on the basis of a modification of the ΔΔCT equation and statistic evaluation, which allows counting for differences in efficiencies (E=10−1/slope) between the PCRs by using REST software (REST-348; Relative Expression Software Tool; Pfaffl et al. 2002). To compare the expression level between normal and CsA-affected gingiva, individual results were pooled and plotted as the x-fold difference between both groups.

Tissue preparation and indirect immunofluorescence

Indirect immunofluorescence (IIF) was performed on serial cryostat sections (10 μm) of normal gingiva and CsA-induced overgrown gingival tissue. In brief, after being air-dried, sections were fixed in 80% methanol and in acetone (5 min each, 4°C) and then incubated with primary antibodies overnight at 4°C following protocols described previously (Tomakidi et al. 2003). Mouse monoclonal anti-human TIMP-1 (sc-21734; Santa Cruz Biotechnology, Santa Cruz, Calif., USA), mouse monoclonal anti-human MMP-1 (sc-21731; Santa Cruz Biotechnology), and goat polyclonal anti-human MMP-10 (sc-9941; Santa Cruz Biotechnology) antibodies were adjusted to a final working concentration of 1:100 each. For IIF, samples were washed in phosphate-buffered saline (PBS; 3×5 min) and incubated with secondary fluorochrome-conjugated antibodies (1:100; Alexa Fluor, MoBiTec GmbH, Göttingen, Germany) for 1 h at room temperature. To allow total nuclei staining, propidium iodide (Sigma-Aldrich, Munich, Germany; 10 μg/ml) was added to the secondary antibody. Specimens were mounted in glycerin (glycerol-PBS, 1:1) and documented by confocal laser scan microscopy (Leica TCS/NTCLSM microscope; Leica Microsystems, Bannockburn, Ill., USA). To test the specificity of immunostaining, negative controls were run without primary antibodies. These specimens revealed no staining reaction (figures are not shown). Relative immunofluorescence intensity was scored by two experienced examiners by using a four-grade scale model (- no immunoreactivity, + some immunoreactivity, ++ easily seen immunoreactivity, +++ highest immunoreactivity and, hence, protein abundance).

Results

ISH indicates elevated mRNA levels of MMP-1, MMP-10, and TIMP-1 in GO compared with normal gingival tissue

To assess whether CsA treatment had an impact on components involved in ECM turn-over, the mRNA transcription levels of MMP-1, MMP-10, and TIMP-1 were investigated in frozen sections of tissues derived from several CsA-treated patients and matched normal tissue, by non-radioactive ISH. In comparison with normal gingiva (Fig. 1a,a1), MMP-1 mRNA levels detected by ISH appeared to be stronger in GO (Fig. 1b,b1). Whereas in the normal tissue, MMP-1 transcripts were predominantly found in the basal cell compartment of the gingival epithelium (Fig. 1a,a1), they were more pronounced in the papillary and deep connective tissue in GO (Fig. 1a1,b1). For MMP-10, transcripts exhibited an equal intensity and distribution in the epithelial compartment in normal (Fig. 1c,c1) and GO tissue (Fig. 1d,d1). However, in the deep connective tissue, detected MMP-10 mRNA levels in GO differed from those of normal tissue. In healthy samples, deep connective tissue showed low MMP-10 levels (Fig. 1c1), whereas MMP-10 mRNA was strong in the deep connective tissue of GO (Fig. 1d1). In normal tissue, transcription of the inhibitor TIMP-1 was low in the epithelium, in its underlying papillary, and in deep connective tissue (Fig. 1e,e1). Interestingly, the mRNA gene expression levels for TIMP-1 in GO indicated strong transcription of this inhibitor in the entire connective tissue (Fig. 1f1) and intermediate transcription levels in the epithelium (Fig. 1f,f1). As previously seen for the MMPs under study (Fig.1a,a1–d,d1), TIMP-1 mRNA was also detected in basal and parabasal epithelial cells (Fig. 1f). The relative gene expression of the analyzed molecules is summarized in Table 2.
Fig. 1

