Parasitology Research

, Volume 116, Issue 7, pp 1973–1980 | Cite as

A revision of the genus Aphalloides (Digenea: Cryptogonimidae), parasites of European brackish water fishes

  • Yuriy Kvach
  • Anna Bryjová
  • Pierre Sasal
  • Helmut M. Winkler
Original Paper

Abstract

Trematodes of the genus Aphalloides Dollfus, Chabaud & Golvan, 1957 reach maturity in their second intermediate host, small fishes of the family Gobionellidae, genera Pomatoschistus and Knipowitschia. Two morphologically similar species have been described from European waters: Aphalloides coelomicola Dollfus et al., 1957 in the Mediterranean Sea (including the brackish Black Sea region) and Aphalloides timmi Reimer, 1970 in the Baltic Sea. There was no difference in morphology and morphometry for specimens corresponding to A. coelomicola and A. timmi and examination of the 28S rDNA sequence confirmed the similarity. Based on these results, these two species are synonymized and A. coelomicola redescribed.

Keywords

Aphalloides Taxonomic revision Zoogeography Molecular study 

Introduction

The Cryptogonimidae Ward, 1917 is a digenean family, which parasitize a large variety of poikilothermic vertebrates, both in fresh and marine waters (Miller and Cribb 2008b). Trematodes of genus Aphalloides Dollfus, Chabaud & Golvan, 1957 reach maturity in their second intermediate host such as small fishes of Gobionellidae family (see Thacker 2009), genera Pomatoschistus and Knipowitschia (Dollfus et al. 1957; Naydenova 1970, 1974; Maillard 1973; Vaes 1978; Zander et al. 2000; Zander and Reimer 2002; Kvach and Winkler 2011; Stoyanov et al. 2015). These fishes are both definitive and second intermediate hosts of these worms, but the first intermediate host are mud-snails of Hydrobia group (Maillard 1973; Vaes 1978; Reimer 1970). The adults are located in the coelomic cavity of the host, causing the parasitic castration of the fish (Pampoulie et al. 1999, 2004; Sasal and Pampoulie 2000). The goby hosts are annual fishes (Bouchereau and Guelorget 1998; Mazzoldi et al. 2002), thereafter the parasite life cycle has been shown to require host death (Pampoulie et al. 2000). Apart from gobionellids, only one case of incidental infection of the two-spotted goby (Gobiusculus flavescens (Fabricius, 1779) (Actinopterygii: Gobiidae)) has been recorded in the Flensburg Fjord, Germany (Josten et al. 2009).

There are two morphologically very similar parasite species described from the annual gobies from European waters: Aphalloides coelomicola Dollfus et al., 1957 in the Mediterranean Sea (including brackish-water in the Black Sea region) and Aphalloides timmi Reimer, 1970 in the Baltic Sea (Dollfus et al. 1957; Reimer et al. 1996). A. coelomicola was originally described from the Mediterranean fishes, but also occurs in the Black Sea and Sea of Azov (Dollfus et al. 1957; Naydenova 1974). The status of specimens from the North Sea is unclear: in Dievengat, Belgium, it was recorded as A. coelomicola (Vaes 1978), but in Øra area of Skagerrak, Norway, it was mentioned as A. timmi (Bakke 1980).

The Black Sea and the Baltic Sea present some similarities in their water characteristics. For example, both of these water bodies are much desalinated compared to the other seas (average S = 18‰ in the Black Sea, but 6–8‰ in the Baltic Sea) and are both classified as brackish-water basins (Zenkevich 1963; Dethier 1992). The faunas of both seas have the great group of Boreo-Atlantic species, which are relicts of the ancient Tethys Sea (from Upper Miocene) (Zaitsev and Mamaev 1997). Differing from the Baltic Sea, the Black Sea fauna consists of the group of Ponto-Caspian relicts and Mediterranean species (Zaitsev and Mamaev 1997; Zaitsev 1998). The colonization of the Black Sea by Mediterranean species (a process of Mediterranization) was started about 7000 years ago and occurs until now (Miller 1965; Zaitsev 1998).

Because of morphological similarity of the representatives of Aphalloides genus, the aim of our work was to compare the individuals from different geographical regions (Baltic, Black and Mediterranean seas) to clarify the taxonomic status of the Black Sea samples.

