Journal of Cancer Research and Clinical Oncology

, Volume 135, Issue 9, pp 1265–1276 | Cite as

A novel role for DYX1C1, a chaperone protein for both Hsp70 and Hsp90, in breast cancer

  • Yuxin Chen
  • Muzi Zhao
  • Saiqun Wang
  • Jie Chen
  • Yun Wang
  • Qinhong Cao
  • Wenbin Zhou
  • Jin Liu
  • Zhiyang Xu
  • Guoqing Tong
  • Jianmin Li
Original Paper

Abstract

Aims

With three consecutive tetratricopeptide repeat (TPR) motifs at its C-terminus essential for neuronal migration, and a p23 domain at its N-terminus, DYX1C1 was the first gene proposed to have a role in developmental dyslexia. In this study, we attempted to identify the potential interaction of DYX1C1 and heat shock protein, and the role of DYX1C1 in breast cancer.

Main methods

GST pull-down, a yeast two-hybrid system, RT-PCR, site-directed mutagenesis approach.

Key findings

Our study initially confirmed DYX1C1, a dyslexia related protein, could interact with Hsp70 and Hsp90 via GST pull-down and a yeast two-hybrid system. And we verified that EEVD, the C-terminal residues of DYX1C1, is responsible for the identified association. Further, DYX1C1 mRNA was significantly overexpressed in malignant breast tumor, linking with the up-regulated expression of Hsp70 and Hsp90.

Significance

These results suggest that DYX1C1 is a novel Hsp70 and Hsp90-interacting co-chaperone protein and its expression is associated with malignancy.

Keywords

DYX1C1 Heat shock protein Tetratricopeptide repeats Protein interaction Breast cancer 

Introduction

Over the past couple of decades, our understanding of the role of the tetratricopeptide repeat (TPR) domain has made great progress. A TPR domain is defined by a repeating motif of 34 amino acids that adopt a helix-turn-helix secondary structure (Blatch and Lassle 1999). The concave and convex surfaces at the inner and outer interfaces (D’Andrea and Regan 2003) of this domain facilitate the binding of various ligands. The diversity of co-factors that can associate with this domain, coupled with the biological significance of those protein–protein interactions, have provided an ongoing area of study. TPR-containing proteins have previously been studied for their roles in molecular chaperone complexes, anaphase promoting complexes, transcription repression complexes, and the organization of protein import complexes (Tzamarias and Struhl 1995; Miyata et al. 1997; Moczko et al. 1997). However, these TPR-mediated functions appear to only be the tip of the iceberg. Identifying all of the possible biological functions of TPR-containing proteins and their specific binding partners is an ongoing challenge.

In this study, we specifically look at the human TPR-containing protein, DYX1C1, which contains three consecutive TPR motifs in its C-terminus. Taipale et al. first reported DYX1C1 as a candidate gene for a role in developmental dyslexia (Taipale et al. 2003). Developmental dyslexia is defined as a specific and persistent failure to acquire efficient reading skills despite conventional instruction, adequate intelligence, and socio-cultural opportunities (Chaix et al. 2007). Ramus et al. concluded that developmental dyslexia can be attributed to all neuro-develomental disorders, especially neuronal migration abnormalities (Ramus 2004). When the biological function of DYX1C1 was investigated, DYX1C1 was shown to play a role in the migration of neocortical neurons, and disruption of DYX1C1 leads to neuronal migration disorders similar to those seen in the brains of dyslexics (Wang et al. 2006; Chaix et al. 2007). Currently, the biological functions of DYX1C1 remain only partially identified. Importantly, the molecular mechanism of how DYX1C1 functions still remains unknown and its binding interactions are unreported.

In the present study, we compared expression of DYX1C1 in tumor tissues versus normal tissues. Unexpectedly, we detected expression of DYX1C1 predominately in proliferative tissues. Furthermore, we confirmed that DYX1C1 can interact with heat shock proteins, Hsp70 and Hsp90, via its TPR domain using glutathione S-transferase (GST) pull-down assays and a yeast two-hybrid system, respectively. We hypothesize that the identification of proteins that bind DYX1C1 will provide valuable insight into the role of DYX1C1 in neuronal migration.

Materials and methods

Sequence analysis of DYX1C1

Several online sequence analysis tools were utilized. To search for similar protein sequences in different species, Blast (http://www.ncbi.nlm.nih/Blast/) and Conserved Domain Architecture Retrieval Tool (CDart) (http://www.ncbi.nlm.nih.gov/structure/lexington/lexington.cgi?cmd=rps) were used. To search for conserved domains, Smart (http://smart.embl-heidelberg.de/Smart) was used. To align similar proteins, ClustalW (http://www.ebi.ac.uk/clustalw/) and the ClustalW (1.83) Multiple Sequence Alignments program were used.

Distribution of DYX1C1 in normal tissues

Multiple tissue cDNA panels including colon, small intestine, spleen, kidney, skeletal muscle, placenta, lung, pancreas, whole brain, heart, peripheral blood leukocyte, testis, and thyroid samples were purchased from Clontech (Human MT Panel II). PCR was performed with primer pairs specific for DYX1C1 (DYX1C1s-F and DYX1C1-R, Table 1) which produced a 268-bp product. Control PCR reactions amplified the β-actin gene using primers β-actin-F and β-actin-R (Table 1). Each PCR reaction contained SuperTaq-Plus DNA polymerase (Ambion) and the amplification reaction consisted of 30 cycles (30 s at 94°C, 30 s at 55°C, 1 min at 72°C), followed by a 5-min extension at 72°C. PCR products were separated by electrophoresis and visualized on a 1.5% agarose gel.
Table 1

Nucleotide sequences of primers used in this study

Name

Primer sequence (5′-3′)