Non-radioactive in situ hybridization (ISH) on frozen sections of tissue from patients with CsA-induced GO (right) and control patients (left) without CsA treatment (EP epithelium, CT connective tissue). ISH was performed with antisense riboprobes. b, b1 Signal for MMP-1 in GO sections showed elevated mRNA transcription level in connective tissue (arrows), compared with control tissue (a, a1). d, d1 The hybridization signal for MMP-10 showed intermediate mRNA levels in the basal epithelial compartment (arrows) and strong mRNA transcription in the deep connective tissue of GO, whereas in normal tissue, MMP-10 transcripts were intermediate in the epithelium and low in the connective tissue (c, c1). For TIMP-1, the signal for mRNA was strong in the connective tissue (arrows) of GO (f, f1), in comparison with normal gingival tissue (e, e1) in which the signal was much weaker. Bars 100 μm

Table 2

Relative expression of MMP-1, MMP-10, and TIMP-1 in native tissue specimens derived from normal gingiva and CsA-induced gingival overgrowth (GO) as assessed by indirect immunofluorescence (IIF) and ISH

Method

Molecule

Tissue area in normal gingiva

Tissue area in GO

Basal epithelial compartment

Papillary connective tissue

Deep connective tissue

Basal epithelial compartment

Papillary connective tissue

Deep connective tissue

IIF

MMP-1

+

+

MMP-10

++

++

++

TIMP-1

++

+++

ISH

MMP-1

+

+

+

+

++

++

MMP-10

++

+

+

++

+

+++

TIMP-1

+

+

+

++

+++

+++

Relative expression of MMP-1, MMP-10, and TIMP-1 is given on an arbitrary scale (+++ strong, ++ intermediate/variable, + low, no expression)

Quantitative analysis of gene expression

To analyze whether the elevated transcription levels for MMP-1, MMP-10, and TIMP-1 detected by ISH in GO could be quantified, we performed quantitative PCR (qPCR). The measurements were carried out for each patient separately and then pooled for the comparison between normal and GO tissue. Figure 2 shows the relative normalized gene expression levels calculated for MMP-1, MMP-10, and TIMP-1 in GO to that in matched normal tissue. This calculation demonstrated a 1.97-fold increase in gene expression for MMP-1, a 2.3-fold increase for MMP-10, and a significantly elevated 4.8-fold gene expression for TIMP-1 (*P<0.05) in GO. The elevated gene expression ratios in GO, obtained from qPCR, were in agreement with the qualitative data from ISH.
Fig. 2

Differences in relative gene expression levels in four patients each for MMP-1, MMP-10, and TIMP-1 between gingival overgrown tissue and matched normal tissue, as analyzed by quantitative RT-PCR. Housekeeping genes (HKG; GAPDH, YHWAZ, HMBS, HPRT1, ACTB; Vandesompele et al. 2002) were tested for their expression stability, and a weighted expression index was calculated on the basis of the expression data of the three most stable HKG (GAPDH, HPRT1, HMBS). The target gene expression level was normalized to this index and calculated on the basis of a modification of the ΔΔCT equation and statistical evaluation, which allowed counting for differences in efficiencies (E=10−1/slope) between the PCRs by using REST software. To compare the expression level between normal and CsA-affected gingiva, individual results were pooled and plotted as the x-fold difference between both groups. *P<0.05

IIF discriminates normal from CsA-induced gingival overgrown tissue

We next assessed the expression and immunolocalization of MMP-1, MMP-10, and TIMP-1 in normal and GO tissue by IIF. Generally, normal gingival papillary and deep connective tissue, displayed no specific fluorescence signals for MMP-1 (Fig. 3a,a1), MMP-10 (Fig. 3c,c1), and TIMP-1 (Fig. 3e,e1). Moreover, for all three molecules, this lack of protein also applied for the epithelial compartment, suggesting that the detectable transcripts were not translated into protein. In GO, IIF revealed a specific fluorescence signal, indicating low MMP-1 protein expression in papillary and deep connective tissue (Fig. 3b,b1). GO displayed intermediate protein expression for MMP-10. In accordance with the spatial distribution of the transcripts, MMP-10 immunolocalization was found in the basal cells of the epithelial compartment and in the connective tissue (Fig. 3d,d1). Concerning TIMP-1, the protein remained undetectable in the entire epithelium, whereas intermediate expression was noted in the papillary and regionally strong expression was found in the deeper regions of the connective tissue of overgrown gingiva (Fig. 3f,f1).
Fig. 3

