Advertisement

Long non-coding RNA H19 promotes glucose metabolism and cell growth in malignant melanoma via miR-106a-5p/E2F3 axis

  • Wenkang Luan
  • Zhou Zhou
  • Xin Ni
  • Yun Xia
  • Jinlong Wang
  • Yulan YanEmail author
  • Bin XuEmail author
Original Article – Cancer Research

Abstract

Purpose

lncRNA H19 has been considered as an oncogenic lncRNA in many human tumours. In the present study, we identify the role and molecular mechanism of lncRNA H19 in melanoma.

Method

QRT-PCR was used to detect the expression of lncRNA H19 and E2F3 was detected in melanoma tissues. Cell counting kit-8 (CCK8), representative metabolites analysis was used to explore the biological function of lncRNA H19, miR-106a-5p and E2F3 in melanoma cells. Bioinformatics, luciferase reporter assays, MS2-RIP and RNA pull-down assay was used to demonstrate the molecular mechanism of lncRNA H19 in melanoma. We further test the function of lncRNA H19 in vivo though Xenograft tumour assay.

Results

We found that lncRNA H19 was increased in melanoma tissue, and lncRNA H19 was correlated with poor prognosis of melanoma patients. miR-106a-5p acts as a tumour suppressor in melanoma by targeting E2F3. E2F3 affects the melanoma cell glucose metabolism and growth. We also demonstrated that lncRNA H19 may function as the sponge of miR-106a-5p to up-regulate E2F3 expression, and consequently promote the glucose metabolism and growth of melanoma.

Conclusions

This result elucidates a new mechanism for lncRNA H19 in melanoma development and provides a survival indicator and potential therapeutic target for melanoma patients.

Keywords

Melanoma Glucose metabolism LncRNA H19 MiR-106a-5p E2F3 

Introduction

In recent years, the alteration of energy metabolism has been listed as 1 of the 10 new hallmarks of cancer. (Hanahan and Weinberg 2011). Unlike normal differentiated cells, tumour cells exhibit increased metabolism of glucose to lactate both under aerobic and anaerobic conditions, and this phenomenon is known as the Warburg effect (aerobic glycolysis) (Vander Heiden et al. 2009). Aerobic glycolysis is important for the self-repair and proliferation of tumour cells. (Vander Heiden et al. 2009). Malignant melanoma is the most aggressive type of skin tumours, with an increasing global incidence in recent years (Millet et al. 2017; Little and Eide 2012). Melanoma cells also exhibit the Warburg effect (Scott et al. 2011), but few studies have investigated melanoma cell metabolism.

Non-coding RNAs (ncRNAs), a kind of gene regulatory effector molecules, have been found to serve as important players in the initiation and development of tumours, including melanoma (Hauptman and Glavac 2013; Hombach and Kretz 2013; Luan et al. 2016). Long non-coding RNAs (lncRNAs), a class of non-coding RNAs that are longer than 200 nucleotides, play critical roles in cancer biology and act as diagnostic or prognostic markers for many human tumours (Wang and Chang 2011; Gupta et al. 2010). lncRNAs are also involved in melanoma progression (Luan et al. 2016; Schmidt et al. 2016), but the function of only a few lncRNAs in melanoma has been identified.

lncRNA H19 is transcribed from the imprinted gene H19 and has been considered as an oncogenic lncRNA in glioma, hepatocellular carcinoma, and bladder carcinoma, among others. (Berteaux et al. 2005; Lv et al. 2014; Shi et al. 2014; Liu et al. 2016). Some studies have shown that the H19 gene is differentially expressed in melanoma (Soares et al. 2010). However, the role and molecular mechanism of lncRNA H19 in melanoma has not been reported yet. In this study, we discovered that the expression of lncRNA H19 was increased in melanoma tissues and that lncRNA H19 level was correlated with poor prognosis in melanoma patients. miR-106a-5p acts as a tumour suppressor in melanoma by targeting E2F3 (a member of the E2F transcription factor family). E2F transcription factors can regulate the growth of tumour cells by affecting cellular glucose metabolism (Tech et al. 2015). Furthermore, we demonstrated that lncRNA H19 may function as a sponge of miR-106a-5p to up-regulate E2F3 expression and consequently promote glucose metabolism and growth in melanoma cells. Thus, lncRNA H19 serves as a survival indicator and potential therapeutic target for melanoma patients.

Methods

Human tissues

A cohort of 30 primary malignant melanoma tissues and adjacent normal tissues were collected from melanoma patients at The Affiliated People’s Hospital of Jiangsu University. No patients received chemotherapy or radiotherapy before surgery, and the samples are stored in liquid nitrogen immediately after collection. Two pathologists diagnosed the clinical pathological features of the tissue. The study was approved by the Human Research Ethics Committee of the Affiliated People’s Hospital of Jiangsu University.

