Planta

, Volume 239, Issue 3, pp 707–715 | Cite as

Spatial distribution of the RABBIT EARS protein and effects of its ectopic expression in Arabidopsis thaliana flowers

  • Seiji Takeda
  • Mariko Noguchi
  • Yuki Hamamura
  • Tetsuya Higashiyama
Original Article

Abstract

In many flowering plants, flowers consist of two peripheral organs, sepals and petals, occurring in outer two whorls, and two inner reproductive organs, stamens and carpels. These organs are arranged in a concentric pattern in a floral meristem, and the organ identity is established by the combined action of floral homeotic genes expressed along the whorls. Floral organ primordia arise at fixed positions in the floral meristem within each whorl. The RABBIT EARS (RBE) gene is transcribed in the petal precursor cells and primordia, and regulates petal initiation and early growth in Arabidopsis thaliana. We investigated the spatial and temporal expression pattern of a RBE protein fused to the green fluorescent protein (GFP). Expression of the GFP:RBE fusion gene under the RBEcis-regulatory genomic fragment rescues the rbe petal defects, indicating that the fusion protein is functional. The GFP signal is located to the cells where RBE is transcribed, suggesting that RBE function is cell-autonomous. Ectopic expression of GFP:RBE under the APETALA1 promoter causes the homeotic conversion of floral organs, resulting in sterile flowers. In these plants, the class B homeotic genes APETALA3 and PISTILLATA are down-regulated, suggesting that the restriction of the RBE expression to the petal precursor cells is crucial for flower development.

Keywords

APETALA1 APETALA3 Floral organ Homeotic genes Petal PISTILLATA 

Abbreviations

AP1

APETALA1

AP3

APETALA3

CAPS

Cleaved amplified polymorphic sequences

FM

Floral meristem

GFP

GREEN FLUORESCENT PROTEIN

IM

Inflorescence meristem

PI

PISTILLATA

PTL

PETAL LOSS

RBE

RABBIT EARS

SEP

SEPALLATA

TUB

TUBULIN

Introduction

Flowers play a major role in plant reproduction. Of the four floral organs, petals have evolved to be the most conspicuous, with their diverse shapes, colors, and fragrances, all serving to attract pollinators. The variety of petals also contributes to horticultural industries. Flowers have been extensively studied to understand plant organ morphogenesis. Much work has focused on the flowers of the model plant Arabidopsis thaliana, due to its small size, short lifecycle and useful genomic resources (Smyth et al. 1990; The Arabidopsis Genome Initiative 2000). During flower development, the inflorescence meristem (IM) generates floral meristem (FM) on its flanks, in which sepals arise in the outermost whorl and grow to cover the FM to protect the inner organs from the outer environment. Around the stage when sepals cover the FM, the primordia of petals, stamens, and carpels initiate.

Despite the wide variety of floral forms among species, their basic structure is surprisingly consistent. For example, the four types of floral organs are arranged in a concentric pattern in many flowering plants. The floral organ identity is established in a concentric pattern by the combined action of transcription factors, encoded by floral homeotic genes. This system is called the floral ABCE model or quartet model, since multimeric protein complexes of the four-class floral homeotic factors are involved: class A and E determine the sepal identity; A, B and E the petal identity; B, C and E the stamen identity; C and E the carpel identity (Theissen and Saedler 2001). In A. thaliana, class A genes are APETALA1 (AP1) and APETALA2 (AP2), class B are APETALA3 (AP3) and PISTILLATA (PI), class C is AGAMOUS (AG), and class E are SEPALLATA1 (SEP1), SEP2, SEP3 and SEP4 (Bowman et al. 1989; Weigel and Meyerowitz 1994; Krizek and Fletcher 2005). AP2 encodes an AP2/ERF-type transcription factor, and the others encode MADS-box transcription factors (Weigel and Meyerowitz 1994; Krizek and Fletcher 2005). Some other genes are known to regulate the expression of the floral homeotic genes, especially the class C gene AG, suggesting their involvement in the fine-tuning of the floral organ identity (Liu and Meyerowitz 1995; Byzova et al. 1999; Conner and Liu 2000; Krizek et al. 2000, 2006; Franks et al. 2002; Sridhar et al. 2004; Xing et al. 2005; Grigorova et al. 2011).