A

CGTGGCCTCTAAGGCCTATGCCACCTCCTCAATGGTGGGGCCCTTGTACAGC

TCGTCCAT

B

GTCGGCCTCTAAGGCCCTAATCCACCTCCTCAATGG

C

CGTGGCCTCTAAGGCCTAGTCTACTTCTTCCATCTTGTACAGCTCGTCCAT

D

CGTGGCCTCTAAGGCCTAGTCTACTTCTTCCTTGTACAGCTCGTCCAT

E

CGTGGCCTCTAAGGCCTAATCACCTCCTCAATGGTGGGGCCCTTGTACAGCT

CGTCCAT

F

CGTGGCCTCTAAGGCCTATGCTACTTCTTCCATCTTGTACAGCTCGTCCAT

G

CATGGCCAATCCGGCCATGGAAGAAGTAGACATGGTGAGCAAGGGCGAGGA

H

CGTGGCCTCTAAGGCCTACTTGTACAGCTCGTCCAT

DYX1C1s-F

CATAAGGCCAATCCGGCCCCAGAATGGTTGAAGGATAAAG

DYX1C1s-R

CAGGGCCTCTAAGGCCGTTGGATGGATCAATCTTAAGTG

DYX1C1-F

CATGGCCAATCCGGCCATGCCTCTTCAGGTTAGCGA

DYX1C1-R

CAGGGCCTCTAAGGCCTTAAGATTTTAGTTCTGTTCC

Hsp70s-F

TGTCGTCCAGCACCCAGGCCAGC

Hsp70s-R

GCTCTTGTTCAGGTCGCGCCGG

Hsp90-F

GGGAGGCCAATCCG GCCATGCCTGAGGAAACCCAGACC

Hsp90-R

GGGAGGCCTCTAAGGCC GTCTACTTCTTCCATGCGTGATG

β-Actin-F

AAAGACCTGTACGCCAACAC

β-Actin-R

GTCATACTCCTGCTTGCTGAT

Collection of breast tumor tissue specimens

Forty-one breast tumor tissue specimens were surgically excised from female patients treated in the Department of Breast Surgery, First Affiliated Hospital of Nanjing Medical University. Of the 41 samples, 31 were diagnosed as malignant breast tumors, and 10 were benign. For controls, 10 tissue samples were obtained from the same mastectomy patients (matched pairs), but at a distance of at least 2 cm from the primary tumor. All tissue specimens were snap-frozen in liquid nitrogen and stored at −80°C until used. Forty-one biopsy samples of breast tumor tissues and their associated pathological details were generously provided by First Affiliated Hospital of Nanjing Medical University. Histological differentiation was determined from hematoxylin and eosin (H&E) staining. Assessment of histological grade was according to the method of Elston and Ellis (1991.).

Total RNA extraction, cDNA synthesis, and semi-quantitative RT-PCR

Total RNA was isolated from breast tumor tissues using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. The extracted RNA was reverse transcribed with random primer N6 of the RetroScript kit (Ambion, Austin, TX) according to the manufacturer’s instructions. Hsp70 primers (Table 1) were designed from Genbank entry NM_005345.4 and amplified a 266-bp product. The primers for DYX1C1 and β-actin are listed in Table 1, and the RT-PCR protocol was the same as described for the PCR assays listed above. All RT-PCR experiments were repeated three times. RT-PCR products were separated by electrophoresis and visualized on a 1.5% agarose gel.

Acquisition of gel images and semi-quantitative analysis

Images of the RT-PCR ethidium bromide-stained agarose gels were acquired with a Panasonic CCTV camera (Panasonic System Solution Suzhou, co., Ltd, Suzhou, China) and quantification of the bands was performed by JEDA801 (Jiangsu JEDA Science-Technology Development Co., Ltd). Band intensity was expressed as relative absorbance units. The ratio between the sample RNA to be determined and β-actin was calculated to normalize for initial variations in sample concentration and as a control for reaction efficiency. Mean and standard deviation of all experiments performed were calculated after normalization to β-actin.

Construction of plasmids containing DYX1C1, Hsp70, and Hsp90

Plasmids pGADT7, pGBDT7, pET28a, and pGEX-4T-1 were developed in our lab and include two Sfi-I restriction sites [5′-Sfi-I (A) site (GGCCATTACGGCC); 3′-Sfi-I (B) site (GGCCGAGGCGGCC)] separated by a sufficient number of basepairs to allow efficient cleavage by Sfi-I. The human Hsp70 and Hsp 90 genes were amplified from pEGFP-Hsp70 (Addgene) and pEGFP-Hsp90, respectively, by PCR using oligos containing the Sfi-I (A) and Sfi-I (B) restriction sites. The Hsp70 and Hsp90 open reading frames (ORFs) were cloned into vector, pGADT7 (Clontech), to create pGADT7-Hsp70 and pGADT7-Hsp90 for use in a yeast two-hybrid system. After sequence verification, the Hsp70 insert was subcloned into pGBDT7 and pET28a between the Sfi-I (A) and Sfi-I (B) sites as previously described (Cao et al. 2006), yielding expression constructs BD-bait Hsp70 (pGBDT7-Hsp70) for the yeast two-hybrid assay and His-tagged Hsp70 (pET28a-Hsp70) for both in vitro translation and GST pull-down assays. Hsp70C is a truncated form of Hsp70 that includes the C-terminal residues of Hsp70 (amino acids 449–640) and was generated using primers Hsp70s-F and Hsp70s-R (Table 1). Similarly, Hsp90C is a truncated form of Hsp90 that includes the C-terminal residues of Hsp90 (amino acids 521–774) and was generated using primers Hsp90s-F and Hsp90s-R (Table 1). PCR fragments obtained were digested with Sfi-I and ligated into the Sfi-I sites of pGADT7.

Hsp70 mutant constructs were assembled using a PCR-based, site-directed mutagenesis approach. The plasmid F2 (pGADT7-GFP-EEVD) from our lab includes the EEVD motif, which are the last four amino acid residues shared by both Hsp70 and Hsp90 at their C-terminus. The plasmid F1 (pGADT7-GFP-MEEVD) contains the C-terminus motif, MEEVD, derived from Hsp90; plasmid F3 (pGADT7-GFP-GPTIEEVD) contains the C-terminal motif, GPTIEEVD, derived from Hsp70; plasmid F7 (pGADT7-MEEVD-GFP) contains the N-terminal motif, MEEVD. In addition, mutants F4 (pGADT7-GFP-MEEVA) and F5 (pGADT7-GFP-GPTIEEVA) contain an amino acid substitution at the extreme C-terminus. Plasmid F6 (pGADT7-GFP) was a negative control. These six mutants, F1–F5 and F7, were generated using primer A (Table 1) as the forward primer, and the reverse primers B, C, D, E, F, or H, respectively (Table 1). Mutant F6 was generated using primer G as the forward primer and primer H as the reverse primer. PCR fragments were digested with Sfi-I and ligated into the Sfi-I sites of the vector pGADT7. The resulting plasmids, F1 (pGADT7-GFP-MEEVD), F2 (pGADT7-GFP-EEVD), F3 (pGADT7-GFP-GPTIEEVD), F4 (pGADT7-GFP-MEEVA), F5 (pGADT7-GFP-GPTIEEVA), F6 (pGADT7-GFP), and F7 (pGADT7-MEEVD-GFP), had their sequences verified and were used in the yeast two-hybrid assays.