Protein expression detected by indirect immunofluorescence (IIF) in frozen sections of normal human gingival tissue (left) and CsA-induced GO (right). In normal control tissue, the proteins for MMP-1 (a, a1), MMP-10 (c, c1), and TIMP-1 (e, e1) remained undetectable. GO displayed low protein levels for MMP-1 in the connective tissue (b, b1; deep connective tissue), and intermediate MMP-10 levels in the epithelial and connective tissue (d, d1; arrows papillary and deep connective tissue). IIF indicated intermediate TIMP-1 protein expression in the papillary and strong expression in the deep connective tissue (f, f1; see arrows). Bars 100 μm

In this regard, an unexpected finding was the discrepancy of the distribution of the mRNA transcripts and the immunolocalization of the protein observed for MMP-1 and TIMP-1 in GO. For both molecules, the predominant site of transcription matched with the localization of the protein, but the minor site of mRNA transcription in the basal epithelial compartment did not. This may indicate that mRNA transcripts synthesized by the gingival fibroblasts render the major source of the corresponding protein, whereas the epithelial mRNA transcripts remain untranslated. The relative expression of the proteins under study is summarized in Table 2.

Discussion

In humans, CsA-induced GO is characterized by a subgingival accumulation of ECM molecules including not only fibrillar collagens COL-1 (Kataoka et al. 2000) and COL-3 (Ceol et al. 2000), but also proteoglycans (Gnoatto et al. 2003). For COL-1 and the COL-1-associated proteoglycan decorin, we have previously shown that an increase in gene expression observed for both molecules may be involved in the causation of this accumulation (B. Dannewitz et al. in preparation).

Based on these findings, we have investigated, in the present study, whether putative changes in molecules that are important for the regulation of ECM turn-over may also contribute to the observed ECM accumulation. Therefore, we have analyzed, at the gene expression and protein level, the matrix metalloproteinases MMP-1 and-10, in conjunction with their inhibitor TIMP-1, by employing frozen sections from GO and matched normal tissue.

Effects of GO on MMP-1

In the present study, ISH and qPCR (1.97-fold increase, see Fig. 2) have demonstrated slightly elevated mRNA levels for MMP-1 in GO, compared with those in normal tissue. In controls, transcripts are predominantly found in basal epithelial cells, whereas in GO, they are pronounced in the papillary and deep connective tissue. Interestingly, in normal gingiva, the protein for MMP-1 remains undetectable, and in GO, IIF has revealed that the protein is exclusively seen in the connective tissue.

So far, no studies in humans are available evaluating the localization and expression of MMP-1 mRNA in native gingiva. However, two in vitro studies on the effects of CsA on gingival fibroblasts have evidenced a slight up-regulation of MMP-1 (Gagliano et al. 2004), but also a decrease in mRNA transcription (Hyland et al. 2003).

In this context, patients with CsA-induced GO sometimes develop inflammation of the gingiva because of increasing bacterial plaque accumulation in the gingival pockets. MMP-1 is an inducible enzyme, and its gene transcription is modulated by several cytokines that play a central role in inflammation (Domeij et al. 2002). MMP-1 mRNA levels have been shown to be significantly increased during the course of gingivitis or periodontitis in human gingival tissue (Aiba et al. 1996; Ejeil et al. 2003). Hence, the increase of MMP-1 mRNA in GO, as shown in our study, may be directly mediated by CsA, which may affect the transcriptional regulation of the MMP-1 gene through transcription factors (Sugano et al. 1998) or may be indirectly induced by inflammatory changes in the tissue.

In agreement with our findings, Thomason et al. (1998) have shown that MMP-1 protein is detectable in connective tissue fibroblasts in tissue specimens derived from patients with CsA-induced GO. The observed discrepancy between the topography of MMP-1 transcripts and protein in GO may result from a post-transcriptional mechanism, leading to the non-translation of the protein in the epithelial compartment. We assume that this mechanism is attributable to the instability of the mRNA thereby implying fast RNA turn-over (for a review, see Day and Tuite 1998).