Although the homeotic genes are expressed in a concentric pattern (Mandel et al. 1992; Goto and Meyerowitz 1994; Jofuku et al. 1994; Hill et al. 1998; Busch et al. 1999; Krizek and Fletcher 2005), the floral organs initiate at fixed positions within each whorl (cf Fig. 2a). In A. thaliana, sepals arise on the adaxial and abaxial sides of the medial domain, and the other two form on the lateral sides. Petals initiate next to the sepal boundary region in the inner neighboring whorl, suggesting that positional information is transferred from the sepal boundary to the petal primordia, and thus indicating a positional-determinant mechanism of floral organogenesis. Several genes seem to be transcribed in this position-dependent manner. PETAL LOSS (PTL), expressed at the sepal boundary, encodes a trihelix DNA binding transcription factor and inhibits the growth of the sepal boundary by affecting the auxin dynamics (Griffith et al. 1999; Brewer et al. 2004; Lampugnani et al. 2012, 2013). ROXY1, encoding a member of the glutaredoxin family, is expressed in the primordia of flowers, sepals, and petals (Xing et al. 2005). The RABBIT EARS (RBE) gene encodes a C2H2-type zinc finger protein and is expressed in precursor cells and the primordia of petals (Takeda et al. 2004). RBE is involved in repressing the transcription of AG and miR164c (Krizek et al. 2006; Huang et al. 2012). Genetic ablation of RBE-expressing cells results in a complete lack of petals, suggesting that the RBE-expressing region contains cells that are recruited to the petal primordia (Takeda et al. 2004). The expression of these genes has been analyzed at the level of transcription, but the protein distribution and subcellular localization during organ development needs to be analyzed in order to understand the function of the transcription factors.

Here we examine the temporal and spatial expression pattern of the RBE protein with the use of fluorescent protein and effects of ectopic expression in flowers. Our data suggest that RBE function is cell-autonomous and that restriction of RBE expression to petal primordia is crucial for proper floral organ development.

Materials and methods

Plant growth conditions

The Columbia (Col-0) ecotype (ABRC stock) and rbe-1 (Landsberg erecta background, lab stock) (Takeda et al. 2004) of A. thaliana were used for generating transgenic plants. Plants were grown on vermiculite in small pots under continuous white light under the long day condition (16 h light and 8 h dark) at 22–24 °C.

rbe-1 CAPS marker

DNA was extracted according to the Edwards’ method (Edwards et al. 1991). A part of the RBE genomic fragment was amplified by PCR with RBEp500_F_HindIII and RBEg*R_SacI primers (Table 1), and digested with DdeI to see the difference of the band pattern between wild type and rbe-1.
Table 1

Oligonuleotides sequences used in this work (5′-3′)