Full-length DYX1C1 (amino acids 1–398), and the TPR domain of DYX1C1 (DYX1C1s, comprising amino acids 293–398) were generated using PCR with primers listed in Table 1 and cDNA generated from breast tumor tissues as described above. The Sfi-I fragment of the product was ligated into the Sfi-I (A) and Sfi-I (B) sites of vectors, pGBDT7 and pGEX-4T-1. The resulting plasmids, pGBDT7-F-DYX1C1 and pGBDT7-DYX1C1s, were used in yeast two-hybrid assays, and pGEX-4T-1-GST-F-DYX1C1 and pGEX-4T-1-GST-DYX1C1s were used in GST pull-down assays.

Expression of recombinant Hsp70, DYX1C1, and DYX1C1s for GST pull-down assays

Plasmid pET28a-Hsp70 was transformed into the BL21 (DE3) E. coli strain following the induction of log-phase cultures in YT liquid media with 1.0 mg/ml IPTG for 6 h at 30°C. Bacteria were harvested and purification of Hsp70 for use in the GST pull-down assays was verified by SDS-PAGE. Recombinant GST-DYX1C1 and GST-DYX1C1s proteins were immobilized on MagneGST particles (Promega) from 1 ml of E. coli sample according to the manufacturer’s instructions. Proteins bound to Hsp70 (prey) by the magnetically immobilized GST-DYX1C1 or GST-DYX1C1 s fusion (bait) proteins were visualized on 12% SDS-polyacrylamide gels.

Yeast two-hybrid screening

Binding of DYX1C1 and DYX1C1s to Hsp70 or Hsp90 was investigated using a yeast two-hybrid system with a lacZ reporter. Using the engineered plasmids described above, DYX1C1 and DYX1C1s were expressed as binding or activation domain hybrids and were co-expressed with an Hsp activation or binding domain hybrid in the Y190 yeast strain. Binding interactions were visualized by assaying β-galactosidase levels. After the first round of library screening, the potential interactors were re-transfected into the Y190 strain with the relevant bait or the pGBDT7 vector as negative controls. If re-expression of the selected interactors did not reproduce the phenotypes originally observed during library screening, the interactor was deemed a false positive. β-galactosidase activity was evaluated based on color development in a filter assay. Color development after 12 h was considered a negative interaction, color development in <4 h was labeled a positive interaction, and color development between 4 and 12 h was labeled a weak interaction. We also used this system to determine the specific residues involved in the binding interaction between DYX1C1 and Hsp proteins.

Results

Sequence analysis of DYX1C1

DYX1C1 is located on chromosome 15q21.3 and comprises 1,993 base pairs spanning 10 exons. This gene encodes three isoforms of DYX1C1, isoform a (NP_570722.2), b (NP_001028731), and c (NP_001028732). Structurally, all three have a N-terminal p23 domain; however, only the DYX1C1-b isoform harbors a unique TPR domain at its C-terminus that consists of three tandem-repeats of TPR motifs (Fig. 1). The DYX1C1 protein is expressed in a number of different mammalian species ranging from chimpanzee to zebrafish in addition to humans. To understand the evolution of DYX1C1, a query of the NCBI database provided a comparison of related proteins in other species (Fig. 2). Human DYX1C1 has 75% identity with the DYX1C1 protein from Rattus norvegicus, 73% identity with the DYX1C1 from Mus musculus, 62% identity with DYX1C1 expressed in Gallus, and 49% identity with the DYX1C1 protein in Danio rerio. Given the high degree of homology of DYX1C1 among different species, we hypothesize that DYX1C1 may have important biological functions in addition to its role in neural migration.
Fig. 1

Nucleic acid and deduced amino acid sequences of DYX1C1. a The amino acid sequence is indicated above the nucleotide sequence of DYX1C1 from positions 369 to 1629 (420 amino acid residues). The start and termination codons are underlined. The peptide sequences that are shaded represent either the p23 domain sequence from position 386 to 676 (97 amino acid residues), or three TPR domains from position 1235 to 1565 (110 amino acid residues) of the DYX1C1 protein. The three units of TPR domain are indicated in different underlines. b The domain structure of DYX1C1 is also represented, in which the rectangle indicate the N-terminal p23 domain and three ellipses indicate the C-terminal TPR domains

Fig. 2

Alignment of DYX1C1 proteins from various species. Using the CLUSTALW (1.82) program, comparisons of protein sequences of DYX1C1 are made between: 1 Homo (Homo sapiens, NP_570722.2), 2 paniscu (Pan paniscus, AAO22535.1), 3 troglod (Pan troglodytes, NP_001009083.1), 4 Gorilla (Gorilla gorilla, AAO22536.1), 5 Pongo (Pongo pygmaeus, AAO22537.1), 6 Canis (Canis familiaris, XP_544692.1), 7 Equus (Equus caballus, XP_001500918.1), 8 Bos (Bos taurus, XP_871512.1), 9 Mus (Mus musculus, EDL26272.1), 10 Rattus (Rattus norvegicus, NP_001007011.1), 11) Gallus (Gallus gallus, NP_001008674.1), 12 Xenopu (Xenopus laevis, AAR89527.1), 13 Danio (Danio rerio, NP_991251.1). Black squares indicate complete homology; gray squares indicate changes in functionally conserved amino acids. White squares indicate functionally non-conserved amino acid disagreement