Effects of GO on MMP-10

Concerning MMP-10, the epithelial compartment of normal and GO tissue displayed fairly comparable transcript intensities. By contrast, MMP-10 mRNA levels were stronger in the deep connective tissue in GO, as indicated by ISH and qPCR (2.3-fold increase, see Fig. 2). Whereas MMP-10 protein remained undetectable in normal tissue, MMP-10 displayed a co-distribution of mRNA and protein in GO.

One possible explanation for the lack of MMP-10 protein in normal tissue could be a regulatory step in translation initiation (Kedersha and Anderson 2002). Therefore, the detected mRNA may represent a reservoir of transcripts, potentially available for translation in case of aberrant tissue situations, e.g., wound healing or inflammation (Kedersha and Anderson 2002). In analogy to our findings, studies on human wound healing have revealed expression of the MMP-10 gene and protein in migrating human keratinocytes; the protein and mRNA are localized not only at the wound margins, but also in the connective tissue (Rechardt et al. 2000). Similar to the connective tissue of normal gingiva, the above-mentioned report on human wound healing demonstrates that normal dermis, further away from the wound, remains consistantly negative for MMP-10 protein (Rechardt et al. 2000). Interestingly, the differential regulation of mRNA transcription and translation of the protein, which we have observed for MMP-10 in normal and aberrant tissues, seems to be generally accepted. This is supported by the study investigating MMP-10 in wound healing of skin (Rechardt et al. 2000) and by a further investigation, but of other proteases, in which mRNAs for MMP-1, -2, and -9 have been detected in the gingival epithelium and connective tissue after wounding, whereas their respective proteins are absent in normal gingiva (Garlick et al. 1996; Makela et al. 1998).

Effects of GO on TIMP-1

An intriguing finding has been that, for TIMP-1 in GO, the tissue displays the strongest elevation in comparison with the other proteases under study, viz., MMP-1 and MMP-10. This is reflected by the TIMP-1 transcripts being excessively present, particularly in the entire subgingival connective tissue. This strong TIMP-1 gene expression has been confirmed by qPCR, indicating a 4.8-fold significant increase (*P<0.05) for the inhibitor (see Fig. 2), when matched with normal tissue. Alhough TIMP-1 gene expression is clearly visible in the epithelial compartment in GO, the protein remains absent, thereby paralleling the situation described above for MMP-1. This also suggests the presence of a post-transcriptional mechanism that is responsible for the lack of TIMP-1 protein in keratinocytes of GO tissue.

In accord with our findings, Stricklin et al. (1993) have shown strong TIMP-1 mRNA intensities in wounded epidermis, whereas the TIMP-1 protein is absent. As here described for GO, several studies on breast tumors have demonstrated enhanced TIMP-1 gene expression levels in the malignant carcinoma, whereas benign tumors and normal breast tissue are devoid of transcription (Yoshiji et al. 1996; Brummer et al. 1999; Nakopoulou et al. 2002). Results, establsihing that CsA has an impact on TIMP-1 expression has so far only been obtained from in vitro experiments, by using cultured human skin fibroblasts (Esposito et al. 2000) and from a rat model (Duymelinck et al. 1998). In both approaches, an increase of TIMP-1 mRNA has been observed. On the other hand, in vitro studies employing human gingival fibroblasts have demonstrated that CsA has no significant effect on TIMP-1 gene expression (Yamaguchi et al. 2004; Gagliano et al. 2004).

Despite these contradictory findings concerning the effects of CsA on cultured cells, we cannot exclude that, in addition to ECM molecules such as COL-1, COL-3, and proteoglycans, the molecules analyzed in the present in vivo study are targets for CsA. The results of our study suggest that TIMP-1 plays an important role in the development of CsA-induced GO. This appears possible, because TIMP-1 is capable of inhibiting MMP-1 and MMP-10 (Woessner 1991; Nakamura et al. 1998) and other proteases involved in gingival tissue remodeling, e.g., MMP-3, which degraded constituents of the basal lamina, such as collagen type IV (Birkedal-Hansen 1993), and MMP-9, which has a similar substrate specificity and which is therefore involved in human periodontitis (Smith et al. 2004). Thus, the elevated levels observed for MMP-1 and MMP-10 in GO may be abrogated by the even more elevated TIMP-1 levels. This abrogation may, in turn, affect the turn-over of subgingival ECM by diminishing the degradation of fibrillar collagens and proteoglycans.