Cell lines and cell culture

The human malignant melanoma cell line A375 was obtained from Chinese Academy of Sciences Cell Bank (Shanghai, China), and the human malignant melanoma cell lines SK-MEL-1 and SK-MEL-5 were obtained from American-Type Culture Collection (ATCC, USA). The cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Gibco, USA), added 10% foetal bovine serum (Invitrogen, USA) and antibiotics (100 µg/ml streptomycin and 100 U/ml penicillin). The human epidermal melanocytes HEMa-LP was purchased from Invitrogen, and cultured in medium 254 (Cascade Biologics). All cells were maintained in a humidified incubator containing 5% carbon dioxide at 37 °C.

Oligonucleotides

Oligonucleotides were chemically synthesized by GenePharma (Shanghai, China), and sequences were as follows: miR-106a-5p mimic, 5′-AAAAGUGCUUACAGUGCAGGUAG-3′; lncRNA H19-small interfering RNA 1, 5′-CCCACAACAUGAAAGAAACTT-3′; lncRNA H19-small interfering RNA 2, 5′- GCUAGAGGAACCAGACCUUTT-3′; negative control, 5′-UUCUCCGAACGUGUCACGUTT-3′. The miR-106a-5p inhibitor, the related miRNAs, and the siRNA for E2F3 were also chemically synthesized by GenePharma. The oligonucleotides were transfected into cells using Lipofectamine 2000 reagent (Invitrogen, USA).

Cell counting kit-8 (CCK-8) assay

CCK-8 (Beyotime, China) assay was used to assess the proliferative ability of melanoma cells. After 24 h of transfection, the 5000 transfected melanoma cells were added to 96-well plates with 100 µl of culture media. The medium of each well was replaced with 100 µl fresh culture media contained 10% CCK8 at different times (12, 24, 36 and 48 h). The cells were incubated for an additional 3 h. The absorbance was measured using microplate reader (Multiscan FC, Thermo Scientific) at 450 nm wavelength.

Representative metabolites analysis

Glucose and Lactate Assay Kit (Biovision, USA) were used to measure the glucose and lactate level. 2 µl of medium was added into a series of well on a 96-well plate after the cells were transfected for 24 h, and the standard solution was added into the other blank well. 50 µl of the reaction mix were added to each well, and the plates were incubated for an additional 30 min. The absorbance was measured at 570 nm wavelength. The glucose and lactate concentrations were calculated according to the standard curve. We measured each hour and counted the cell within the next 24 h to minimize changes caused by cell proliferation. PicoProbe Lactate Fluorometric Assay Kit (Biovision, USA) was used to detect the level of lactate in animal tumour tissues. ATP contents were determined using respective assay kits purchased from Biovision (Milpitas, USA), and data are presented as a percentage of the control group.

Extraction of RNA and quantitative RT-PCR

TRIzol (Invitrogen, USA) was used to extract total RNA from the cells and tissues. Fermentas reverse transcription reagents and Applied Biosystems® TaqMan® MicroRNA Reverse Transcription Kit (Applied Biosystems, CA) were used to conduct Reverse transcription (RT), and the amplification reaction was performed using the ABI StepOnePlus system (Applied Biosystems, CA) following predetermined conditions. Specific primer for miR-106a-5p was obtained from RiboBio (Guangzhou, China), U6 was used for normalization. The primers: lncRNA H19 forward 5′-TACAACCACTGCACTACCTG-3′ and lncRNA H19 reverse 5′-TGGAATGCTTGAAGGCTGCT-3′; E2F3 forward 5′-CACTTCCACCACCTCCTGTT-3′ and E2F3 reverse 5′-TGACCGCTTTCTCCTAGCTC-3′; GAPDH forward 5′- GTCAACGGATTTGGTCTGTATT-3′ and GAPDH reverse 5′- AGTCTTCTGGGTGGCAGTGAT-3′. The 2−△△Ct method was used to analyze the data.

Western blot analysis

RIPA buffer (KenGEN, China) was used to extract the total protein from cells. The protein concentrations were quantified with BCA Protein Assay Kit (Beyotime, China), and were separated by 10% SDS–PAGE and transferred to PVDF membranes (Millipore, USA). The membrane was blocked by 5% nonfat milk, and incubated overnight with antibodies against E2F3 (1:2000, Abcam, UK), followed by incubation with HRP-conjugated secondary antibody, GAPDH was used as a control (1:2500, Abcam, UK).

Luciferase reporter assay

For luciferase reporter assay, the 3′-UTR fragment of E2F3 containing the putative binding sequences of miR-106a-5p was cloned into pMIR-REPORT vectors. The sequences and the fragment of lncRNA H19 including the miR-106a-5p-binding site were inserted into pMIR-REPORT vectors. The melanoma cells were co-transfected with miR-106a-5p mimic or related miRNAs and reporter constructs, and the mutated plasmid was used as the control. Dual-Luciferase Reporter Assay System (Promega, USA) was used to detect the luciferase activity.

RNA pull-down assay with biotinylated miRNA

Biotinylated miR-106a-5p, biotinylated mutant, and biotinylated NC were synthesized by GenePharma (Shanghai, China). The biotinylated miRNA was transfected into the melanoma cells. The cell lysates were incubated with M-280 streptaviden magnetic beads (Invitrogen, USA) (Subramanian et al. 2015). RT–qPCR was used to detect the lncRNA H19 levels.