DYX1C1 is overexpressed in breast tumor tissues

Currently, only Taipale et al. have published data for the expression of DYX1C1 in various human tissues (Taipale et al. 2003). In our assays of DYX1C1 expression, we additionally found that DYX1C1 is highly expressed in placenta (data was not shown). Thirty-one samples were diagnosed with breast carcinoma and 10 were benign tumor samples (Fig. 3). Semi-quantitative RT-PCR was used to analyze the expression level of DYX1C1. The ratio DYX1C1/β-actin was calculated to normalize for initial variations in sample concentration. DYX1C1 signal intensity was graded as weak (the ratio is less than 0.3000), or as moderate (the ratio is between 0.3000 and 0.7000), or as strong (the ratio is more than 0.7000). Of the 31 breast carcinoma samples, 8 (25.8%) strongly expressed DYX1C1, 20 (64.5%) were associated with moderate DYX1C1 expression levels, and 3 (9.6%) had weak expression of DYX1C1. For the benign tumor samples, 5 (50%) had moderate expression of DYX1C1, and 4 (40%) had weak expression of DYX1C1 (Table 2; Fig. 4). Overall, DYX1C1 expression was found to be low in benign tumor tissues, yet was overexpressed in malignant tumor samples. We also analyzed adjacent normal breast tissue from 10 of 31 breast cancer samples as controls. The ratio of DYX1C1/β-actin was found to be significantly increased in tumor tissue compared to adjacent normal breast tissue. P value was obtained using the t test (t = 1.85, P < 0.05).
Fig. 3

Representative HE stainings of breast samples used in this study. H&E staining of breast tissue samples are shown of: a adjacent normal breast tissue; b benign breast tumor tissue; c well-differentiated breast carcinoma; d moderately differentiated breast carcinoma; e poorly differentiated adenocarcinoma

Table 2

Expression level of DYX1C1 in malignant and benign tumor tissues

DYX1C1 expression

No. of malignant tumor samples (%)

No. of benign tumor cases (%)

Weak

3 (9.6)

4 (40)

Moderate

20 (64.5)

5 (50)

Strong

8 (25.8)

1 (10)

Total number

31 (100)

10 (100)

Fig. 4

Semi-quantitative RT-PCR analysis of DYX1C1 and Hsp70 expression. Detection of DYX1C1, Hsp70, and β-actin in four breast carcinoma samples (T1T4), three paired adjacent normal breast tissues (N4N6), and two breast benign tumor samples (B7).According to variation of the ratio DYX1C1/Hsp70, samples were classified as three levels: weak, moderate and strong. T1 is representative of ‘strong’ DYX1C1 expression, T2 as ‘moderate’ DYX1C1 expression, and N5 as ‘weak’ DYX1C1 intensity

Ten of patients included in this study also were diagnosed with axillary lymph node metastasis. However, no significant correlation between DYX1C1 expression and node metastasis of breast cancer could be identified. Since we were unable to obtain sufficient samples to examine varying grades of breast carcinoma, RT-PCR could not be used to determine whether there was a correlation between DYX1C1 expression and the stage of breast cancer.

TPR domain of DYX1C1 binds Hsp70 in vitro

Our semi-quantitative RT-PCR results suggest that DYX1C1 can be abundantly expressed in proliferative tissues. Intriguingly, TPR domain, presented in C-terminus of DYX1C1, is recognized as a binding partner of heat shock proteins, which function as regulators of cell apoptosis and survival (Scheufler et al. 2000; Beere 2004). Therefore, we hypothesized that DYX1C1 may be associated with heat shock proteins. Using a GST pull-down assay system, we analyzed the ability of GST-tagged DYX1C1 to bind Hsp70 translated in vitro. Transcription and translation of pET28a-Hsp70 produced a single 70S-labeled protein sample. Additionally, a GST-DYX1C1 fusion protein, a GST-DYX1C1s fusion protein, and GST alone were produced in the E. coli strain BL21 and the soluble post-induction extracts were incubated with glutathione-magnetic particles. Immobilized GST-DYX1C1, GST-DYX1C1s, or GST were incubated with Hsp70 translated in vitro. Electrophoresis of the binding reaction followed by Coomassie staining indicated that Hsp70 was retained on particles coated with GST-DYX1C1s and GST-DYX1C1, but not on GST beads alone (Fig. 5). This result not only shows that DYX1C1 could bind with Hsp70, but also strongly supports that DYX1C1s, C-terminal TPR domain in DYX1C1, is sufficient to interact with Hsp70 in vitro. Taken together, DYX1C1 can associate with Hsp70 through its C-terminal domains.
Fig. 5

Interactions between Hsp70 and DYX1C1 in glutathione S-transferase (GST) pull-down assays. a SDS-PAGE and staining of a purified 6-His-Hsp70 protein sample. b SDS-PAGE and staining of purified recombinant GST-DYX1C1 (B1), GST-DYX1C1s (B2), and GST (B3) samples used in GST pull-down assays. c GST pull-down assay to evaluate binding interactions of 6-His-Hsp70. SDS-PAGE and staining show that GST and 6-His-Hsp70 did not interact, whereas GST-DYX1C1 and 6-His-Hsp70 interacted more strongly than GST-DYX1C1s and 6-His-Hsp70

Interaction of DYX1C1 with Hsp70 in vivo

We confirmed the binding interaction between DYX1C1 and DYX1C1s with Hsp70 in vivo by using a yeast two-hybrid system with a lacZ reporter. The assay included the empty pGADT7 vector as a negative control, and pGADT7-PP5 as a positive control based on the interaction previously shown to occur between the catalytic unit of protein phosphatase 5 (PP5) and Hsp70 (Zeke et al. 2005). Growth of colonies on solid SD/-Leu-Trp-His media was detected after 4 days of incubation at 30°C for all pairs. The assay for X-gal activity on the two pairs showed a color reaction on the filters within 4 h (Fig. 6b). These results are consistent with data from the GST pull-down experiments and demonstrate that DYX1C1 can interact with Hsp70, and furthermore, the TPR domain in DYX1C1 plays a key role in the interaction between DYX1C1 and Hsp70.
Fig. 6

Mapping of interactions between DYX1C1 and Hsp70 or Hsp90. a Simplified illustrations of the binding domains assembled and tested in the yeast two-hybrid experiments. F1 contained a mutation in the C-terminus sequence, MEEVD, of Hsp90. F2 contained EEVD, the last amino acid residues at the C-terminus shared by both Hsp70 and Hsp90. F3 contained the C-terminal residues of Hsp70, GPTIEEVD. F4 and F5 contained amino acid substitutions at the extreme C-terminus compared to F1 and F3, respectively. F6 was a negative control. F7 contained the MEEVD motif located at the N-terminus. The domain structure of DYX1C1 is also represented, in which the rectangle indicate the N-terminal p23 domain and three ellipses indicate the C-terminal TPR domains. DYX1C1s is a truncated form of DYX1C1 that only contains the three tetratricopeptide repeat motifs. b Summary of results obtained from the yeast two-hybrid experiments using the plasmids illustrated in a. The designations (+), (++), (+++), and (++++) indicate the time required for development of a detectable blue color produced by β-galactosidase activity as follows: (+) 1–2 h, (++) 30–60 min, (+++) 30–45 min, (++++) within 30 min. Designations of (—) and ND indicate there was no color development after 12 h or the assay was not done, respectively