Material and methods

The parasites were sampled in different localities in the Mediterranean Sea (St.-Nazaire and Salse-Leucate lagoons), Black Sea (Budaki Lagoon, Sukhyi Estuary) and Baltic Sea (Salzhaff and Unterwarnow) from different species of Gobionellidae: Pomatoschistus marmoratus (Risso, 1810) and Knipowitschia caucasica (Berg, 1916) from the Black Sea, Pomatoschistus microps (Krøyer, 1838) from the Mediterranean and Baltic seas (Table 1). From each infected fish individual, some of the parasites were fixed in pure 96% ethanol for molecular study, and the others were preserved in hot 4% formaldehyde for morphological study (Cribb and Bray 2010). The formaldehyde-preserved worms were then stained with iron acetic carmine, dehydrated in ethanol of increasing concentration and mounted in Canada balsam as permanent slides (Georgiev et al. 1986). Voucher specimens are deposited in the helminthological collection of the Institute of Parasitology of the Academy of Sciences of the Czech Republic, (České Budějovice, Czech Republic).
Table 1

Samples used for sequencing

Parasite taxa

Host

Sample date

Locality

Country

Aphalloides cf. coelomicola

Knipowitschia caucasica

31.05.2005

Black Sea, Sukhyi Estuary

Ukraine

Aphalloides cf. coelomicola

Pomatoschistus marmoratus

28.07.2008

Black Sea, Budaki Lagoon

Ukraine

Aphalloides cf. coelomicola

Pomatoschistus microps

03.03.2008

Mediterranean Sea, Salse-Leucate Lagoon

France

Aphalloides cf. coelomicola (3 samples)

P. microps

06.03.2008

Mediterranean Sea, St.-Nazaire Lagoon

France

Aphalloides cf. timmi

P. microps

19.07.2010

Baltic Sea, Unterwarnow

Germany

Aphalloides cf. timmi (3 samples)

P. microps

10.06.2008

Baltic Sea, Salzhaff

Germany

Timoniella cf. balthica

Syngnathus typhle

10.06.2008

Baltic Sea, Salzhaff

Germany

Allocanthochasmus sp.

Morone chrysops

15.11.2006

Lake Erie, Oregon, OH

USA

Neochasmus umbellus

M. chrysops

15.11.2006

Lake Erie, Oregon, OH

USA

Anisocoelium capitellatus

Uranoscopus scaber

22.10.2011

Black Sea, Gelendzhik Bay

Russia

Anisocladium fallax

U. scaber

22.10.2011

Black Sea, Gelendzhik Bay

Russia

The DNA from a worm individual from each sample was extracted using the JetQuick kit (Genomed, Germany). The genomic region of 28S rDNA was amplified by KAPA2G Robust HotStart PCR Kit (Kapabiosystems, USA) using primers and annealing temperature detailed in Table 2. Sanger sequencing of PCR products was commercially performed at GATC Biotech (Germany), and sequences were edited and aligned using Geneious 9.0.5 (Kearse et al. 2012). Phylogenetic analysis was based on 28S sequences of 15 newly sequenced individuals. The data of 28S sequences from previous study of Stoyanov et al. (2015)—A. coelomicola, GenBank accession no. KJ162159—were used to compare with 28S sequences from our data.
Table 2

The DNA sites and primers used for sequencing of region 28S

Primer name

Primer sequence

t °C

Reference

LSU5

TAGGTCGACCCGCTGAAYTTAAGCA

57 °C

Littlewood 1994

ECD2

CCTTGGTCCGTGTTTCAAGACGGG

 

Littlewood et al. 1997

D2A

ACAAGTACCGTGAGGGAAAGTTG

56 °C

Nunn 1992

D3B

TCGGAAGGAACCAGCTACTA

 

Nunn 1992

As out-group, the samples of five other cryptogonimid species from own samples were sequenced (see Table 1). Moreover, we used as out-group the sequences of Brachycladium goliath (KR703279), Acanthostomum burminis (KC489791; Jayawardena et al. 2013), Siphoderina jactus (EU571263) and Siphoderina poulini (EU571267; Miller and Cribb 2008a) available online.

The balsam slides were studied under the light microscope Olympus BX50 equipped with phase contrast, differential interference contrast (DIC) and digital image analysis (Olympus MicroImage™ for Windows 95/98/NT 7.0 (Olympus Optical Co.). The length and width of body, oral and ventral suckers, pharynx, ovary, both testes, seminal receptacle, and egg also length of oesophagus were measured to the nearest micrometre.

Results

Molecular study

Bayesian inference analysis based on sequences of 28S rDNA showed strong support for a monophyletic group encompassing genera Timoniella and Aphalloides (posterior probability PP = 0.99) (Fig. 1). The genus Aphalloides was also monophyletic, included all samples from France, Germany and Ukraine, but the support was only PP = 0.89. Within the genus, only little variation was observed for the 28S rDNA, but it seems that specimens ex. Knipowitschia caucasica (samples from Atanasovsko Lake, Bulgaria, and Sukhyi Estuary, Ukraine) differ from samples ex. Pomatoschistus spp. (the latter form supported monophyletic group, PP = 0.99). Sequences from individuals identified previously as A. cf. timmi from Germany are identical to those identified as A. coelomicola from France.
Fig. 1