RBE CAPS primers

 RBEp500_F_HindIII

TTCCGAAAGCTTATGGTGTATATTTTAGACTCC

 RBEg*R_SacI

GGAGTCGAGCTCCTAGTTAACCTTAGGCGGATC

Cloning primers

 RBEpF_HindIII

CGCTAAGCTTGTCGACGAGAGTGTTTTGAACAAT

 RBEpR_BamHI

CGGGATCCATGTAAGATTTTTCTATGCAGTAG

 RBEgF_KpnI

GGGGTACCATGATGGATAGAGGAGAATGCTTG

 RBEtR_EcoRI

CGGAATTCCTTTCACTTTCCTATTGTATGCAT

 GCFP_F_BamHI

CGGGATCCATGGTGAGCAAGGGCGAGGAGCTG

 GCFPwos_R_5Gly_KpnI

GGGGTACCTCCACCTCCACCTCCCTTGTACAGCTCGTCCATGCC

 APlp_F_PstI

AAACTGCAGGTAACCGTATCTTAGTGGATCGAG

 APlp_R_BamHI

CGGGATCCAGACTTTGGTATGAACCAATTAGG

RT-PCR primers

 RBE_RT_F

CGGATGGGACTTTATTTTGG

 RBE_RT_R

CGGGATCCGTTAACCTTAGGCGGATCAGCT

 API_RT_F

ATCAATAGACAAGTGACATTCTCG

 API_RT_R

TCATTGCCATAGGATCATCTTCTT

 AP3_RT_F

CTAGCTCCAACAAGCTTCATGAGT

 AP3_RT_R

AGTCCATAGTGAGGATCTTCAGCT

 PI_RT_F

GGACCAATACCAGAAGTTATCTGG

 PI_RT_R

TCATTCCTCTTGCGTTGCTTGCTA

 SEP1_RT_F

TCATCATCTTCTCCAACGTGGAA

 SEP1_RT_R

CCTGTCATCATCATCATCATCACC

 SEP2_RT_F

TTCTGTTCTCTGCGATGCTGAAGT

 SEP2_RT_R

TCTGAGCACACTGGATGGCTATAT

 SEP3_RT_F

AGTGTAACTATGGAGCACCAGAAC

 SEP3_RT_R

ATTATTCACACTTGGTCCTGCTCC

 AG_RT_F

CACCGGATCGGTGGCAGAAATTAATGC

 AG_RT_R

GGATCGGATTCGGGTAATACTTCTCTC

Plasmid construction and transformation

The oligonucleotide primers used for plasmid construction are listed in Table 1. To generate RBEp:GFP:RBEg, the GFP was amplified with GCFP_F_BamHI and GCFPwos_R_5Gly_KpnI primers, digested with BamHI and KpnI, and cloned into pAN19, a modified pUC19 vector carrying the AseI and NotI restriction sites (a gift from Takehide Kato, NAIST, Japan), to generate pAN19_GFPwos_5Gly. The 1.8 kb promoter of RBE was amplified with RBEpF_HindIII and RBEpR_BamHI, digested by BamHI and HindIII, and 2.6 kb genomic fragments including coding sequence and terminator of RBE gene were amplified with RBEgF_KpnI and RBEtR_EcoRI, and digested with KpnI and EcoRI. These fragments were cloned into pAN19_GFPwos_5Gly to generate RBEp:GFP:RBEg. Instead of RBE promoter the 2.0 kb promoter region of APETALA1 was amplified with AP1p_F_PstI and AP1p_R_BamHI, digested with BamHI and PstI, and cloned to generate AP1p:GFP:RBEg. These cassettes were subcloned into the binary vector pBIN30, a modified pBIN19 vector (a gift from T. Kato, NAIST, Japan). The constructed plasmids were transformed into Agrobacterium tumefaciens strain GV3101 (pMP90) and then into plants by the floral-dip method (Clough and Bent 1998).

Microscopy

Images were captured using an S8AP0 binocular microscope equipped with an EC3 digital camera system (Leica) for flowers, and fluorescent images were taken with an Axioimager M1 microscope equipped with an AxioCam MRc5 digital camera system (Carl Zeiss), LSM780 confocal laser scanning microscopy (Carl Zeiss), or Nikon ECLIPSE E600 microscope equipped with confocal D-ECLIPSE C1si system.

RT-PCR

Five inflorescences from each line were pooled for each RNA sample. RNA was isolated with TRIzol (Life Technologies) and treated with DNaseI (Life Technologies). One microgram of total RNA was reverse-transcribed with the Advantage RT kit for PCR (Clontech). One microliter of diluted cDNA was used for the subsequent PCR reactions. Oligonucleotide primers sequences used for RT-PCR are listed in Table 1. The reaction conditions were 55 or 60 °C with 30 s extension.

Accession number of genes

RABBIT EARS: At5g06070, APETALA1: At1g69120, APETALA3: At3g54340, PISTILLATA: At5g20240, AGAMOUS: At4g18960, SEPALLATA2: At3g02310, SEPALLATA3: At1g24260, TUBULIN BETA CHAIN 4: At5g44340.

Results

Spatial distribution of RBE protein in flowers

To examine the spatial and temporal expression and subcellular localization of the RBE protein during petal primordia initiation, we made a RBEp:GFP:RBEg construct that expresses the GFP:RBE fusion gene under the control of the RBE native promoter and has a 3′ region containing a putative terminator (Fig. 1). This construct was transformed to rbe-1 homozygous plants. No positive T1 plants were obtained, probably due to the production of few seeds in rbe-1 homozygous mutant (Takeda et al. 2004; Krizek et al. 2006). Therefore we transformed to the rbe-1 heterozygous plants, which segregate in the T1 generation. Five plants were obtained from T1 screening, of these one line was heterozygous for the rbe-1 locus, whilst the others were wild-type background. The heterozygous line segregated in T2 generation and we confirmed their genotype by the CAPS marker for the rbe-1 mutation (see “Materials and methods”). In the rbe-1 homozygous background, four petals are formed normally (Fig. 2b, c), suggesting that the GFP:RBE fusion gene is functional. We checked the intensity of the GFP:RBE fluorescent signal in inflorescences and found that, though faint, it was located to each of the four regions corresponding to the petal primordia (data not shown). We also transformed Col plants using the same construct and obtained 14 transgenic plants, exhibiting the similar fluorescent pattern to the rbe-1 background plants but with a stronger signal than them, so that we used these lines for further analysis. The fluorescent signal of GFP was detected in cells corresponding to the petal precursor and primordia cells (Fig. 2d, e), where RBE is transcribed (Takeda et al. 2004). The z-stack image from a series of optical transverse sections of a stage 4 flower showed localization of the RBE protein to the nuclei of petal precursor cells (Fig. 2f; Online Resource 1), supporting the function of RBE as a transcription factor. Together, the data suggest that the RBE protein is expressed in petal precursor cells and regulates the petal primordia initiation in a cell-autonomous manner.
Fig. 1

Schematic diagram of RBE genomic region and construction. RBE genomic fragment contains 1.8 kb promoter (RBEp), 0.7 kb coding sequence (RBEg), and 1.9 kb 3′ region (RBEter). For RBEp:GFP:RBEg construct, GFP is inserted between RBEp and RBEg. The RBEp is swapped to the 2.0 kb APETALA1 promoter (AP1p) for AP1p:GFP:RBEg construct. Note the existence of the CArG box in downstream of RBE, which is not included in the constructs