DYX1C1 interacts with Hsp90 via a TPR domain

Using the yeast two-hybrid system, we investigated whether DYX1C1 can interact with Hsp90α, one isoform of Hsp90. Color-based assays revealed that DYX1C1 could interact with both full-length Hsp90α and truncated Hsp90α (Fig. 6b). Since DYX1C1 contains a p23 domain, a domain characterized for binding Hsp90, our results were consistent with previous studies. However, we additionally wanted to know whether TPR domain at the C-terminus of DYX1C1 could mediate this interaction. Therefore, we assessed whether DYX1C1s interacts with Hsp90α or Hsp90α C. We did observe a weaker color change in some of the clones, indicating that the TPR domain of DYX1C1 could mediate weaker interaction with Hsp90α, which might be caused by disruption of p23.

Mutational analysis of the interaction site for Hsp in DYX1C1

Having shown that DYX1C1 is able to associate with both Hsp70 and Hsp90, we generated a series of plasmids coding for different mutants of Hsp70 and Hsp90 to map the heat shock protein (Hsp)-binding domain of DYX1C1 in a yeast two-hybrid system (Fig. 6a). It is well established that TPR co-chaperones recognize the EEVD structural motif that is present in the C-terminus of both Hsp70 and Hsp90. However, the EEVD motif is flanked by different residues in Hsp70 versus Hsp90, GPTIEEVD and MEEVD, respectively (Scheufler et al. 2000). For the yeast two-hybrid screen, these mutant fusion proteins were each co-expressed with a DYX1C1 fusion protein in the Y190 yeast strain and X-gal activity was assayed. Growth on solid SD/-Leu-Trp-His media was detected after 4 days of incubation at 37°C for all pairs. Of the seven pairs tested, two colonies, F2 and F3, produced blue color on the filter within 4 h, demonstrating a strong binding interaction had occurred. With EEVA rather than EEVD at their C-terminus, both F4 and F5 showed no association with the target protein. We did not detect an interaction between DYX1C1 and F1, which share the same last five residues of Hsp90. As a negative control, F7 colonies exhibited no color change. Taken together, our results confirm that EEVD is indispensable for binding interactions between Hsp and DYX1C1, and the octapeptide GPTIEEVD at the C-terminus can also mediate interactions between Hsp70 and DYX1C1. However, our data indicate that MEEVD does not associate with DYX1C1, suggesting there are additional mechanisms by which TPR co-chaperones interact with Hsp90 which deserve further exploration (Fig. 6b).

Discussion

Heat shock proteins (Hsps) are a well-known family of highly homologous molecular chaperones that are transiently induced under a variety of chemical and physiological stimuli (Marino et al. 2005). Extensive studies have shown the ability of Hsps to maintain cell survival by mediating the renaturation of proteins and participating in anti-apoptotic signaling (Beere 2004; Gething and Sambrook 1992; Nollen and Morimoto 2002; Parsell and Lindquist 1993; Parcellier et al. 2003). Many mechanisms have been proposed to account for the role of Hsps in inhibiting cell apoptosis where, in response to stress, the coordinated activities of Hsps may regulate signaling events within apoptotic pathways to support cell survival. Hsps have been shown to participate in at least six major signaling pathways that involve c-myc, p53, Bcl-2, c-Jun N-terminal kinase (JNK), and cytochrome c (Jolly and Morimoto 2000).

Studies in animal models and in vitro models have shown that acquired resistance to apoptosis is a trait of most, if not all, types of cancer (Sreedhar and Csermely 2004). It is not surprising, therefore, that Hsp expression is associated with tumor growth. Elevated expression of Hsp70 has been detected in high-grade malignant tumors, and associated with short-term disease-free survival, metastasis, and poor patient prognosis (Kaur and Ralhan 1995; Santarosa et al. 1997). Other members of the Hsp family—including Hsp90a, Hsp90b, and Hsp60—have also been shown to be overexpressed in breast tumors, lung cancer, leukemia, and Hodgkin’s disease (Jameel et al. 1992; Wong and Wispe 1997; Yufu et al. 1992). Strong evidence has shown that higher levels of Hsp transcription in tumor cells is related to the dysfunction of p53, elevated expression of the proto-oncogene HER2 and c-myc, and is crucial to tumorigenesis (Lane et al. 1993). Hsp family members conduct coordinated activities in tumor growth by promoting both autonomous cell proliferation and by inhibiting apoptosis. Hsp90 appears to play an especially important role in both promoting tumor progression by permitting the autonomous state of unstable growth signaling, and by stimulating cell transformation events by facilitating a growing pool of mutant proteins (Calderwood et al. 2006). Unlike Hsp90 that has been shown to be a mediator of proliferation, Hsp70 has been shown to provide protection from programmed cell death (PCD) and senescence. Inactivation or knockdown of Hsp70 can induce a spontaneous PCD event that is rarely observed in normal tissues (Beere and Green 2001). Unfortunately, the mechanistic details of Hsp70 or Hsp90 signaling events in promoting tumor development have not been fully explored.