MS2-RIP assay

Maltose-binding protein (MBP)-affinity purification was used to identify miRNAs that associated with lncRNA H19. The MS2-MBP protein was expressed and purified from E. coli following the protocol of the Steitz laboratory. Three bacteriophage MS2 coat protein-binding sites (5′-cgtacaccatcagggtacgagctagcccatggc gtacaccatcagggtacgactagtagatctcgtacaccatcagggtacg-3′) were inserted downstream of lncRNA H19 by site-directed mutagenesis using the Stratagene Quik Change Site-Directed Mutagenesis Kit. To obtain miRNAs associated with the MS2-tagged lncRNA H19, the melanoma cell lines were transfected with MS2-tagged lncRNA H19 constructs. Ten million cells were used for each immunoprecipitation assay. At 48 h following transfection, the cells were subjected to RIP analysis as described elsewhere (Luan et al. 2016).

Fluorescence in situ hybridization (FISH)

RNA-FISH was carried out using RiboTM Fluorescent In Situ Hybridization Kit (RiboBio, Guangzhou, China) following the manufacturer’s instructions. Procedures were performed based on a previous study (Liu et al. 2017). The lncRNA H19 probe labeled by Cy3 was designed and synthesized by RiboBio. These slides were counterstained with DAPI. The images were acquired using a confocal microscope.

Xenograft tumour assay and immunohistochemistry staining

Nude mice were obtained from Beijing Laboratory Animal Center (Beijing, China). Three mice were injected subcutaneously with A375 cells. We remove the tumours and cut into pieces of 1–2 mm3 when the tumours were reached 5 mm in length, and reseeded into the hypodermis of 15 mice. The mice were divided into three groups. lncRNA H19 siRNA, miR-106a-5p inhibitor, or NC was intratumorally injected every 3 days. The tumour volume was measured every 3 days. The tumour tissues were stripped and weighed after 27 days. The study was approved by the Experimental Animal Ethics Committee of the Affiliated People’s Hospital of Jiangsu University. Immunohistochemistry staining was performed as described previously (Luan et al. 2015), and tissues sections were incubated with antibodies against E2F3.

Statistical analysis

The data are presented as the mean ± standard error, and SPSS 13.0 software was used to analyze the data. T test or one-way-ANOVA was used to measure the statistical significance. MATLAB was used to perform Pearson correlation analysis. Survival plots were generated by Kaplan–Meier analysis. P < 0.05 was considered to be statistically significant. All experiments were independently performed in triplicate.

Results

lncRNA H19 was increased in melanoma and associated with poor prognosis of patients with melanoma

We initially analyzed the expression of lncRNA H19 in 30 primary malignant melanoma tissues and adjacent normal tissues and found that lncRNA H19 expression was increased in melanoma tissues (Fig. 1a). High expression of lncRNA H19 was associated with the clinical stage of melanoma but not with age, sex, family history, or ulcer (Table 1). Kaplan–Meier analysis was used to access the relationship between lncRNA H19 expression and survival of melanoma patients, and the results showed that high lncRNA H19 expression was associated with poor survival in melanoma patients (Fig. 1b). We also detected lncRNA H19 levels in human melanoma cell lines and human epidermal melanocytes. lncRNA H19 expression was increased in melanoma cell lines (Fig. 1c). These results indicated that lncRNA H19 may be a critical factor in the malignant progression of melanoma.

Fig. 1

lncRNA H19 was increased in melanoma and associated with poor prognosis in patients with melanoma. a lncRNA H19 levels were analyzed in 30 malignant melanoma tissues and adjacent normal tissues. b Overall survival curves of melanoma patients with high lncRNA H19 expression and low lncRNA H19 expression. c lncRNA H19 expression profile in human melanoma cell lines (A375, SK-MEL-1, and SK-MEL-5) and human epidermal melanocytes (HEMa-LP). *P < 0.05, **P < 0.01, ***P < 0.001

Table 1

Correlation between lncRNA H19 expression and clinical pathological characteristic (n = 30)

Clinical characteristics

Number

Low lncRNA H19 expression

High lncRNA H19 expression

P value

Age

   

0.256

 < 50

11

4

7

 

 ≥ 50

19

11

8

 

Gender

   

0.713

 Male

17

9

8

 

 Female

13

6

7

 

Family history

   

0.624

 Yes

5

2

3

 

 No

25

13

12

 

Ulcer

   

1.000

 Yes

18

9

9

 

 No

12

6

6

 

TMN stage

   

< 0.001

 I–II

13

11

2

 

 III

17

4

13

 

lncRNA H19 promotes the glucose metabolism and growth of melanoma cell

We further explored the role of lncRNA H19 in melanoma cells. The level of lncRNA H19 was reduced by siRNA in A375 and SK-MEL-1 cells (Fig. 2a). The CCK8 assay revealed that lncRNA H19 knockdown suppressed the proliferative ability of melanoma cells (Fig. 2b). Decreased lncRNA H19 expression inhibited glucose consumption and reduced lactate levels in melanoma cells (Fig. 2c, d). Meanwhile, the ATP generation was also suppressed in the lncRNA H19 siRNA transfection group (Fig. 2e). These results suggested that lncRNA H19 is critical for glucose metabolism and growth in melanoma cell.