Fig. 2

Spatial and temporal expression of RBE protein. a Floral diagram. IM inflorescence meristem. brbe-1 flower. Note the defective development of two petals. cRBEp:GFP:RBEg flower in rbe-1 homozygous background. Note that the petal development is restored. Fluorescent image of longitudinal (d) or transverse (e) stage 4 flowers expressing the GFP:RBE fusion protein. f Z-stack image from serial transverse optical sections of stage 4 flower. Note the GFP:RBE localization in nuclei. Arrowheads show the localization of GFP:RBE in petal precursor cells. giRBEp:GFP:RBEg ovules in Col background. g GFP:RBE is expressed in inner integuments. h, i GFP:RBE is expressed in several cells of nucellus, in addition to inner integument cells. i Merged image of (h) and bright-field image. se sepals, n nucellus, ii inner integument, oi outer integument. Bars 1 mm (b, c), 50 μm (d, e), 20 μm (fi)

RBE is expressed in integuments of ovules and regulates their development (Krizek et al. 2006). In RBEp:GFP:RBEg plants, the GFP:RBE fluorescent signal was detected in inner integuments (Fig. 2g–i). The GFP:RBE was also detected in several cells of nucellus, where the RBE transcripts expression has not been reported (Fig. 2h, i). This suggests that RBE is expressed in nucellus at low level, or RBE protein moves to the nucellus cells.

GFP:RBE expression under the APETALA1 promoter causes the homeotic conversion of floral organs

RBE expression is limited to petal precursor cells during the early stages of flower development, but the importance of this restriction remains unknown. To examine the effect of the ectopic expression of RBE, we generated transgenic plants expressing the GFP:RBE fusion gene under the APETALA1 (AP1) promoter (AP1p:GFP:RBEg, Fig. 1). AP1 is expressed throughout the floral meristem at stage 1 and 2, and restricted to the outer two whorls afterwards (Mandel et al. 1992; Gustafson-Brown et al. 1994; Urbanus et al. 2009). The construct was transformed into Col wild type, and 47 independent T1 plants were obtained from screening. We counted the organ number of ten lines, and according to the severity of the flower phenotype we classified all lines into three classes (Table 2). Seven lines were indistinguishable from wild type. Fourteen lines were classified as mild, since they produced almost normal number of sepals and petals, but fewer stamens and more carpels (Fig. 3a; Table 2). Some lines generated carpelloid sepals, filamentous organs, sepalloid petals and unfused carpels, which do not occur in wild-type flowers (Table 2). The other 26 lines had severe defects, such as reduction of sepals, petals and stamens, but increased number of carpels (Table 2). In many flowers, the 2nd and 3rd whorl organs were often replaced by unfused carpel-likes (Fig. 3c; Table 2). The plants with mild or severe defects were sterile, probably due to the reduced number of stamens or aberrant structure of gynoecium. In these severe lines, RBE expression was increased compared to the wild-type like or mild lines (Fig. 4). AP1 expression was not affected in severe lines (Fig. 4), suggesting that the flower defects were not due to the cosuppression of AP1. The homeotic conversions suggest that RBE has affected the expression of class B MADS-box genes. Indeed, AP3 and PI expression was reduced in mild and severe lines (Fig. 4), suggesting that RBE misexpression influences the floral organ development by affecting the class B gene expression.
Table 2

Floral organ number in AP1 p:GFP:RBE lines (Col background, T1 generation)

 