Phylogenetic trees of Cryptogonimids based on sequences of 28S rDNA

Morphological study

The morphological study of worms from different region did not show differences (Table 3; Fig. 2). The morphometric parameters overlap between worms from different regions and with data from previous authors or original descriptions (see Table 3; Dollfus et al. 1957; Naydenova 1970; Reimer 1970). Based on our observations, we provide a redescription of A. coelomicola as follows:
Table 3

Morphometric parameters of Aphalloides sampled from the different localities

  

France

Ukraine

Germany

  

Our data (n = 16)

Dollfus et al. 1957 (n = 7)

Our data (n = 17)

Naydenova 1970

Our data (n = 20)

Reimer 1970

  

Mean

Min-max

Mean

Mean

Min-max

Min-max

Mean

Min-max

Mean

Min-max

Body

L

1456

347.5–3466

2500

1951

1040–3441

840–3750

2243

707.5–4367

2970

2170–3620

W

540

160–1516

1000

757

399–1367

256–1200

853

192–1291

720

535–950

Oral sucker

L

70

43–114

120

72

55–99

37–83

86

53.5–122

58

38–70

W

69.5

44–115

120

68

50.5–82

37–93

88

50–129.5

58

61–94

Ventral sucker

L

69

34–200

95

72.5

53–100

40–96

77

43–115

68

47–94

W

70

33.5–140

130

87

63–107.5

45–109

91

46–126.5

76

59–90

Pharynx

L

50

27–92

95

56

45–68

34–76

58

33–85

55

47–66

W

49

31–73.5

55

48

41.5–59

31–47

54

32–85

38

26–52

Oesophagus

 

167

66–311

165

163

139–192

93–202

186

13–323

201

108–264

Ovary

L

140

46–237

210

197

131–346

150–265

243

68–316

245

247–318

W

154

77–247.5

390

232

171–344

78–210

243

56–342

277

159–365

Anterior testis

L

287

66–677

500

279

121–429

109–450

368

67–601.5

337

247–475

W

204

55–498

230

162

79.5–282

68–225

253

60–583

229

118–460

Posterior testis

L

259.5

59–500

500

305

223–348.5

112–525

301

88–451

410

294–610

W

188

36.5–464

230

227

127.5–293

81–265

238

87–579

189

141–318

Seminal receptaculum

L

56

44–68

680

101

50–183

239–555

145

44–392

349

224–517

W

54

44–64

600

80

53–123

120–405

94.5

46–206

196

99–282

Egg

L

27

24–30

28

30

26–35

26–31

29

24–32

30

28–34

W

13

11.5–14.5

12

13

10–16

16–17

13

11–15.5

14

13–15

Fig. 2

Aphalloides coelomicola. a ex. Pomatoschistus microps, St.-Nazaire Lagoon. b ex. P. microps, Salzhaff. c Photograph of a speciman ex. Knipowitschia caucasica with vitellin ducts visible. Scale bar 500 μm

Family Cryptogonimidae Ward, 1917.

Genus Aphalloides Dollfus, Chabaud & Golvan, 1957.

Aphalloides coelomicola Dollfus, Chabaud & Golvan, 1957 (Fig. 2).

Synonym: Aphalloides timmi Reimer, 1970

Type host: Pomatoschistus microps (Krøyer, 1838) (Actinopterygii, Gobionellidae).

Other hosts: Pomatoschistus minutus (Pallas, 1770), Pomatoschistus marmoratus (Risso, 1810), Knipowitschia caucasica (Berg, 1916), and Knipowitschia longicaudata (Berg, 1916) (Actinopterygii: Gobionellidae); Incidentally: Gobiusculus flavescens (Fabricius, 1779) (Actinopterygii: Gobiidae).

Type locality: Mediterranean Sea near Banyuls-sur-Mer, France.

Other localities: Mediterranean Sea (Camargue, Salse-Leucate Lagoon, St.-Nazaire Lagoon), Black Sea (Atanasovsko Lake, gulfs of Odessa and Yagorlyk, lagoons and estuaries of the North-Western Black Sea, Sea of Azov), Baltic Sea (Rügen Island, lagoons and bights of South-Western Baltic Sea) and North Sea (Dievengat, Øra area of Skagerrak) (see Fig. 3).
Fig. 3