Fig. 2

lncRNA H19 promotes the glucose metabolism and growth of melanoma cell. a Transfection efficiency of si-H19 was determined by PCR. b Proliferative ability of A375 and SK-MEL-1 cells was measured by CCK8 assay. c, d Glucose consumption and lactate production of melanoma cells were measured after the cells were transfected with si-H19 or a negative control. e Relative changes of ATP content in melanoma cells.*P < 0.05, **P < 0.01, ***P < 0.001

lncRNA H19 sponged miR-106a-5p in melanoma cells

Some lncRNAs act as competing endogenous RNAs during tumourigenesis. ceRNAs can bind functional miRNAs and liberate mRNAs targeted by miRNAs, thereby regulating gene expression (Arancio et al. 2014). RNA-FISH results revealed that lncRNA H19 was mainly localized in cytoplasm in melanoma cells and tissues (Supplementary Fig. 1A). Using bioinformatics analysis, 38 miRNAs were found that have possible targets of lncRNA H19 (Supplementary Table 1). Subsequently, luciferase reporter assays were used to determine whether these miRNAs can directly target lncRNA H19. As shown in Fig. 3a, the luciferase activity of lncRNA H19 luciferase reporters was reduced more than 50% in miR-106a-5p mimics transfected group. It suggested that miR-106a-5p is the lncRNA H19-associated miRNA in melanoma cells. The binding site between miR-106a-5p and lncRNA H19 is shown in Fig. 3b. miR-106a-5p levels were increased after silencing lncRNA H19 in melanoma cells (Fig. 3c). Furthermore, miR-106a-5p mimics could decreased lncRNA H19 levels in melanoma cells (Fig. 3d). Moreover, we constructed luciferase reporter plasmids for lncRNA H19 containing predicted wild type and mutant-binding sites for miR-106a-5p and found that miR-106a-5p mimics reduced the luciferase activity of the wild-type plasmid but not that of the mutant plasmid (Fig. 3e). MS2-RIP was used to further validate the direct interaction between miR-106a-5p and lncRNA H19. The precipitated miRNAs were analyzed by real-time PCR. We found that the MS2-tagged wild-type H19 was enriched for miR-106a-5p compared to the empty vector and H19 with a mutation binding site (Fig. 3f). Moreover, we performed an RNA pull-down assay using biotinylated miR-106a-5p and found that lncRNA H19 was pulled down by biotin-labeled miR-106a-5p oligos (Fig. 3g). These results suggested that lncRNA H19 directly binds to miR-106a-5p in melanoma cells.

Fig. 3

lncRNA H19 sponged miR-106a-5p in melanoma cells. a Luciferase reporter assay revealed that miR-106a-5p reduce the luciferase activity of lncRNA H19 luciferase reporters more than 50%. b Putative binding sites of miR-106a-5p on the lncRNA H19 transcript. c Expression levels of miR-106a-5p in melanoma cells following transfection with si-H19 or NC. d Expression levels of lncRNA H19 in melanoma cells following transfection with miR-106a-5p mimic or NC. e miR-106a-5p mimic led to a marked decrease in luciferase activity of pMIR-H19-WT, without any change in luciferase activity of pMIR-H19-MUT in melanoma cells. f MS2-RIP followed by miRNA RT-PCR to detect endogenous miR-106a-5p associated with the MS2-tagged lncRNA H19 transcript. g Melanoma cells transfected with biotin-labeled miR-106a-5p, mutated oligos or biotinylated NC, assayed by biotin-based pull-down after transfection. lncRNA H19 levels were analyzed by RT–qPCR.. *P < 0.05, **P < 0.01, ***P < 0.001

E2F3 is directly targeted by miR-106a-5p

TargetScan was used to search for potential targets of miR-106a-5p. The 3′-UTR of E2F3 shares binding sites for miR-106a-5p with lncRNA H19 (Fig. 4a). We constructed luciferase reporter plasmids containing the wild type and mutant-binding sites of the E2F3 3′-UTR. Luciferase reporter assays showed that the luciferase activity of the wild-type E2F3 3′-UTR-harbouring vector was reduced in the miR-106a-5p mimic group, but no significant changes was observed with the mutant vector (Fig. 4b). Western blotting showed that the overexpression of miR-106a-5p led to a decrease in the protein levels of endogenous E2F3 (Fig. 4c). Taken together, these results demonstrated that E2F3 is a direct target of miR-106a-5p in melanoma cells.