First whorl

Second whorl

Third whorl

Fourth whorl

Severity

Sepal

Carpelloid sepala

Filamenta

Petal

Sepalloid petala

Stamen

Unfused carpela

Fused carpel

_

Col

4 ± 0

0

0

4 ± 0

0

5.73 ± 0.12

0

2 ± 0

#1

4 ± 0

0

0

4 ± 0

0

6 ± 0

0

2 ± 0

WT-like

#2

4.07 ± 0.67

0

0

3.93 ± 0.67

0.07 ± 0.67

4.87 ± 0.19

0.40 ± 0.16

3.47 ± 0.17

Mild

#8

4.33 ± 0.19

0.07 ± 0.07

0.07 ± 0.07

3.93 ± 0.15

0.13 ± 0.09

1.00 ± 0.32

0.47 ± 0.22

4.20 ± 0.17

Mild

#3

4.07 ± 0.32

0.53 ± 0.29

0.07 ± 0.07

0.60 ± 0.21

0.40 ± 0.19

0.07 ± 0.07

0.33 ± 0.16

3.73 ± 0.25

Severe

#4

2.67 ± 0.57

0.87 ± 0.29

0

0

0

0

0.73 ± 0.33

4.00 ± 0.22

Severe

#5

2.27 ± 0.43

0.67 ± 0.27

0.27 ± 0.15

0

0

0

0.87 ± 0.36

3.33 ± 0.29

Severe

#6

3.20 ± 0.43

0.67 ± 0.30

0.13 ± 0.13

0.27 ± 0.18

0

0

0.40 ± 0.16

3.27 ± 0.12

Severe

#7

3.60 ± 0.43

0.53 ± 0.26

0.07 ± 0.07

0.73 ± 0.23

0.07 ± 0.07

0

0.87 ± 0.29

3.07 ± 0.15

Severe

#9

2.73 ± 0.38

0.07 ± 0.07

0.07 ± 0.07

0

0.13 ± 0.09

0

1.73 ± 0.33

3.33 ± 0.13

Severe

#10

4.27 ± 0.28

0.20 ± 0.14

0.53 ± 0.27

0.20 ± 0.11

0

0

0.40 ± 0.19

3.47 ± 0.27

Severe

Fifteen flowers are examined in each line

Numbers indicate the average organ number ± SE

aAbnormal organs that do not occur in wild-type flowers

Fig. 3

AP1p:GFP:RBEg flower phenotype. acAP1p:GFP:RBEg in Col background. a Flower with mild defects generating less number of petals and stamens, and more carpels. b Flower with severe defects, forming less petals and stamens. Arrowhead indicates the petal with anther-like structure. c Flower with severe defects, generating no petals or stamens but forming the unfused carpels in the third whorl. df Flowers of AP1p:GFP:RBEg in rbe-1 heterozygous background. d The second whorl organs are transformed to sepals. e The chimeric organ of sepal and petal is formed in the second whorl (arrowhead). f Unfused carpels are formed instead of stamens, showing the ovule formation along the edge. gi Flowers of AP1p:GFP:RBEg in rbe-1 homozygous background. g, h Petal development is restored and the third whorl organs are homeotically converted to unfused carpels. i Stamen-like organ in the third organ is fused to carpels in the fourth whorl (arrowheads). Sepals are removed to show the inside of the flowers in b and e. Bars 1 mm

Fig. 4

Gel image of the RT-PCR in AP1p:GFP:RBEg plants (Col background, T1 generation). 1 WT-like lines, 2 mild lines, 3 severe lines. PCR cycles are indicated

To investigate the effects of the transgene in rbe mutant background, we transformed the AP1p:GFP:RBEg construct in the rbe-1 heterozygous plants. We obtained 6 independent T1 plants, all of which showed the flower defects shown below. We selected the rbe-1 heterozygous and homozygous lines using the CAPS marker and examined the floral phenotype. In the AP1p:GFP:RBEg in rbe-1 heterozygous plants, the second whorl organs were converted to sepals (Fig. 3d) or a sepal/petal chimeric organ (Fig. 3e). The stamens were transformed to carpels, exhibiting ovule production along the margin (Fig. 3f). These defects were also seen in the wild-type background (Fig. 3c). When AP1p:GFP:RBEg was expressed in the rbe-1 homozygous background, the wild-type petal development was restored (Fig. 3g–i), supporting the hypothesis that the GFP:RBE fusion gene is functional. In addition to the petal restoration, the third whorl stamens were converted to carpel-like organs (Fig. 3h, i), similar to the AP1p:GFP:RBEg in rbe-1 heterozygous or Col flowers. In some flowers, stamens are transformed to a stamen/carpel chimeric organ, fusing to the carpel (Fig. 3i). The expression of the class B genes AP3 and PI are drastically down-regulated in AP1p:GFP:RBEg in rbe-1 heterozygous plants (Online resource 2), supporting our hypothesis that RBE misexpression affects development of the second and third whorl organs.

Discussion

The spatial and temporal regulation of gene expression is the central process for plant development. Recent developments in fluorescent proteins and laser microscopes enable us to examine the dynamics of gene expression easier than before, in addition to the in situ hybridization and promoter-reporter assays. GFP is one of the most useful tools to examine the protein expression and subcellular localization in living organisms. Here we show that the RBE protein accumulates in nuclei of the petal precursor cells, where RBE is transcribed, suggesting that RBE acts in cell-autonomous manner during petal development.