Concluding remarks

We here report for the first time that elevated levels of MMP-1 and MMP-10 and particularly TIMP-1 have been detected in human tissue derived from patients suffering from CsA-induced GO. This elevation becomes particularly visible in the connective tissue and is here applicable to both the gene and protein expression. Except for MMP-10, MMP-1 and TIMP-1 mRNAs seen in GO and normal tissue remain untranslated, suggesting a post-transcriptional regulation. TIMP-1, displaying the strongest elevation, may contribute to GO-associated ECM accumulation, possibly by affecting ECM turn-over through the abolishment of ECM-degrading proteases.

References

  1. Aiba T, Akeno N, Kawane T, Okamoto H, Horiuchi N (1996) Matrix metalloproteinases-1 and -8 and TIMP-1 mRNA levels in normal and diseased human gingivae. Eur J Oral Sci 104:562–569PubMedCrossRefGoogle Scholar
  2. Amano S, Ogura Y, Akutsu N, Matsunaga Y, Kadoya K, Adachi E, Nishiyama T (2005) Protective effect of matrix metalloproteinase inhibitors against epidermal basement membrane damage: skin equivalents partially mimic photoageing process. Br J Dermatol 153 (Suppl 2):37–46PubMedCrossRefGoogle Scholar
  3. Bartold PM, Walsh LJ, Narayanan AS (2000) Molecular and cell biology of the gingiva. Periodontology 2000:28–55CrossRefGoogle Scholar
  4. Bennet JA, Christian JM (1982) Cyclosporin-induced gingival hyperplasia. A case report and literature review. J Am Dent Assoc 111:272–273Google Scholar
  5. Birkedal-Hansen H (1993) Role of matrix metalloproteinases in human periodontal diseases. J Periodontol 64 (5 Suppl):474–484PubMedGoogle Scholar
  6. Bolzani G, Della Coletta R, Martelli H Jr, Graner E (2000) Cyclosporin A inhibits production and activity of matrix metalloproteinases by gingival fibroblasts. J Periodontal Res 35:51–58PubMedCrossRefGoogle Scholar
  7. Braissant O, Wahli W (1998) Differential expression of peroxisome proliferator-activated receptor-alpha, -beta, and -gamma during rat embryonic development. Endocrinology 139:2748–2754PubMedCrossRefGoogle Scholar
  8. Brummer O, Athar S, Riethdorf L, Loning T, Herbst H (1999) Matrix-metalloproteinases 1, 2, and 3 and their tissue inhibitors 1 and 2 in benign and malignant breast lesions: an in situ hybridization study. Virchows Arch 435:566–573PubMedCrossRefGoogle Scholar
  9. Ceol M, Anglani F, Vianello D, Murer L, Del Prete D, Forino M, Favaro S, Gambaro G, D’Angelo A (2000) Direct effect of chronic cyclosporine treatment on collagen III mRNA expression and deposition in rat kidneys. Clin Nephrol 53:8–9PubMedGoogle Scholar
  10. Day DA, Tuite MF (1998) Post-transcriptional gene regulatory mechanisms in eukaryotes: an overview. J Endocrinol 157:361–371PubMedCrossRefGoogle Scholar
  11. Domeij H, Yucel-Lindberg T, Modeer T (2002) Signal pathways involved in the production of MMP-1 and MMP-3 in human gingival fibroblasts. Eur J Oral Sci 110:302–306PubMedCrossRefGoogle Scholar
  12. Domeij H, Modeer T, Yucel-Lindberg T (2004) Matrix metalloproteinase-1 and tissue inhibitor of metalloproteinase-1 production in human gingival fibroblasts: the role of protein kinase C. J Periodontal Res 39:308–314PubMedCrossRefGoogle Scholar