Fig. 4

E2F3 is directly targeted by miR-106a-5p. a Binding site of miR-106a-5p within the 3′-UTR of E2F3 was predicted by miRanda. b Overexpression of miR-106a-5p suppressed luciferase activity in melanoma cells with the pMIR-E2F3-WT, but did not cause a significant change in melanoma cells with the pMIR-E2F3-MUT. c Western blots identified E2F3 protein expression changes following transfection with miR-106a-5p. *P < 0.05, **P < 0.01, ***P < 0.001

lncRNA H19 enhance E2F3 expression in melanoma

We investigated whether lncRNA H19 acts as ceRNA of miR-106a-5p to promote E2F3 expression in melanoma. E2F3 expression was up-regulated in melanoma tissues (Fig. 5a), and Pearson’s correlation analysis indicated positive relationship between lncRNA H19 and E2F3 mRNA levels (Fig. 5b). This suggested that lncRNA H19 and E2F3 are interrelated in melanoma. Dual-luciferase reporter assays showed that lncRNA H19 knockdown suppressed the luciferase activity of the wild-type E2F3 vector and that the luciferase activity was attenuated by the miR-106a-5p inhibitor (Fig. 5c). The mRNA and protein levels of E2F3 were inhibited in the lncRNA H19 knockdown group, and this inhibition was also rescued by the miR-106a-5p inhibitor (Fig. 5d, e). Overall, these results indicated that lncRNA H19 enhances E2F3 expression by competitively binding miR-106a-5p.

Fig. 5

lncRNA H19 enhances E2F3 expression in melanoma. a E2F3 levels were analyzed in 30 malignant melanoma tissues and adjacent normal tissues. b Pearson correlation of E2F3 and lncRNA H19 expression in 30 malignant melanoma tissues was positive. c Luciferase activity of indicated groups in melanoma cells. d Expression of E2F3 mRNA in melanoma cells transfected with si-H19 or si-H19 combination with miR-106a-5p inhibitor. e Western blots identified E2F3 protein expression changes following transfection with si-H19 alone or in combination with miR-106a-5p inhibitor. *P < 0.05, **P < 0.01, ***P < 0.001

lncRNA H19 promotes the glucose metabolism and growth of melanoma cell by sponging miR-106a-5p and up-regulating E2F3 expression

lncRNA H19 enhances the expression of E2F3 in melanoma. Recent studies have found that E2F transcription factors can regulate tumour cell growth by affecting glucose metabolism (Tech et al. 2015). We further investigated whether lncRNA H19 promotes glucose metabolism and growth in melanoma cell via E2F3. We transfected E2F3-targeting siRNA, lncRNA H19-targeting siRNA, miR-106a-5p mimics, and lncRNA H19-targeting siRNA together with the miR-106a-5p inhibitor into melanoma cells and carried out a series of functional assays. Western blotting was used to confirm E2F3 protein expression (Fig. 6a). Knockdown of E2F3 and overexpression of miR-106a-5p repressed glucose metabolism and growth in melanoma cells (Fig. 6b–e). The effect of the lncRNA H19-targeting siRNA on glucose metabolism and growth in melanoma cells was rescued by the miR-106a-5p inhibitor (Fig. 6b–e). Overall, we demonstrated that lncRNA H19 modulates the progression of melanoma by sponging miR-106a-5p to up-regulate E2F3 expression.

Fig. 6

lncRNA H19 promotes the glucose metabolism and growth of melanoma cell by sponging miR-106a-5p and up-regulating E2F3 expression. a Western blots identified E2F3 protein expression changes in different groups; GAPDH was used as a control. b Proliferative ability of A375 and SK-MEL-1 cells was measured by CCK8 assay. c, d Glucose consumption and lactate production of melanoma cells were measured. e Relative changes of ATP content in melanoma cells.*P < 0.05, **P < 0.01, ***P < 0.001

lncRNA H19 oncogenic activity through negative regulation of miR-106a-5p in vivo

We established a melanoma xenograft model to further assess the function of lncRNA H19 in vivo. The excision tumour in nude mice of A375 xenografts is shown in Supplementary Fig. 1B. Silencing of lncRNA H19 markedly decreased the growth of the tumour between 15 and 27 days (Fig. 7a). The average tumour weight in the control group was higher than that in the lncRNA H19 knockdown group (Fig. 7b). qRT-PCR showed that the expression of miR-106a-5p was increased in the lncRNA H19 knockdown group (Fig. 7c). The protein expression of E2F3 was reduced in the lncRNA H19 knockdown group (Fig. 7d). The effect of the lncRNA H19 siRNA on the growth of the tumour was rescued by the miR-106a-5p inhibitor (Fig. 7a–d). Finally, we detected the level of lactate in the animal tumour tissue and found that decreased lncRNA H19 expression inhibited the production of lactate, and this effect could also be reversed by miR-106a-5p inhibitor (Fig. 7e). These results indicated that lncRNA H19 may promote melanoma progression in vivo.