The expression of RBE by AP1 promoter results in the suppression of class B genes AP3 and PI, causing the homeotic conversion of petals and stamens. We also expressed the GFP:RBE fusion genes in Col plants under the AP3 promoter or cis-regulatory genomic elements of AG, but they showed no phenotype (data not shown). The AP1 promoter induces the expression throughout the floral meristem from as early as stage 1, while the AP3 and AG expression starts after stage 3, when the floral organ starts initiation (Jack et al. 1992; Mandel et al. 1992; Hill et al. 1998; Busch et al. 1999; Urbanus et al. 2009). It is likely that the expression of RBE throughout the floral meristem at early stages affects the floral organ identity, suggesting that the restriction of RBE expression to petal precursor cells at early stages is required for the proper flower development. The phenotype of the AP1p:GFP:RBEg flowers were different from DEX-induced flowers of 35S:GR:RBE, which had small floral organs without homeotic conversion (Huang et al. 2012). This may be due to difference of the promoter activity or procedure for the induction system of the gene expression.

It has recently been reported that AP3 and PI can bind to a site nearly 2 kb downstream from the RBE gene, and that down-regulation of AP3 and PI leads to the suppression of RBE expression, suggesting that RBE is the direct target of AP3 and PI (Wuest et al. 2012). We found that the RBE downstream region contains the CArG box-like sequence, a binding site of MADS transcription factors, but this is out of the genomic fragment that complement the rbe phenotype (Fig. 1; Takeda et al. 2004). Moreover, RBE is expressed and active in the ap3 mutant, since the double mutant of rbe-1 ap35 shows an additive phenotype (Takeda et al. 2004). Therefore, although AP3 and PI are able to activate the RBE expression directly, this regulation may play a minor role in the development of the second whorl organ. Since RBE is expressed in a cup-shaped domain in some stage 3 flowers (Krizek et al. 2006), AP3 and PI may regulate the RBE expression at this stage. Similar homeotic conversion is reported in double mutants of HD-ZIP IV family genes, PROTODERMAL FACTOR 2 (PDF2) combined with HOMEODOMAIN GLABROUS1 (HDG1), HDG5 or HDG12 (Kamata et al. 2013), suggesting the possibility that RBE regulates AP3/PI expression through these genes. We have checked the expression level of these genes in the transcriptome data from 35S:GR:RBE plants, where the putative RBE downstream genes are listed (Huang et al. 2012), but we did not find a significant change of the genes, suggesting that they are likely to be involved in the distinct developmental processes.

PTL is also involved in petal initiation, but is expressed in sepal boundaries, suggesting that PTL acts in a non-cell autonomous manner (Griffith et al. 1999; Brewer et al. 2004). When expressed under the AP1 promoter, PTL causes flowers to arrest at early stages of development (Brewer et al. 2004), indicating the distinct effect from RBE ectopic expression. PTL is involved in growth inhibition in sepal boundaries, and regulates the petal development by affecting the auxin signaling pathway (Li et al. 2008; Lampugnani et al. 2012, 2013). Both the ptl and rbe mutants have similar petal defects, and the ptl rbe double mutant is indistinguishable from each single mutant (Griffith et al. 1999; Takeda et al. 2004; Lampugnani et al. 2013). Together, these data suggest that PTL and RBE have similar but distinct functions during petal initiation. RBE is involved in the direct repression of the miR164c, which is known to be a negative regulator of CUP-SHAPED COTYLEDON1 (CUC1) and CUC2 (Mallory et al. 2004; Baker et al. 2005; Nikovics et al. 2006). CUC1 and CUC2 are master regulators of the organ boundary establishment of both the vegetative and reproductive organs (Aida et al. 1997; Ishida et al. 2000; Takada et al. 2001), and these mutations enhance the sepal fusion in ptl and rbe mutants (Brewer et al. 2004; Krizek et al. 2006; Huang et al. 2012; Lampugnani et al. 2012). One of the future works is to investigate the molecular link between sepal boundaries and petal primordia by analyzing these regulatory factors in order to understand the spatial regulation of the petal initiation process.

Notes

Acknowledgments

We thank Mitsuhiro Aida, Takehide Kato (NAIST, Japan), Tetsu Kinoshita (Nagahama Institute of Bio-Science and Technology, Japan), Mie Ichikawa, Masahiko Sato, Takashi Shiina (Kyoto Prefectural University, Japan), and Kiyotaka Okada (NIBB, Japan) for providing materials and helpful discussion, and Rebecca Horn for critical reading of the manuscript. This research was supported by Japan Advanced Plant Science Network and funded by JSPS KAKENHI grant number 22570042 (S.T.).

Conflict of interest

The authors declare that they have no conflict of interest.