  13. Duymelinck C, Deng JT, Dauwe SE, De Broe ME, Verpooten GA (1998) Inhibition of the matrix metalloproteinase system in a rat model of chronic cyclosporine nephropathy. Kidney Int 54:804–818PubMedCrossRefGoogle Scholar
  14. Egeblad M, Werb Z (2002) New functions for the matrix metalloproteinases in cancer progression. Nat Rev Cancer 2:161–174PubMedCrossRefGoogle Scholar
  15. Ejeil AL, Igondjo-Tchen S, Ghomrasseni S, Pellat B, Godeau G, Gogly B (2003) Expression of matrix metalloproteinases (MMPs) and tissue inhibitors of metalloproteinases (TIMPs) in healthy and diseased human gingiva. J Periodontol 74:188–195PubMedCrossRefGoogle Scholar
  16. Esposito C, Fornoni A, Cornacchia F, Bellotti N, Fasoli G, Foschi A, Mazzucchelli I, Mazzullo T, Semeraro L, Dal Canton A (2000) Cyclosporine induces different responses in human epithelial, endothelial and fibroblast cell cultures. Kidney Int 58:123–130PubMedCrossRefGoogle Scholar
  17. Fornoni A, Cornacchia F, Howard GA, Roos BA, Striker GE, Striker LJ (2001) Cyclosporin A affects extracellular matrix synthesis and degradation by mouse MC3T3-E1 osteoblasts in vitro. Nephrol Dial Transplant 16:500–505PubMedCrossRefGoogle Scholar
  18. Gagliano N, Moscheni C, Dellavia C, Torri C, Stabellini G, Ferrario VF, Gioia M (2004) Effect of cyclosporin A on human gingival fibroblast collagen turnover in relation to the development of gingival overgrowth: an in vitro study. Biomed Pharmacother 58:231–238PubMedCrossRefGoogle Scholar
  19. Garlick JA, Parks WC, Welgus HG, Taichman LB (1996) Re-epithelialization of human oral keratinocytes in vitro. J Dent Res 75:912–918PubMedGoogle Scholar
  20. Gnoatto N, Lotufo RF, Toffoletto O, Marquezini MV (2003) Gene expression of extracellular matrix proteoglycans in human cyclosporin-induced gingival overgrowth. J Periodontol 74:1747–1753PubMedCrossRefGoogle Scholar
  21. Gomez DE, Alonso DF, Yoshiji H, Thorgeirsson UP (1997) Tissue inhibitors of metalloproteinases: structure, regulation and biological functions. Eur J Cell Biol 74:111–122PubMedGoogle Scholar
  22. Hyland PL, Traynor PS, Myrillas TT, Marley JJ, Linden GJ, Winter P, Leadbetter N, Cawston TE, Irwin CR (2003) The effects of cyclosporin on the collagenolytic activity of gingival fibroblasts. J Periodontol 74:437–445PubMedCrossRefGoogle Scholar
  23. Kataoka M, Shimizu Y, Kunikiyo K, Asahara Y, Yamashita K, Ninomiya M, Morisaki I, Ohsaki Y, Kido JI, Nagata T (2000) Cyclosporin A decreases the degradation of type I collagen in rat gingival overgrowth. J Cell Physiol 182:351–358PubMedCrossRefGoogle Scholar
  24. Kedersha N, Anderson P (2002) Stress granules: sites of mRNA triage that regulate mRNA stability and translatability. Biochem Soc Trans 30:963–969PubMedGoogle Scholar
  25. Kelly EA, Jarjour NN (2003) Role of matrix metalloproteinases in asthma. Curr Opin Pulm Med 9:28–33, ReviewPubMedCrossRefGoogle Scholar
  26. Makela M, Sorsa T, Uitto VJ, Salo T, Teronen O, Larjava H (1998) The effects of chemically modified tetracyclines (CMTs) on human keratinocyte proliferation and migration. Adv Dent Res 12:131–135PubMedCrossRefGoogle Scholar
  27. Margiotta V, Pizzo I, Pizzo G, Barbaro A (1996) Cyclosporin- and nifedipine-induced gingival overgrowth in renal transplant patients: correlations with periodontal and pharmacological parameters, and HLA-antigens. J Oral Pathol Med 25:128–134PubMedCrossRefGoogle Scholar