Fig. 7

lncRNA H19 oncogenic activity through negative regulation of miR-106a-5p in vivo. a Difference in tumour volume in different groups. b Tumour weight of excision tumour. c RT–qPCR identified lncRNA H19 and miR-106a-5p expression changes. d Expression of E2F3 was examined by immunohistochemical staining of sections from melanoma xenograft model in nude mice. e Level of lactate in the animal tumour tissue. *P < 0.05, **P < 0.01, ***P < 0.001

Discussion

Tumour cells are rapidly producing ATP via vigorous glycolysis for its growth. Meanwhile, glycolysis also provides essential precursors for the synthesis of cellular biological macromolecules (Kroemer and Pouyssegur 2008). Malignant melanoma cells also showed vigorous aerobic glycolysis (Scott et al. 2011). However, few studies on melanoma cell glucose metabolism have been reported.

lncRNAs are involved in a variety of cellular processes and functions related to cancer biology (Jiang and Bikle 2014). The aberrant expression of some special lncRNAs may be closely related to the development of tumours (Zhang et al. 2013). lncRNA H19 has been considered as a tumour suppressor in Wilms’ tumours and rhabdomyosarcoma (Okamoto et al. 1997; Scrable et al. 1990). Several studies have characterized lncRNA H19 as an oncogene in breast adenocarcinoma, bladder tumours, and choriocarcinoma (Rachmilewitz et al. 1995). However, the role and molecular mechanism of lncRNA H19 in melanoma have not been reported. In this study, we found that lncRNA H19 expression was increased in melanoma tissues and cells. High lncRNA H19 levels were correlated with poor prognosis of melanoma patients. We subsequently investigated the biological function of lncRNA H19 in melanoma cells and found that lncRNA H19 promoted melanoma cell proliferation and glucose metabolism.

Many studies have demonstrated that some specific lncRNAs can act as ceRNAs to affect miRNA pathways. ceRNAs function as miRNA sponges to inhibit the binding of miRNAs to their targets, thereby regulating gene expression (Tay et al. 2014). The disequilibrium between ceRNAs and miRNAs can be critical for tumourigenesis (Johnsson et al. 2013). For example, MALAT1 promotes metastasis and proliferation of osteosarcoma cells by acting as a ceRNA for miR-144-3p (Wang et al. 2017). Therefore, we hypothesized that H19 may target miRNAs in melanoma. Indeed, miR-106a-5p was found that have possible binding sites for lncRNA H19. Meanwhile, miR-106a-5p levels were increased after silencing lncRNA H19. Dual-luciferase reporter assays, MS2-RIP and RNA pull-down assays, confirmed that lncRNA H19 directly binds to miR-106a-5p.

miR-106a-5p is down-regulated and functions as a tumour suppressor in many human tumours (He et al. 2016; Zhi et al. 2013). Here, we found that miR-106a-5p suppressed the proliferation and glucose metabolism of melanoma cells. We used TargetScan to search for potential targets of miR-106a-5p and found that the 3′-UTR of E2F3 shares binding sites for miR-106a-5p with lncRNA H19. We demonstrated that E2F3 is a functional target of miR-106a-5p. E2F3 is a member of the E2F transcription factor family. E2F transcription factors can regulate tumour cell growth by affecting glucose metabolism (Tech et al. 2015). We further investigated whether H19 exerts its functions in melanoma cells via E2F3. Our results indicated that H19 enhances E2F3 expression by competitively binding miR-106a-5p. In addition, the effect of lncRNA H19 on melanoma cells could be reversed by the miR-106a-5p inhibitor. Finally, we demonstrated that H19 promotes melanoma progression in vivo through the negative regulation of miR-106a-5p.

In conclusion, we demonstrated that lncRNA H19 is an oncogene in melanoma. lncRNA H19 promotes growth and glucose metabolism in melanoma cells by sponging miR-106a-5p and thus functionally releasing E2F3 mRNA transcripts targeted by miR-106a-5p. Understanding the regulatory mechanism of lncRNA H19 in melanoma leads to the identification of new potential therapeutic for melanoma. Future studies to assess the role of the lncRNA H19/miR-106a-5p/E2F3 axis in a clinical context are warranted.

Notes

Funding

This study was funded by The Health and Family Planning Science and Technology Key project Foundation of Zhenjiang city (SHW2017004), The Social Development and Technology Support Foundation of Zhenjiang city (SH2011057), and The Clinical Medical Science and Technology Development Fund of Jiangsu University (JLY20160002).

Compliance with ethical standards

Conflict of interest

The authors declare that they have no competing interests.

Ethical approval

All applicable international, national, and/or institutional guidelines for the care and use of animals were followed. All procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 Helsinki declaration and its later amendments or comparable ethical standards.

Informed consent

Informed consent was obtained from all individual participants included in the study.