The pleiotropic role of Hsps is based on one fundamental property, their ability to interact with proteins. Hsp70 and Hsp90 share two domains: a N-terminal ATPase domain and a C-terminal domain for protein–protein interactions. The C-terminal four amino acids, EEVD, endow Hsp70 and Hsp90 with a peptide-binding capacity, which is also required for protection against heat stress (Carrigan et al. 2006). During cancer progression, it is fundamental that Hsp family members cooperate with co-factors. The major co-chaperones of Hsp include BAG-1 (Bcl-2 associated athanogene-1), CHIP (C-terminal Hsp90 interacting protein), Hsp40, hip (Hsc70 interacting protein), hop (Hsp70-Hsp90 organizing protein), and p23. BAG-1 binding to Hsp70 was the first anti-apoptotic protein characterized (Doong et al. 2002; Stuart et al. 1998; Takayama et al. 1995). Hsp40 has been shown to bind unfolded proteins and transfer them to Hsp70 (Hartl and Hayer-Hartl 2002), and contains a J domain that is also maintained by several known oncogenes. Similarly, the family of TPR-containing proteins commonly binds to Hsps. A few TPR-containing proteins have had their binding partners identified and associated with cancer. For example, Hip modulates the Hsp70 chaperones by inhibiting their ATPase activity. By binding to Hsp70 and Hsp90, CHIP inhibits their chaperone activity that is involved in ubiquitin-mediated protein degradation. Hop is an adaptor protein of Hsp70 and Hsp90 which is part of the Hsp70/Hsp90 complex (Frydman and Hohfeld 1997).

In the present study, DYX1C1 is verified to be a co-chaperone of both Hsp70 and Hsp90. The role of DYX1C1 in the developing brain is being studied by a few groups and has been shown to play a role in the migration of neocortical neurons (Wang et al. 2006; Threlkeld et al. 2007). Transfection of N- and C-terminal truncations of DYX1C1 have demonstrated that the C-terminal TPR domain determines the intracellular localization of DYX1C1 to the cytoplasm and the nucleus, although these results were not consistent with data reported by Taipale et al. (2003; Wang et al. 2006). Additional experiments showed that the C-terminus of DYX1C1 is necessary and sufficient for DYX1C1’s function in migration (Wang et al. 2006). Therefore, these data support the significance of the C-terminal TPR domain of DYX1C1 in understanding the function of this gene. The unique domain at the N-terminus of DYX1C1, p23, further specializes the function of DYX1C1 compared to other TPR-containing proteins. P23, the smallest protein in Hsp90 co-chaperone complexes, serves as an important modulator of Hsp90 (Johnson et al. 1994; Johnson and Toft 1994) and stabilizes its ATP-bound form to facilitate the formation of Hsp90 chaperone complexes (Sullivan et al. 2002). However, p23 also participates in a host of cellular process independent of Hsp90 (Freeman et al. 2000; Freeman and Yamamoto 2002). Recent evidence reveals that p23 is degraded by caspases and proteasomes during apoptosis (Mollerup and Berchtold 2005), and is up-regulated following ischemia, in human cancer, and in metastatic tissue (Krebs et al. 2002; Li et al. 2000). Sugt1 is a protein that also contains p23 and TPR domains and has a role in kinetochore assembly in yeast. It is possible that DYX1C1 might have a similar function as Sugt1 (Steensgaard et al. 2004). The combination of functions predicted by both the N-terminal and C-terminal domains of DYX1C1 emphasizes the need for its characterization.

Our current study focuses on the function of the TPR domain of DYX1C1 in mediating interactions with Hsp70 and Hsp90 to provide some additional insight into the role of this protein. Sequence alignments of DYX1C1 showed that human DYX1C1exhibits a high degree of genetic homology among different species. DYX1C1 is also predominately overexpressed in malignant cancer tissues compared to paired adjacent normal tissue and benign tumor tissues. Protein interaction assays in vivo and in vitro verify that the TPR domain of DYX1C1 interacts with the C-terminal EEVD motif contained in both Hsp70 and Hsp90. Our study indicates that DYX1C1 might not only function in neural migration, but may also have an important role in regulating cell apoptosis and cell survival in association with Hsp70 and Hsp90.

It is well established that the chemokine CXCL12 plays a role in the proliferative phenotype of benign and malignant proliferative diseases of the breast and the prostate (Cabioglu et al. 2005). Recently, CXCL12 transcription was shown to regulate DYX1C1 in human prostate epithelia cells as modulated by ELK-1, a transcriptional signal of the early growth response-1 (EGR1) gene that facilitates tumor cell growth, angiogenesis, and cell survival (Begley et al. 2007; Adamson and Mercola 2002). Data that characterizes that interactions between CXCL12, ELK-1, and DYX1C1 strengthen our conclusion that DYX1C1 plays a role in cell proliferation and tumor progression. Latest research has suggested the similar conclusion that alternative transcripts of DYX1C1 might be used as a biomarker to detect specific cancer (Kim et al. 2009).

Given the molecular heterogeneity observed for cancer cells, Hsps represent a key factor in the modulation of co-chaperone proteins to endow cancer cells with a capacity for acquired resistance to apoptosis. Thus, the study of Hsp co-chaperones represents an important area of study which may identify valuable tumor markers and possible therapeutic targets. Recently, a number of Hsp90 inhibitors have entered phase 1 and 2 clinical trials and have a promising future in clinical application (Neckers and Neckers 2002; Neckers et al. 1999). Similarly, DYX1C1, the Hsp70 and Hsp90 co-chaperone, also has the potential to be applied in clinical diagnosis and treatment with additional study.

Conclusion

In summary, this study identified DYX1C1 as a co-chaperone of Hsp70 and Hsp90 and its overexpression in breast malignant tumor. We detected DYX1C1 overexpression in malignant breast tumor tissue compared to benign breast tumor tissue, and also detected a significant difference in expression of DYX1C1 in cancer tissue versus adjacent normal tissue. Moreover, this study confirmed the hypothesis that DYX1C1 can interact with Hsp70 and Hsp90 via its TPR domains using GST pull-down assays and yeast two-hybrid system, respectively. We also confirmed that the C-terminal residues of EEVD in Hsp70 and Hsp90 are the residues that specifically interact with DYX1C1. Based on our data, we hypothesize that the TPR domains of DYX1C1 mediate interactions between DYX1C1 and Hsp70 and Hsp90 to promote cell proliferation. Additional details of DYX1C1’s protein–protein interactions will continue to improve our understanding of the role of DYX1C1 in neuronal migration and other important, conserved roles that DYX1C1 may have.

Notes

Acknowledgments

This work was supported by China national 973 funds (No. G1999055901 and No. 2009CB941701), Program for Changjiang Scholars and Innovative Research Team in University and construction of medical key discipline and talent fostering strategy. Besides, we thank generous technical assistance from Professor Sha Jiahao.