Confirmed findings of Aphalloides coelomicola in Europe. Mediterranean Sea: 1 Banyuls-sur-Mer (Dollfus et al. 1957), 2 Salse-Leucate and St.-Nazaire lagoons (this study), 3 Vaccarès and Malagroy lagoons, Camargue (Maillard 1973; Bayssade-Dufour and Maillard 1982; Pampoulie et al. 1999, 2000, 2004; Sasal and Pampoulie 2000); Black Sea: 4 Atanasovsko Lake (Stoyanov et al. 2015), 5 Budaki Lagoon (Kvach 2010; this study), 6 Sukhyi Estuary (Kvach 2010; Krasnovyd et al. 2012; this study), 7 Gulf of Odessa (Chernyshenko and Sventsytskaya 1970), 8 Hryhorivsky and Tyligul estuaries (Chernyshenko and Sventsytskaya 1970; Kvach 2010), 9 Berezan Estuary (Chernyshenko and Sventsytskaya 1970), 10 Gulf of Yagorlyk (Naydenova 1974; Parukhin et al. 1983); Sea of Azov (Naydenova 1974): 11 Gulf of Arabat, 12 Obytichna Split, 13 Biryuchy Island, 14 Taman, 15 Gulf of Yeysk; North Sea: 16 Dievengat Pond (Vaes 1978), 17Øra area, Glomma River Estuary (Bakke 1980); Baltic Sea: 18 Flensburg Fjord (Josten et al. 2009), 19 Kiel Bight (Zander et al. 2002; Zander 2005), 20 Lübeck Bight (Zander 2003), 21 Salzhaff (Zander et al. 1999, 2000; Zander and Reimer 2002; this study), 22 Unterwarnow (Kvach and Winkler 2011; this study), 23 Rügen Island (Reimer 1970; Reimer et al. 1996)

Site in host: body cavity, gonads.

Voucher material: D-640 (Helminthological collection of the Institute of Parasitology of Academy of Sciences of the Czech Republic, České Budějovice, Czech Republic).

Representative sequence: KY978885, KY978886, KY978887, and KY978888.

Description:

Body large, elongate, variable in size: 350–3750 × 160–1516. Maximum body width in central part, in second quarter or at the level of ovary. Anterior part tapering, posterior part rounded. Tegument slightly rugose transversally, devoid of spines. Two brown eyespots at level of pharynx.

Oral sucker terminal, slightly elongate transversely, different in shape (from pyriform to globular): 37–122 × 37–130. Ventral sucker subspherical in shape, typically smaller than oral sucker, rarely slightly larger, 34–200 × 34–140. Positioned at level of intestinal bifurcation or slightly posterior, at base of tegumental depression.

Prepharynx absent. Pharynx muscular, thick-walled, elongate-oval, 27–95 × 31–59. Oesophagus different in length, thick-walled, 13–323, usually winding, rarely straight. Intestinal bifurcation in anterior quarter of body. Caeca elongate-saccular, without lateral diverticula, contiguous, winding, terminate blindly just anterior to anterior testis or slightly overlapping it. Sinistral caecum sometime slightly longer than dextral. Excretory pore terminal.

Genital pore located immediately anterior to ventral sucker. Gonotyle absent, cirrus and cirrus-sac absent. Excretory vesicle Y-shaped, reaches posterior margin of ventral sucker or slightly posterior to it. Distal part of seminal vesicle covered by prostatic cells. Seminal vesicle tubular, curved, positioned at middle of body.

Testes two, oval, located at same level, close to posterior extremity of body, one anterior to another, sometime slightly overlapping. Anterior testis 66–677 × 55–583, posterior 59–610 × 37–579. Ovary deeply tri-lobed, 46–346 × 59–365, anterior to testes. Ovary positioned sometime immediately at anterior margin of anterior testis, sometime distanced, almost equatorial. Follicular vitellarium in clusters of follicles arranged in groups, positioned from level of posterior end of ventral sucker to level of testes. Vitelline ducts can form ring surrounding seminal receptacle and/or anterior part of ovary. Uterine seminal receptacle anterior to ovary, oval to circular, usually 44–395 × 44–206, sometime gigantic, 500–680 × 282–600, can partially overlap ovary. Space between ventral sucker and testes usually overfill by uterus with eggs. Uterus tubular, strongly developed, forms numerous loops. Metraterm absent. Eggs small, elongate-oval, 24–35 × 12–17, yellowish-brown, not embryonated.

Discussion

In this work, based on both morphological and molecular data, we consider A. coelomicola and A. timmi as a single species in the monotypic genus Aphalloides. The species has a wide geographical range, which includes brackish waters of the Mediterranean region (including the Black Sea) and the Baltic Sea. The host range is limited by the group of annual gobies of Gobionellidae family. The genus was place in Siphoderinae Manter, 1934, a subfamily of Cryptogonimidae (Dollfus et al. 1957). Naydenova (1970) placed this genus to Heterophyidae, which was later disputed by Bayssade-Dufour and Maillard (1982). Miller and Cribb (2008b) do not recognize subfamilies in Cryptogonimidae, confirming Aphalloides inside this family.

The parasite was first described from the common goby (P. microps) from a small brackish-water canal in Banyuls-sur-Mer in Southern France, leading to the creation of a new genus and a new species (Dollfus et al. 1957). Later, this parasite was confirmed in the lagoons of the Rhone delta (Maillard 1973 and more recently Pampoulie et al. 1999). Maillard (1973) showed that the life cycle of A. coelomicola includes two hosts: a snail host (Hydrobia spp.) as first intermediate host with parthenogenetic stages, and the annual gobies, where metacercariae develop into adults. A progenetic life cycle has been characterized for this species, and the worms start to produce eggs at the metacercarial stage (see Lefebvre and Poulin 2005; Stoyanov et al. 2015).