Supplementary material

432_2018_2582_MOESM1_ESM.doc (220 kb)
Supplementary material 1 (DOC 220 KB)
432_2018_2582_MOESM2_ESM.tif (689 kb)
Supplementary Figure 1 (A) lncRNA H19 was mainly distributed in cytoplasm analyzed by FISH. lncRNA H19 was labeled by Cy3 (red). Nucleus was stained by DAPI (blue). The tissue sections were observed in 400X magnification. The slides of cells were observed in 600X magnification. (B) The excision tumour in nude mice of A375 xenografts. (TIF 689 KB)
432_2018_2582_MOESM3_ESM.doc (52 kb)
Supplementary material 3 (DOC 51 KB)

References

  1. Arancio W, Pizzolanti G, Genovese SI, Baiamonte C, Giordano C (2014) Competing endogenous RNA and interactome bioinformatic analyses on human telomerase. Rejuvenation Res 17:161–167CrossRefPubMedGoogle Scholar
  2. Berteaux N, Lottin S, Monte D, Pinte S, Quatannens B, Coll J, Hondermarck H, Curgy JJ, Dugimont T, Adriaenssens E (2005) H19 mRNA-like noncoding RNA promotes breast cancer cell proliferation through positive control by E2F1. J Biol Chem 280:29625–29636CrossRefPubMedGoogle Scholar
  3. Gupta RA, Shah N, Wang KC, Kim J, Horlings HM, Wong DJ, Tsai MC, Hung T, Argani P, Rinn JL, Wang Y, Brzoska P, Kong B, Li R, West RB, van de Vijver MJ, Sukumar S, Chang HY (2010) Long non-coding RNA HOTAIR reprograms chromatin state to promote cancer metastasis. Nature 464:1071–1076CrossRefPubMedPubMedCentralGoogle Scholar
  4. Hanahan D, Weinberg RA (2011) Hallmarks of cancer: the next generation. Cell 144:646–674CrossRefPubMedGoogle Scholar
  5. Hauptman N, Glavac D (2013) Long non-coding RNA in cancer. Int J Mol Sci 14:4655–4669CrossRefPubMedPubMedCentralGoogle Scholar
  6. He QY, Wang GC, Zhang H, Tong DK, Ding C, Liu K, Ji F, Zhu X, Yang S (2016) miR-106a-5p Suppresses the Proliferation, Migration, and Invasion of Osteosarcoma Cells by Targeting HMGA2. DNA Cell Biol 35:506–520CrossRefPubMedGoogle Scholar
  7. Hombach S, Kretz M (2013) The non-coding skin: exploring the roles of long non-coding RNAs in epidermal homeostasis and disease. Bioessays 35:1093–1100CrossRefPubMedGoogle Scholar
  8. Jiang YJ, Bikle DD (2014) LncRNA profiling reveals new mechanism for VDR protection against skin cancer formation. J Steroid Biochem Mol Biol 144(Pt A):87–90PubMedGoogle Scholar
  9. Johnsson P, Ackley A, Vidarsdottir L, Lui WO, Corcoran M, Grander D, Morris KV (2013) A pseudogene long-noncoding-RNA network regulates PTEN transcription and translation in human cells. Nat Struct Mol Biol 20:440–446CrossRefPubMedPubMedCentralGoogle Scholar
  10. Kroemer G, Pouyssegur J (2008) Tumor cell metabolism: cancer’s Achilles’ heel. Cancer Cell 13:472–482CrossRefPubMedGoogle Scholar
  11. Little EG, Eide MJ (2012) Update on the current state of melanoma incidence. Dermatol Clin 30:355–361CrossRefPubMedGoogle Scholar
  12. Liu C, Chen Z, Fang J, Xu A, Zhang W, Wang Z (2016) H19-derived miR-675 contributes to bladder cancer cell proliferation by regulating p53 activation. Tumour Biol 37:263–270CrossRefPubMedGoogle Scholar
  13. Liu H, Dai C, Wu Q, Liu H, Li F (2017) Expression profiling of long noncoding RNA identifies lnc-MMP3–1 as a prognostic biomarker in external auditory canal squamous cell carcinoma. Cancer Med 6:2541–2551CrossRefPubMedPubMedCentralGoogle Scholar
  14. Luan W, Wang Y, Chen X, Shi Y, Wang J, Zhang J, Qian J, Li R, Tao T, Wei W, Hu Q, Liu N, You Y (2015) PKM2 promotes glucose metabolism and cell growth in gliomas through a mechanism involving a let-7a/c-Myc/hnRNPA1 feedback loop. Oncotarget 6:13006–13018CrossRefPubMedPubMedCentralGoogle Scholar
  15. Luan W, Li L, Shi Y, Bu X, Xia Y, Wang J, Djangmah HS, Liu X, You Y, Xu B (2016) Long non-coding RNA MALAT1 acts as a competing endogenous RNA to promote malignant melanoma growth and metastasis by sponging miR-22. Oncotarget 7:63901–63912PubMedPubMedCentralGoogle Scholar
  16. Lv J, Yu YQ, Li SQ, Luo L, Wang Q (2014) Aflatoxin B1 promotes cell growth and invasion in hepatocellular carcinoma HepG2 cells through H19 and E2F1. Asian Pac J Cancer Prev 15:2565–2570CrossRefPubMedGoogle Scholar