References

  1. Adamson ED, Mercola D (2002) Egr1 transcription factor: multiple roles in prostate tumor cell growth and survival. Tumour Biol 23(2):93–102PubMedCrossRefGoogle Scholar
  2. Beere HM (2004) “The stress of dying”: the role of heat shock proteins in the regulation of apoptosis. J Cell Sci 117:2641–2651PubMedCrossRefGoogle Scholar
  3. Beere HM, Green DR (2001) Stress management—heat shock protein-70 and the regulation of apoptosis. Trends Cell Biol 11:6–10PubMedCrossRefGoogle Scholar
  4. Begley LA, MacDonald JW, Day ML, Macoska JA (2007) CXCL12 activates a robust transcriptional response in human prostate epithelial cells. J Biol Chem 282:26767–26774PubMedCrossRefGoogle Scholar
  5. Blatch GL, Lassle M (1999) The tetratricopeptide repeat: a structural motif mediating protein–protein interactions. Bioessays 21:932–939PubMedCrossRefGoogle Scholar
  6. Cabioglu N, Summy J, Miller C et al (2005) CXCL-12/stromal cell-derived factor-1alpha transactivates HER2-neu in breast cancer cells by a novel pathway involving Src kinase activation. Cancer Res 65:6493–6497PubMedCrossRefGoogle Scholar
  7. Calderwood SK, Khaleque MA, Sawyer DB, Ciocca DR (2006) Heat shock proteins in cancer: chaperones of tumorigenesis. Trends Biochem Sci 31:164–172PubMedCrossRefGoogle Scholar
  8. Cao Q, Chen J, Zhu L et al (2006) A testis-specific and testis developmentally regulated tumor protein D52 (TPD52)-like protein TPD52L3/hD55 interacts with TPD52 family proteins. Biochem Biophys Res Commun 344:798–806PubMedCrossRefGoogle Scholar
  9. Carrigan PE, Sikkink LA, Smith DF, Ramirez-Alvarado M (2006) Domain:domain interactions within Hop, the Hsp70/Hsp90 organizing protein, are required for protein stability and structure. Protein Sci 15:522–532PubMedCrossRefGoogle Scholar
  10. Chaix Y, Albaret JM, Brassard C et al (2007) Motor impairment in dyslexia: the influence of attention disorders. Eur J Paediatr Neurol 11:368–374PubMedCrossRefGoogle Scholar
  11. D’Andrea LD, Regan L (2003) TPR proteins: the versatile helix. Trends Biochem Sci 28:655–662PubMedCrossRefGoogle Scholar
  12. Doong H, Vrailas A, Kohn EC (2002) What’s in the ‘BAG’? A functional domain analysis of the BAG-family proteins. Cancer Lett 188:25–32PubMedCrossRefGoogle Scholar
  13. Elston CW, Ellis IO (1991) Pathological prognostic factors in breast cancer I. The value of histological grade in breast cancer: experience from a large study with long-term follow-up. Histopathology 19:403–410PubMedCrossRefGoogle Scholar
  14. Freeman BC, Yamamoto KR (2002) Disassembly of transcriptional regulatory complexes by molecular chaperones. Science 296:2232–2235PubMedCrossRefGoogle Scholar
  15. Freeman BC, Felts SJ, Toft DO, Yamamoto KR (2000) The p23 molecular chaperones act at a late step in intracellular receptor action to differentially affect ligand efficacies. Genes Dev 14:422–434PubMedGoogle Scholar
  16. Frydman J, Hohfeld J (1997) Chaperones get in touch: the Hip–Hop connection. Trends Biochem Sci 22:87–92PubMedCrossRefGoogle Scholar
  17. Gething MJ, Sambrook J (1992) Protein folding in the cell. Nature 355:33–45PubMedCrossRefGoogle Scholar
  18. Hartl FU, Hayer-Hartl M (2002) Molecular chaperones in the cytosol: from nascent chain to folded protein. Science 295:1852–1858PubMedCrossRefGoogle Scholar
  19. Jameel A, Skilton RA, Campbell TA, Chander SK, Coombes RC, Luqmani YA (1992) Clinical and biological significance of HSP89 alpha in human breast cancer. Int J Cancer 50:409–415PubMedCrossRefGoogle Scholar
  20. Johnson JL, Toft DO (1994) A novel chaperone complex for steroid receptors involving heat shock proteins, immunophilins, and p23. J Biol Chem 269:24989–24993PubMedGoogle Scholar
  21. Johnson JL, Beito TG, Krco CJ, Toft DO (1994) Characterization of a novel 23-kilodalton protein of unactive progesterone receptor complexes. Mol Cell Biol 14(3):1956–1963PubMedGoogle Scholar
  22. Jolly C, Morimoto RI (2000) Role of the heat shock response and molecular chaperones in oncogenesis and cell death. J Nat Cancer Inst 92:1564–1572PubMedCrossRefGoogle Scholar
  23. Kaur J, Ralhan R (1995) Differential expression of 70-kDa heat shock-protein in human oral tumorigenesis. Int J Cancer 63:774–779PubMedCrossRefGoogle Scholar
  24. Kim YJ, Huh JW, Kim DS et al (2009) Molecular characterization of the DYX1C1 gene and its application as a cancer biomarker. J Cancer Res Clin Oncol 135(2):265–270PubMedCrossRefGoogle Scholar
  25. Krebs J, Saremaslani P, Caduff R (2002) ALG-2: a Ca2+-binding modulator protein involved in cell proliferation and in cell death. Biochim Biophys Acta 1600:68–73PubMedGoogle Scholar
  26. Lane DP, Midgley C, Hupp T (1993) Tumour suppressor genes and molecular chaperones. Philos Trans R Soc B 339:369–372 discussion 72–73CrossRefGoogle Scholar
  27. Li W, Jin K, Nagayama T et al (2000) Increased expression of apoptosis-linked gene 2 (ALG2) in the rat brain after temporary focal cerebral ischemia. Neuroscience 96:161–168PubMedCrossRefGoogle Scholar
  28. Marino C, Giorda R, Luisa Lorusso M et al (2005) A family-based association study does not support DYX1C1 on 15q21.3 as a candidate gene in developmental dyslexia. Eur J Hum Genet 13:491–499PubMedCrossRefGoogle Scholar