In the Black Sea, the parasite was first recorded in the 1960s from the marbled goby (P. marmoratus) in the Gulf of Odessa and Tyligul Estuary (Chernyshenko and Sventsytskaya 1970). Naydenova (1970, 1974) found both metacercariae and adults in three goby species (P. marmoratus, Knipowitchia longicaudata and K. caucasica) from the northern Sea of Azov. Also, the adults occurred in Pomatoschistus minutus, P. marmoratus and K. caucasica from different parts of the North-Western Black Sea (Parukhin et al. 1983; Kvach 2010; Krasnovyd et al. 2012). Recently, it was recorded in K. caucasica from brackish Atanasovsko Lake in Bulgaria (Stoyanov et al. 2015).

In the Baltic Sea, the distribution of this species is limited to German coastal waters from the Flensburg Fjord (Josten et al. 2009) to Rügen Island (Reimer et al. 1996), where it is common in two gobiids (P. microps, P. minutus) in Kiel Bight (Zander et al. 2002; Zander 2005), Lübeck Bight (Zander 2003), Salzhaff (Zander et al. 1999) and Unterwarnow (Kvach and Winkler 2011).

Describing the new species A. timmi, Reimer (1970) reported differences relative to A. coelomicola as the ratio of suckers (the ventral sucker is larger than the oral sucker in A. timmi), the size of seminal receptaculum (smaller in A. timmi), and vitelline ducts surrounding the seminal receptacle (absent in A. coelomicola). Studying the specimens from the Øra area of Skagerrak, Norway, Bakke (1980) confirmed the absence of tegumental spines. Later, Miller and Cribb (2008b) mentioned this item as one of the characteristic of the genus Aphalloides.

Stoyanov et al. (2015) provided redescription of this species, based on specimens from K. caucasica. They confirmed the relation of Black Sea specimens to A. coelomicola, noting the smaller sizes of seminal receptacle in comparing to previously described (Dollfus et al. 1957; Naydenova 1970). Also, they noted the morphometrical variability in studied specimens. According to Stoyanov et al. (2015), only the presence of vitellin ducts surrounding the seminal receptacle is discriminating between the two species of Aphalloides. Our study confirmed the presence of these ducts, but they were observed not only in specimens from the Baltic Sea, but also in many specimens from France and Ukraine (see Fig. 2c).

Zander and Reimer (2002) considered this species (noted as A. timmi) to be a brackish-water/marine endemic of the Baltic Sea. But, the type-host of this parasite, the common goby (P. microps), is a Boreal-Atlantic fish, widely distributed from Norway in the north to the Canary Islands in the south, including the Mediterranean and Baltic seas (Miller 1986). Another host of this parasite, the sand goby (P. minutus), has similar range, also inhabiting the Black Sea region (Miller 1986). Taking into account the host specificity of Aphalloides, the presence of endemic parasites in widely distributed host seems unlikely.

In the Black Sea (including the Sea of Azov), A. coelomicola was considered as Mediterranean species (Naydenova 1974; Kvach 2010). The marbled goby (P. marmoratus) is a Mediterranean immigrant, entering the Black Sea fauna about 7000–12,000 years ago (Miller 1965; Zaitsev and Mamaev 1997). So, it seems probable that the parasite migrated with its host. But, taking into account the presence of A. coelomicola in the Baltic and North seas, we can consider A. coelomicola as a Boreal-Atlantic species, which is probably part of a relict fauna (from Upper Miocene) in the Black and Baltic seas. The parasite can use different species of mud-snail of Hydrobia group as first intermediate host. So, for the Mediterranean Sea, Ecrobia ventrosa (Montagu, 1803) is recorded as the snail host (Maillard 1973), but Semisalsa stagnorum (Gmelin, 1791) is mentioned for the Baltic Sea (Vaes 1978; Reimer 1970). According to Zander et al. (2002), in the Baltic Sea, both Peringia ulvae (Pennant, 1777) and E. ventrosa are used by Aphalloides as first intermediate host. Two snails of the Hydrobia group, E. ventrosa and Hydrobia acuta (Draparnaud, 1805), are common in the Black Sea fauna (Butenko 2000; Osikowski et al. 2016). These molluscs are related to a group of the European lagoonal species, distribution today in the region of the old Tethys Sea, including eastwards into the Ponto-Caspian basin, in all European coasts, also to the eastern seaboard of North America (Barnes 1989). The wide distribution of snails of Hydrobia group, especially of E. ventrosa as main host, can support the Boreal-Atlantic status of A. coelomicola.