Supplementary material

Supplementary material 1 (MPG 241359 kb)

425_2013_2010_MOESM2_ESM.tif (1.8 mb)
Supplementary material 2 (TIFF 1888 kb)

References

  1. Aida M, Ishida T, Fukaki H, Fujisawa H, Tasaka M (1997) Genes involved in organ separation in Arabidopsis: an analysis of the cup-shaped cotyledon mutant. Plant Cell 9:841–857PubMedCentralPubMedCrossRefGoogle Scholar
  2. Baker CC, Sieber P, Wellmer F, Meyerowitz EM (2005) The early extra petals1 mutant uncovers a role for microRNA miR164c in regulating petal number in Arabidopsis. Curr Biol 15:303–315PubMedCrossRefGoogle Scholar
  3. Bowman JL, Smyth DR, Meyerowitz EM (1989) Genes directing flower development in Arabidopsis. Plant Cell 1:37–52PubMedCentralPubMedGoogle Scholar
  4. Brewer PB, Howles PA, Dorian K, Griffith ME, Ishida T, Kaplan-Levy RN, Kilinc A, Smyth DR (2004) PETAL LOSS, a trihelix transcription factor gene, regulates perianth architecture in the Arabidopsis flower. Development 131:4035–4045PubMedCrossRefGoogle Scholar
  5. Busch MA, Bomblies K, Weigel D (1999) Activation of a floral homeotic gene in Arabidopsis. Science 285:585–587PubMedCrossRefGoogle Scholar
  6. Byzova MV, Franken J, Aarts MG, de Almeida-Engler J, Engler G, Mariani C, Van LookerenCampagne MM, Angenent GC (1999) Arabidopsis STERILE APETALA, a multifunctional gene regulating inflorescence, flower, and ovule development. Genes Dev 13:1002–1014PubMedCrossRefGoogle Scholar
  7. Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16:735–743PubMedCrossRefGoogle Scholar
  8. Conner J, Liu Z (2000) LEUNIG, a putative transcriptional corepressor that regulates AGAMOUS expression during flower development. Proc Natl Acad Sci USA 97:12902–12907PubMedCrossRefGoogle Scholar
  9. Edwards K, Johnstone C, Thompson C (1991) A simple and rapid method for the preparation of plant genomic DNA for PCR analysis. Nucleic Acids Res 19:1349PubMedCentralPubMedCrossRefGoogle Scholar
  10. Franks RG, Wang C, Levin JZ, Liu Z (2002) SEUSS, a member of a novel family of plant regulatory proteins, represses floral homeotic gene expression with LEUNIG. Development 129:253–263PubMedGoogle Scholar
  11. Goto K, Meyerowitz EM (1994) Function and regulation of the Arabidopsis floral homeotic gene PISTILLATA. Genes Dev 8:1548–1560PubMedCrossRefGoogle Scholar
  12. Griffith ME, da Silva Conceicao A, Smyth DR (1999) PETAL LOSS gene regulates initiation and orientation of second whorl organs in the Arabidopsis flower. Development 126:5635–5644PubMedGoogle Scholar
  13. Grigorova B, Mara C, Hollender C, Sijacic P, Chen X, Liu Z (2011) LEUNIG and SEUSS co-repressors regulate miR172 expression in Arabidopsis flowers. Development 138:2451–2456PubMedCrossRefGoogle Scholar
  14. Gustafson-Brown C, Savidge B, Yanofsky MG (1994) Regulation of the arabidopsis floral homeotic gene APETALA1. Cell 76:131–143PubMedCrossRefGoogle Scholar
  15. Hill TA, Day CD, Zondlo SC, Thackeray AG, Irish VF (1998) Discrete spatial and temporal cis-acting elements regulate transcription of the Arabidopsis floral homeotic gene APETALA3. Development 125:1711–1721PubMedGoogle Scholar
  16. Huang T, Lopez-Giraldez F, Townsend JP, Irish VF (2012) RBE controls microRNA164 expression to effect floral organogenesis. Development 139:2161–2169PubMedCrossRefGoogle Scholar
  17. Ishida T, Aida M, Takada S, Tasaka M (2000) Involvement of CUP-SHAPED COTYLEDON genes in gynoecium and ovule development in Arabidopsis thaliana. Plant Cell Physiol 41:60–67PubMedCrossRefGoogle Scholar
  18. Jack T, Brockman LL, Meyerowitz EM (1992) The homeotic gene APETALA3 of Arabidopsis thaliana encodes a MADS box and is expressed in petals and stamens. Cell 68:683–697PubMedCrossRefGoogle Scholar
  19. Jofuku KD, den Boer BG, Van Montagu M, Okamuro JK (1994) Control of Arabidopsis flower and seed development by the homeotic gene APETALA2. Plant Cell 6:1211–1225PubMedCentralPubMedGoogle Scholar
  20. Kamata N, Okada H, Komeda Y, Takahashi T (2013) Mutations in epidermis-specific HD-ZIP IV genes affect floral organ identity in Arabidopsis thaliana. Plant J 75:430–440PubMedCrossRefGoogle Scholar