  17. Millet A, Martin AR, Ronco C, Rocchi S, Benhida R (2017) Metastatic melanoma: insights into the evolution of the treatments and future challenges. Med Res Rev 37(1):98–148CrossRefPubMedGoogle Scholar
  18. Okamoto K, Morison IM, Taniguchi T, Reeve AE (1997) Epigenetic changes at the insulin-like growth factor II/H19 locus in developing kidney is an early event in Wilms tumorigenesis. Proc Natl Acad Sci USA 94:5367–5371CrossRefPubMedPubMedCentralGoogle Scholar
  19. Rachmilewitz J, Elkin M, Rosensaft J, Gelman-Kohan Z, Ariel I, Lustig O, Schneider T, Goshen R, Biran H, de Groot N et al (1995) H19 expression and tumorigenicity of choriocarcinoma derived cell lines. Oncogene 11:863–870PubMedGoogle Scholar
  20. Schmidt K, Joyce CE, Buquicchio F, Brown A, Ritz J, Distel RJ, Yoon CH, Novina CD (2016) The lncRNA SLNCR1 Mediates Melanoma Invasion through a Conserved SRA1-like Region. Cell Rep 15:2025–2037CrossRefPubMedPubMedCentralGoogle Scholar
  21. Scott DA, Richardson AD, Filipp FV, Knutzen CA, Chiang GG, Ronai ZA, Osterman AL, Smith JW (2011) Comparative metabolic flux profiling of melanoma cell lines: beyond the Warburg effect. J Biol Chem 286:42626–42634CrossRefPubMedPubMedCentralGoogle Scholar
  22. Scrable HJ, Sapienza C, Cavenee WK (1990) Genetic and epigenetic losses of heterozygosity in cancer predisposition and progression. Adv Cancer Res 54:25–62CrossRefPubMedGoogle Scholar
  23. Shi Y, Wang Y, Luan W, Wang P, Tao T, Zhang J, Qian J, Liu N, You Y (2014) Long non-coding RNA H19 promotes glioma cell invasion by deriving miR-675. PLoS One 9:e86295CrossRefPubMedPubMedCentralGoogle Scholar
  24. Soares MR, Huber J, Rios AF, Ramos ES (2010) Investigation of IGF2/ApaI and H19/RsaI polymorphisms in patients with cutaneous melanoma. Growth Horm IGF Res 20:295–297CrossRefPubMedGoogle Scholar
  25. Subramanian M, Li XL, Hara T, Lal A (2015) A biochemical approach to identify direct microRNA targets. Methods Mol Biol 1206:29–37CrossRefPubMedGoogle Scholar
  26. Tay Y, Rinn J, Pandolfi PP (2014) The multilayered complexity of ceRNA crosstalk and competition. Nature 505:344–352CrossRefPubMedPubMedCentralGoogle Scholar
  27. Tech K, Deshmukh M, Gershon TR (2015) Adaptations of energy metabolism during cerebellar neurogenesis are co-opted in medulloblastoma. Cancer Lett 356:268–272CrossRefPubMedGoogle Scholar
  28. Vander Heiden MG, Cantley LC, Thompson CB (2009) Understanding the Warburg effect: the metabolic requirements of cell proliferation. Science 324:1029–1033CrossRefPubMedPubMedCentralGoogle Scholar
  29. Wang KC, Chang HY (2011) Molecular mechanisms of long noncoding RNAs. Mol Cell 43:904–914Google Scholar
  30. Wang Y, Zhang Y, Yang T, Zhao W, Wang N, Li P, Zeng X, Zhang W (2017) Long non-coding RNA MALAT1 for promoting metastasis and proliferation by acting as a ceRNA of miR-144–3p in osteosarcoma cells. Oncotarget 8:59417–59434PubMedPubMedCentralGoogle Scholar
  31. Zhang H, Chen Z, Wang X, Huang Z, He Z, Chen Y (2013) Long non-coding RNA: a new player in cancer. J Hematol Oncol 6:37CrossRefPubMedPubMedCentralGoogle Scholar
  32. Zhi F, Zhou G, Shao N, Xia X, Shi Y, Wang Q, Zhang Y, Wang R, Xue L, Wang S, Wu S, Peng Y, Yang Y (2013) miR-106a-5p inhibits the proliferation and migration of astrocytoma cells and promotes apoptosis by targeting FASTK. PLoS One 8:e72390CrossRefPubMedPubMedCentralGoogle Scholar

Copyright information

© Springer-Verlag GmbH Germany, part of Springer Nature 2018

Authors and Affiliations

  1. 1.Department of Plastic SurgeryAffiliated People’s Hospital of Jiangsu UniversityZhenjiangChina
  2. 2.Department of NeurosurgeryAffiliated People’s Hospital of Jiangsu UniversityZhenjiangChina
  3. 3.Department of GastroenterologyAffiliated Hospital of Jiangsu UniversityZhenjiangChina
  4. 4.Department of Respiratory MedicineAffiliated People’s Hospital of Jiangsu UniversityZhenjiangChina

Personalised recommendations