Notes

Acknowledgements

The study received financial support from the European Centre of Ichthyoparasitology–Centre of Excellence, Grant Agency of the Czech Republic Project No. P505/12/G112. We thank Kevin Roche for English correction.

References

  1. Bakke TA (1980) A scanning electron microscope study of the microtopography of Aphalloides timmi Reimer, 1970 (Digenea; Cryptogonimidae). Fauna Norvegica (Series A) 1:38–44Google Scholar
  2. Barnes RSK (1989) What, if anything, is a brackish-water fauna? Trans Royal Soc Edinburgh (Earth Sci) 80:235–240. doi:10.1017/S0263593300028674 CrossRefGoogle Scholar
  3. Bayssade-Dufour C, Maillard C (1982) Discussion sur la position taxonomique d’Aphalloides coelomicola Dollfus, Chabaud et Golvan, 1957 (Trematoda, Opistorchioidea). Ann Parasitol Hum Comp 57(6):549–553PubMedGoogle Scholar
  4. Bouchereau JL, Guelorget O (1998) Comparison of three Gobiidae (Teleostei) life history strategies over their geographical range. Oceanol Acta 21:503–517. doi:10.1016/S0399-1784(98)80034-0 CrossRefGoogle Scholar
  5. Butenko OI (2000) Molluscs of coastal shallow waters of the Odessa Bay. Ekologiya Morya 52:44–47 (in Russian with English summary)Google Scholar
  6. Chernyshenko AS, Sventsytskaya GA (1970) Sravnitelno-ekologicheskaya kharakteristika gelmintofauny bychkov (sem. Gobiidae) limanov Severo-Zapadnogo Prichernomorya i Odesskogo zaliva [Comparative ecological characteristic of helminth fauna of gobies (fam. Gobiidae) of lagoons of North-Western Black Sea region and the Gulf of Odessa]. In: Voprosy morskoy parazitologii [Issues of marine parasitology]. Naukova Dumka, Kiev, pp 135–137 (in Russian)Google Scholar
  7. Cribb TH, Bray RA (2010) Gut wash, body soak, blender and heat-fixation: approaches to the effective collection, fixation and preservation of trematodes of fishes. Syst Parasitol 76:1–7. doi:10.1007/s11230-010-9229-z CrossRefPubMedGoogle Scholar
  8. Dethier MN (1992) Classifying marine and estuarine natural communities: an alternative to the coward in system. J Nat Areas 12:90–100Google Scholar
  9. Dollfus RP, Chabaud AG, Golvan YJ (1957) Helminthes de la région de Banyuls. V. Nouveau Distome Aphalloïdes coelomicola n. gen. n. sp. de la cavité générale d’un Gobius d’eau saumâtre. Annales de Parasitologie 32:29–40Google Scholar
  10. Georgiev B, Biserkov V, Genov T (1986) In toto staining method for cestodes with iron acetocarmine. Helminthologia 23:279–281Google Scholar
  11. Jayawardena UA, Tkach VV, Navaratne AN, Amerasinghe PH, Rajakaruna RS (2013) Malformations and mortality in the Asian common toad induced by exposure to pleurolophocercous cercariae (Trematoda: Cryptogonimidae). Parasitol Int 62(3):246–252. doi:10.1016/j.parint.2013.01.003 CrossRefPubMedGoogle Scholar
  12. Josten N, Detloff KC, Zander CD (2009) Analysis of a parasite supra community from the Flensburg fjord. Parasitol Res 104:449–461. doi:10.1007/s00436-008-1218-7 CrossRefPubMedGoogle Scholar
  13. Krasnovyd V, Kvach Y, Drobiniak O (2012) The parasite fauna of the gobiid fish (Actinopterygii, Gobiidae) in the Sykhyi Lyman, Black Sea. Vestnik Zoologii 46(6):483–490. doi:10.2478/v10058-012-0041-x CrossRefGoogle Scholar
  14. Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A, Markowitz S, Duran C, Thierer T, Ashton B, Mentjies P, Drummond A (2012) Geneious basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28(12):1647–1649. doi:10.1093/bioinformatics/bts199 CrossRefPubMedPubMedCentralGoogle Scholar
  15. Kvach Y (2010) Helminths of the marbled goby (Pomatoschistus marmoratus), a Mediterranean immigrant in the Black Sea fauna. Vestnik Zoologii 44(6):509–518. doi:10.2478/v10058-010-0034-6 CrossRefGoogle Scholar
  16. Kvach Y, Winkler HM (2011) The colonization of the invasive round goby Neogobius melanostomus by parasites in new localities in the southwestern Baltic Sea. Parasitol Res 109(3):769–780. doi:10.1007/s00436-011-2321-8 CrossRefPubMedGoogle Scholar