  28. Mariani G, Calastrini C, Carinci F, Marzola R, Calura G (1993) Ultrastructural features of cyclosporine A-induced gingival hyperplasia. J Periodontol 64:1092–1097PubMedGoogle Scholar
  29. Mariani G, Calastrini C, Aleotti A, Carnevale E, Stabellini G (2004) Ultrastructural changes in Langerhans cells in gingival overgrowth in cyclosporin A-treated renal transplant patients. Pathology 36:242–246PubMedCrossRefGoogle Scholar
  30. Murphy G, Cockett MI, Stephens PE, Smith BJ, Docherty AJ (1987) Stromelysin is an activator of procollagenase. A study with natural and recombinant enzymes. Biochem J 248:265–268PubMedGoogle Scholar
  31. Nakopoulou L, Giannopoulou I, Stefanaki K, Panayotopoulou E, Tsirmpa I, Alexandrou P, Mavrommatis J, Katsarou S, Davaris P (2002) Enhanced mRNA expression of tissue inhibitor of metalloproteinase-1 (TIMP-1) in breast carcinomas is correlated with adverse prognosis. J Pathol 197:307–313PubMedCrossRefGoogle Scholar
  32. Nagase H, Woessner JF Jr (1999) Matrix metalloproteinases. J Biol Chem 274:21491–21494PubMedCrossRefGoogle Scholar
  33. Nakamura H, Fujii Y, Ohuchi E, Yamamoto E, Okada Y (1998) Activation of the precursor of human stromelysin 2 and its interactions with other matrix metalloproteinases. Eur J Biochem 253:67–75PubMedCrossRefGoogle Scholar
  34. Nicholson R, Murphy G, Breathnach R (1989) Human and rat malignant-tumor-associated mRNAs encode stromelysin-like metalloproteinases. Biochemistry 28:5195–5203PubMedCrossRefGoogle Scholar
  35. Pfaffl MW, Horgan GW, Dempfle L (2002) Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res 30:e36PubMedCrossRefGoogle Scholar
  36. Rechardt O, Elomaa O, Vaalamo M, Paakkonen K, Jahkola T, Hook-Nikanne J, Hembry RM, Hakkinen L, Kere J, Saarialho-Kere U (2000) Stromelysin-2 is upregulated during normal wound repair and is induced by cytokines. J Invest Dermatol 115:778–787PubMedCrossRefGoogle Scholar
  37. Reynolds JJ (1996) Collagenases and tissue inhibitors of metalloproteinases: a functional balance in tissue degradation. Oral Dis 2:70–76PubMedCrossRefGoogle Scholar
  38. Seymour RA, Jacobs DJ (1992) Cyclosporin and the gingival tissues. J Clin Periodontol 19:1–11PubMedCrossRefGoogle Scholar
  39. Shevach EM (1985) The effects of cyclosporin A on the immune system. Annu Rev Immunol 3:397–423PubMedCrossRefGoogle Scholar
  40. Smith PC, Munoz VC, Collados L, Oyarzun AD (2004) In situ detection of matrix metalloproteinase-9 (MMP-9) in gingival epithelium in human periodontal disease. J Periodontal Res 39:87–92PubMedCrossRefGoogle Scholar
  41. Somacarrera ML, Hernandez G, Acero J, Moskow BS (1994) Factors related to the incidence and severity of cyclosporin-induced gingival overgrowth in transplant patients. A longitudinal study. J Periodontol 65:671–675PubMedGoogle Scholar
  42. Spolidorio LC, Spolidorio DM, Holzhausen M (2004) Effects of long-term cyclosporin therapy on the periodontium of rats. J Periodontal Res 39:257–262PubMedCrossRefGoogle Scholar
  43. Sternlicht MD, Werb Z (2001) How matrix metalloproteinases regulate cell behavior. Annu Rev Cell Dev Biol 17:463–516PubMedCrossRefGoogle Scholar
  44. Stricklin GP, Li L, Jancic V, Wenczak BA, Nanney LB (1993) Localization of mRNAs representing collagenase and TIMP in sections of healing human burn wounds. Am J Pathol 143:1657–1666PubMedGoogle Scholar