  29. Miyata Y, Chambraud B, Radanyi C, et al. (1997) Phosphorylation of the immunosuppressant FK506-binding protein FKBP52 by casein kinase II: regulation of HSP90-binding activity of FKBP52. Proceedings of the National Academy of Sciences 94, 14500-5Google Scholar
  30. Moczko M, Bomer U, Kubrich M, Zufall N, Honlinger A, Pfanner N (1997) The intermembrane space domain of mitochondrial Tom22 functions as a trans binding site for preproteins with N-terminal targeting sequences. Mol Cell Biol 17:6574–6584PubMedGoogle Scholar
  31. Mollerup J, Berchtold MW (2005) The co-chaperone p23 is degraded by caspases and the proteasome during apoptosis. FEBS Lett 579:4187–4192PubMedCrossRefGoogle Scholar
  32. Neckers L, Neckers K (2002) Heat-shock protein 90 inhibitors as novel cancer chemotherapeutic agents. Expert Opin Emerg Drugs 7:277–288PubMedCrossRefGoogle Scholar
  33. Neckers L, Schulte TW, Mimnaugh E (1999) Geldanamycin as a potential anti-cancer agent: its molecular target and biochemical activity. Invest New Drugs 17:361–373PubMedCrossRefGoogle Scholar
  34. Nollen EA, Morimoto RI (2002) Chaperoning signaling pathways: molecular chaperones as stress-sensing ‘heat shock’ proteins. J Cell Sci 115:2809–2816PubMedGoogle Scholar
  35. Parcellier A, Gurbuxani S, Schmitt E, Solary E, Garrido C (2003) Heat shock proteins, cellular chaperones that modulate mitochondrial cell death pathways. Biochem Biophys Res Commun 304:505–512PubMedCrossRefGoogle Scholar
  36. Parsell DA, Lindquist S (1993) The function of heat-shock proteins in stress tolerance: degradation and reactivation of damaged proteins. Annu Rev Genet 27:437–496PubMedCrossRefGoogle Scholar
  37. Ramus F (2004) Neurobiology of dyslexia: a reinterpretation of the data. Trends Neurosci 27:720–726PubMedCrossRefGoogle Scholar
  38. Santarosa M, Favaro D, Quaia M, Galligioni E (1997) Expression of heat shock protein 72 in renal cell carcinoma: possible role and prognostic implications in cancer patients. Eur J Cancer 33:873–877PubMedCrossRefGoogle Scholar
  39. Scheufler C, Brinker A, Bourenkov G et al (2000) Structure of TPR domain-peptide complexes: critical elements in the assembly of the Hsp70-Hsp90 multichaperone machine. Cell 101:199–210PubMedCrossRefGoogle Scholar
  40. Sreedhar AS, Csermely P (2004) Heat shock proteins in the regulation of apoptosis: new strategies in tumor therapy: a comprehensive review. Pharmacol Ther 101:227–257PubMedCrossRefGoogle Scholar
  41. Steensgaard P, Garre M, Muradore I et al (2004) Sgt1 is required for human kinetochore assembly. EMBO Rep 5:626–631PubMedCrossRefGoogle Scholar
  42. Stuart JK, Myszka DG, Joss L et al (1998) Characterization of interactions between the anti-apoptotic protein BAG-1 and Hsc70 molecular chaperones. J Biol Chem 273:22506–22514PubMedCrossRefGoogle Scholar
  43. Sullivan WP, Owen BA, Toft DO (2002) The influence of ATP and p23 on the conformation of hsp90. J Biol Chem 277:45942–45948PubMedCrossRefGoogle Scholar
  44. Taipale M, Kaminen N, Nopola-Hemmi J et al (2003) A candidate gene for developmental dyslexia encodes a nuclear tetratricopeptide repeat domain protein dynamically regulated in brain. Proceedings of the National Academy of Sciences 100, 11553-8Google Scholar
  45. Takayama S, Sato T, Krajewski S et al (1995) Cloning and functional analysis of BAG-1: a novel Bcl-2-binding protein with anti-cell death activity. Cell 80:279–284PubMedCrossRefGoogle Scholar
  46. Threlkeld SW, McClure MM, Bai J et al (2007) Developmental disruptions and behavioral impairments in rats following in utero RNAi of Dyx1c1. Brain Res Bull 71:508–514PubMedCrossRefGoogle Scholar
  47. Tzamarias D, Struhl K (1995) Distinct TPR motifs of Cyc8 are involved in recruiting the Cyc8-Tup1 corepressor complex to differentially regulated promoters. Genes Dev 9:821–831PubMedCrossRefGoogle Scholar
  48. Wang Y, Paramasivam M, Thomas A et al (2006) DYX1C1 functions in neuronal migration in developing neocortex. Neuroscience 143:515–522PubMedCrossRefGoogle Scholar
  49. Wong HR, Wispe JR (1997) The stress response and the lung. Am J Physiol 273:L1–L9PubMedGoogle Scholar
  50. Yufu Y, Nishimura J, Nawata H (1992) High constitutive expression of heat shock protein 90 alpha in human acute leukemia cells. Leuk Res 16:597–605PubMedCrossRefGoogle Scholar
  51. Zeke T, Morrice N, Vazquez-Martin C, Cohen PT (2005) Human protein phosphatase 5 dissociates from heat-shock proteins and is proteolytically activated in response to arachidonic acid and the microtubule-depolymerizing drug nocodazole. Biochem J 385:45–56PubMedCrossRefGoogle Scholar

Copyright information

© Springer-Verlag 2009

Authors and Affiliations

  • Yuxin Chen
    • 1
  • Muzi Zhao
    • 1
  • Saiqun Wang
    • 1
  • Jie Chen
    • 1
  • Yun Wang
    • 1
  • Qinhong Cao
    • 2
  • Wenbin Zhou
    • 2
  • Jin Liu
    • 1
  • Zhiyang Xu
    • 1
  • Guoqing Tong
    • 3
  • Jianmin Li
    • 1
  1. 1.Lab of Reproductive Medicine, Department of Cell Biology and Medical GeneticsNanjing Medical UniversityNanjingPeople’s Republic of China
  2. 2.Department of Breast and Endocrine SurgeryJiangsu Province Hospital, The First Affiliated Hospital of Nanjing Medical UniversityNanjingPeople’s Republic of China
  3. 3.Department of Obstetrics and GynecologyNanjing Maternity and Child Health Care HospitalNanjingPeople’s Republic of China

Personalised recommendations