  17. Lefebvre F, Poulin R (2005) Progenesis in digenean trematodes: a taxonomic and synthetic overview of species reproducing in their second intermediate hosts. Parasitology 130:587–605. doi:10.1017/S0031182004007103 CrossRefPubMedGoogle Scholar
  18. Littlewood DTJ, Rohde K, Clough KA (1997) Parasite speciation within or between host species?—Phylogenetic evidence from site-specific polystome monogeneans. Int J Parasitol 27:1289–1297. doi:10.1016/S0020-7519(97)00086-6 CrossRefPubMedGoogle Scholar
  19. Littlewood DTJ (1994) Molecular phylogenetics of cupped oysters based on partial 28S rRNA gene sequences. Mol Phylogenet Evol 3(3):221–229. doi:10.1006/mpev.1994.1024 CrossRefPubMedGoogle Scholar
  20. Maillard C (1973) Mise en évidence du cycle évolutif abrégé d'Aphalloïdes coelomicola Dollfus, Chabaud et Golvan, 1957 (trematoda). Notion d'hôte historique. CR Acad Scie Paris (Sér D) 277:317–320Google Scholar
  21. Mazzoldi C, Poltronieri C, Rasotto MB (2002) Egg size variability and mating system in the marbled goby Pomatoschistus marmoratus (Pisces: Gobiidae). Mar Ecol Prog Ser 233:231–239. doi:10.3354/meps233231 CrossRefGoogle Scholar
  22. Miller PJ (1965) Relictogobius kryzhanovskii and the penetration of Mediterranean gobies into the Black Sea. Nature 208:474–475. doi:10.1038/208474a0 CrossRefGoogle Scholar
  23. Miller PJ (1986) Gobiidae. In: Whitehead PJP, Bauchot M-L, Hureau J-C, Nielsen J, Tortonese E (eds) Fishes of the North-eastern Atlantic and the Mediterranean, volume 3. UNESCO, Paris, pp 1019–1085Google Scholar
  24. Miller TL, Cribb TH (2008a) Eight new species of Siphoderina Manter, 1934 (Digenea, Cryptogonimidae) infecting Lutjanidae and Haemulidae (Perciformes) off Australia. Acta Parasitol 53(4):344–364. doi:10.2478/s11686-008-0053-4 CrossRefGoogle Scholar
  25. Miller TL, Cribb TH (2008b) Family Cryptogonimidae Ward, 1917. In: Bray RA, Gibson DI, Jones A (eds) Keys to the Trematoda, Vol. 3. CAB International, Wallingford, pp 51–112Google Scholar
  26. Naydenova NN (1970) K sistematicheskomu polozheniju Aphalloides coelomicola Dollfus, Chabaud et Golvan, 1958 [to systematic position of Aphalloides coelomicola Dollfus, Chabaud et Golvan, 1958]. Biologiya Morya (Kiev) 20:74–84 (in Russian)Google Scholar
  27. Naydenova NN (1974) Parazitofauna ryb semeystva Gobiidae Chernogo i Azovskogo morey [the parasite fauna of fishes of Gobiidae Family in the Black Sea and the sea of Azov]. Naukova Dumka, Kiev, p 182 (in Russian)Google Scholar
  28. Nunn G (1992) Nematode molecular evolution. An investigation of evolutionary patterns among nematodes based upon DNA sequences. PhD dissertation, University of Nottingham, UKGoogle Scholar
  29. Osikowski A, Hofman S, Georgiev D, Kalcheva S, Falniowski A (2016) Aquatic snails Ecrobia maritima (Milaschewitsch, 1916) and E. ventrosa (Montagu, 1803) (Caenogastropoda: Hydrobiidae) in the East Mediterranean and Black Sea. Annales Zoologici 66:477–486. doi:10.3161/00034541ANZ2016.66.3.012 CrossRefGoogle Scholar
  30. Pampoulie C, Lambert A, Rosecchi E, Crivelli AJ, Bouchereaut J-L, Morand S (2000) Host death: a necessary condition for the transmission of Aphalloides coelomicola Dollfus, Chabaud, and Golvan, 1957 (Digenea, Cryptogonimidae)? J Parasitol 86(2):416–417. doi:10.1645/0022-3395(2000)086[0416:HDANCF]2.0.CO;2 CrossRefPubMedGoogle Scholar
  31. Pampoulie C, Morand S, Lambert A, Rosecchi E, Bouchereaut J-L, Crivelli AJ (1999) Influence of the trematode Aphalloïdes cœlomicola Dollfus, Chabaud & Golvan, 1957 on the fecundity and survival of Pomatoschistus microps (Krøyer, 1838) (Teleostei: Gobiidae). Parasitology 119:61–67. doi:10.1017/S0031182099004412 CrossRefPubMedGoogle Scholar
  32. Pampoulie C, Rosecchi E, Bouchereaut J-L, Crivelli AJ (2004) Do environmental changes influence the occurrence and effect of parasites? J Negat Results: Ecol Evol Biol 1:8–15Google Scholar