  45. Sugano N, Ito K, Murai S (1998) Cyclosporin A inhibits collagenase gene expression via AP-1 and JNK suppression in human gingival fibroblasts. J Periodontal Res 33:448–452PubMedCrossRefGoogle Scholar
  46. Thomason JM, Sloan P, Seymour RA (1998) Immunolocalization of collagenase (MMP-1) and stromelysin (MMP-3) in the gingival tissues of organ transplant patients medicated with cyclosporin. J Clin Periodontol 25:554–560PubMedCrossRefGoogle Scholar
  47. Tomakidi P, Stark HJ, Herold-Mende C, Bosch FX, Steinbauer H, Fusenig NE, Breitkreutz D (2003) Discriminating expression of differentiation markers evolves in transplants of benign and malignant human skin keratinocytes through stromal interactions. J Pathol 200:298–307PubMedCrossRefGoogle Scholar
  48. Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F (2002) Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 3:0034.1–0034.11CrossRefGoogle Scholar
  49. Visse R, Nagase H (2003) Matrix metalloproteinases and tissue inhibitors of metalloproteinases: structure, function, and biochemistry. Circ Res 92:827–839PubMedCrossRefGoogle Scholar
  50. Windsor LJ, Grenett H, Birkedal-Hansen B, Bodden MK, Engler JA, Birkedal-Hansen H (1993) Cell type-specific regulation of SL-1 and SL-2 genes. Induction of the SL-2 gene but not the SL-1 gene by human keratinocytes in response to cytokines and phorbolesters. J Biol Chem 268:17341–173417PubMedGoogle Scholar
  51. Woessner JF Jr (1991) Matrix metalloproteinases and their inhibitors in connective tissue remodeling. FASEB J 5:2145–54, ReviewPubMedGoogle Scholar
  52. Wysocki GP, Gretzinger HA, Laupacis A, Ulan RA, Stiller CR (1983) Fibrous hyperplasia of the gingiva: a side effect of cyclosporin A therapy. Oral Surg Oral Med Oral Pathol 55:274–278PubMedCrossRefGoogle Scholar
  53. Yamaguchi M, Naruishi K, Yamada-Naruishi H, Omori K, Nishimura F, Takashiba S (2004) Long-term cyclosporin A exposure suppresses cathepsin-B and -L activity in gingival fibroblasts. J Periodontal Res 39:320–326PubMedCrossRefGoogle Scholar
  54. Yoshiji H, Gomez DE, Thorgeirsson UP (1996) Enhanced RNA expression of tissue inhibitor of metalloproteinases-1 (TIMP-1) in human breast cancer. Int J Cancer 69:131–134PubMedCrossRefGoogle Scholar
  55. Zebrowski EJ, Pylypas SP, Odlum O, Johnson RB (1994) Comparative metabolism of 3H-glucosamine by fibroblast populations exposed to cyclosporine. J Periodontol 65:565–567PubMedGoogle Scholar

Copyright information

© Springer-Verlag 2006

Authors and Affiliations

  • Bettina Dannewitz
    • 1
  • Christina Edrich
    • 2
  • Pascal Tomakidi
    • 2
  • Annette Kohl
    • 2
  • Olaf Gabbert
    • 3
  • Peter Eickholz
    • 4
  • Thorsten Steinberg
    • 2
  1. 1.Section of Periodontology, Department of Operative Dentistry and Periodontology, Dental SchoolUniversity of HeidelbergHeidelbergGermany
  2. 2.Department of Orthodontics and Dentofacial Orthopaedics, Dental SchoolUniversity of HeidelbergHeidelbergGermany
  3. 3.Department of Prosthodontics, Dental SchoolUniversity of HeidelbergHeidelbergGermany
  4. 4.Department of Periodontology, Center for Dental, Oral, and Maxillofacial MedicineUniversity Hospital FrankfurtFrankfurtGermany

Personalised recommendations