  33. Parukhin AM, Machkevskiy VK, Ilchenko SV (1983) Osobennosti gelmintofauny ryb Yagorlytskogo zaliva [the characteristics of the helminth fauna of fish of the Gulf of Yahorlyk]. Vestnik Zoologii 1:33–37 (in Russian)Google Scholar
  34. Reimer L (1970) Digene Trematoden und Cestoden der Ostseefische als natürliche Fischmarken. Parasitologische SchriftenReiche 20:1–144Google Scholar
  35. Reimer LW, Hildebrand A, Scharberth D, Walter U (1996) Trematodes of the brackish waters of the Baltic Sea and their distribution together with that of related species in other European areas. Appl Parasitol 37:177–185Google Scholar
  36. Sasal P, Pampoulie C (2000) Asymmetry, reproductive success and parasitism of Pomatoschistus microps in a French lagoon. J Fish Biol 57:382–390. doi:10.1111/j.1095-8649.2000.tb02178.x Google Scholar
  37. Stoyanov B, Neov B, Pankov P, Radoslavov G, Hristov P, Georgiev BB (2015) Redescription of Aphalloides coelomicola Dollfus, Chabaud & Golvan, 1957 (Digenea, Opisthorchioidea) based on specimens from Knipowitschia caucasica (Berg) (Actinopterygii, Gobionellidae) from a Black Sea lagoon, with comments on the systematic position of the genus. Syst Parasitol 91:1–12. doi:10.1007/s11230-015-9559-y CrossRefPubMedGoogle Scholar
  38. Thacker CE (2009) Phylogeny of Gobioidei and placement within Acanthomorpha, with a new classification and investigation of diversification and character evolution. Copeia 2009(1):93–104. doi:10.1643/CI-08-004 CrossRefGoogle Scholar
  39. Vaes M (1978) Infection of the common goby, Pomatoschistus microps, with Aphalloides coelomicola (Trematoda Digenea). Vlaams Diergeneeskundig Tijdschrift 47(3):274–278Google Scholar
  40. Zaitsev Y, Mamaev V (1997) Biological diversity in the Black Sea: a study of change and decline. UN Publication, New York, p 208Google Scholar
  41. Zaitsev YP (1998) The most blue sea in the world. UN Publication, New York, p 142 (in Russian)Google Scholar
  42. Zander CD (2003) Four-year monitoring of parasite communities in gobiid fishes of the south-western Baltic. I. Guild and component community. Parasitol Res 90:502–511. doi:10.1007/s00436-003-0887-5 CrossRefPubMedGoogle Scholar
  43. Zander CD (2005) Comparative studies on goby (Teleostei) parasite communities from the North and Baltic Sea. Parasitol Res 96:62–68. doi:10.1007/s00436-005-1327-5 CrossRefPubMedGoogle Scholar
  44. Zander CD, Koçoglu O, Skroblies M, Strohbach U (2002) Parasite populations and communities from the shallow littoral of the Orther Bight (Fehmarn, SW Baltic Sea). Parasitol Res 88:734–744. doi:10.1007/s00436-002-0652-1 CrossRefPubMedGoogle Scholar
  45. Zander CD, Reimer LW (2002) Parasitism at the ecosystem level in the Baltic Sea. Parasitology 124:S119–S135. doi:10.1017/S0031182002001567 CrossRefPubMedGoogle Scholar
  46. Zander CD, Reimer LW, Barz K (1999) Parasite communities of the Salzhaff (Northwest Mecklenburg, Baltic Sea). I. Structure and dynamics of communities of littoral fish, especially small-sized fish. Parasitol Res 85:356–372. doi:10.1007/s004360050562 CrossRefPubMedGoogle Scholar
  47. Zander CD, Reimer LW, Barz K, Dietel G, Strohbach U (2000) Parasite communities of the Salzhaff (Northwest Mecklenburg, Baltic Sea). II. Guild communities, with special regard to snails, benthic crustaceans, and small-sized fish. Parasitol Res 86:359–372. doi:10.1007/s004360050681
  48. Zenkevich LA (1963) Biologiya morey SSSR [Biology of seas of USSR]. Izdatelsto AN SSSR, Moskva, p 302 (in Russian)Google Scholar

Copyright information

© Springer-Verlag Berlin Heidelberg 2017

Authors and Affiliations

  1. 1.Institute of Vertebrate BiologyCzech Academy of SciencesBrnoCzech Republic
  2. 2.Institute of ParasitologyBiology Centre of the Czech Academy of SciencesČeské BudějoviceCzech Republic
  3. 3.Institute of Marine BiologyNational Academy of Sciences of UkraineOdessaUkraine
  4. 4.UPSL Research University: EPHE-UPVD-CNRSPapetoaiFrench Polynesia
  5. 5.Institute of Biosciences/ZoologyRostock UniversityRostockGermany

Personalised recommendations