  21. Krizek BA, Fletcher JC (2005) Molecular mechanisms of flower development: an armchair guide. Nat Rev Genet 6:688–698PubMedCrossRefGoogle Scholar
  22. Krizek BA, Prost V, Macias A (2000) AINTEGUMENTA promotes petal identity and acts as a negative regulator of AGAMOUS. Plant Cell 12:1357–1366PubMedCentralPubMedGoogle Scholar
  23. Krizek BA, Lewis MW, Fletcher JC (2006) RABBIT EARS is a second-whorl repressor of AGAMOUS that maintains spatial boundaries in Arabidopsis flowers. Plant J 45:369–383PubMedCrossRefGoogle Scholar
  24. Lampugnani ER, Kilinc A, Smyth DR (2012) PETAL LOSS is a boundary gene that inhibits growth between developing sepals in Arabidopsis thaliana. Plant J 71:724–735PubMedCrossRefGoogle Scholar
  25. Lampugnani ER, Kilinc A, Smyth DR (2013) Auxin controls petal initiation in Arabidopsis. Development 140:185–194PubMedCrossRefGoogle Scholar
  26. Li X, Qin G, Chen Z, Gu H, Qu LJ (2008) A gain-of-function mutation of transcriptional factor PTL results in curly leaves, dwarfism and male sterility by affecting auxin homeostasis. Plant Mol Biol 66:315–327PubMedCrossRefGoogle Scholar
  27. Liu Z, Meyerowitz EM (1995) LEUNIG regulates AGAMOUS expression in Arabidopsis flowers. Development 121:975–991PubMedGoogle Scholar
  28. Mallory AC, Dugas DV, Bartel DP, Bartel B (2004) MicroRNA regulation of NAC-domain targets is required for proper formation and separation of adjacent embryonic, vegetative, and floral organs. Curr Biol 14:1035–1046PubMedCrossRefGoogle Scholar
  29. Mandel MA, Gustafson-Brown C, Savidge B, Yanofsky MF (1992) Molecular characterization of the Arabidopsis floral homeotic gene APETALA1. Nature 360:273–277PubMedCrossRefGoogle Scholar
  30. Nikovics K, Blein T, Peaucelle A, Ishida T, Morin H, Aida M, Laufs P (2006) The balance between the MIR164A and CUC2 genes controls leaf margin serration in Arabidopsis. Plant Cell 18:2929–2945PubMedCentralPubMedCrossRefGoogle Scholar
  31. Smyth DR, Bowman JL, Meyerowitz EM (1990) Early flower development in Arabidopsis. Plant Cell 2:755–767PubMedCentralPubMedGoogle Scholar
  32. Sridhar VV, Surendrarao A, Gonzalez D, Conlan RS, Liu Z (2004) Transcriptional repression of target genes by LEUNIG and SEUSS, two interacting regulatory proteins for Arabidopsis flower development. Proc Natl Acad Sci USA 101:11494–11499PubMedCrossRefGoogle Scholar
  33. Takada S, Hibara K, Ishida T, Tasaka M (2001) The CUP-SHAPED COTYLEDON1 gene of Arabidopsis regulates shoot apical meristem formation. Development 128:1127–1135PubMedGoogle Scholar
  34. Takeda S, Matsumoto N, Okada K (2004) RABBIT EARS, encoding a SUPERMAN-like zinc finger protein, regulates petal development in Arabidopsis thaliana. Development 131:425–434PubMedCrossRefGoogle Scholar
  35. The Arabidopsis Genome Initiative (2000) Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408:796–815CrossRefGoogle Scholar
  36. Theissen G, Saedler H (2001) Plant biology. Floral quartets. Nature 409:469–471PubMedCrossRefGoogle Scholar
  37. Urbanus SL, de Folter S, Shchennikova AV, Kaufmann K, Immink RG, Angenent GC (2009) In planta localisation patterns of MADS domain proteins during floral development in Arabidopsis thaliana. BMC Plant Biol 9:5PubMedCentralPubMedCrossRefGoogle Scholar
  38. Weigel D, Meyerowitz EM (1994) The ABCs of floral homeotic genes. Cell 78:203–209PubMedCrossRefGoogle Scholar
  39. Wuest SE, O’Maoileidigh DS, Rae L, Kwasniewska K, Raganelli A, Hanczaryk K, Lohan AJ, Loftus B, Graciet E, Wellmer F (2012) Molecular basis for the specification of floral organs by APETALA3 and PISTILLATA. Proc Natl Acad Sci USA 109:13452–13457PubMedCrossRefGoogle Scholar
  40. Xing S, Rosso MG, Zachgo S (2005) ROXY1, a member of the plant glutaredoxin family, is required for petal development in Arabidopsis thaliana. Development 132:1555–1565PubMedCrossRefGoogle Scholar

Copyright information

© Springer-Verlag Berlin Heidelberg 2013

Authors and Affiliations

  • Seiji Takeda
    • 1
    • 2
  • Mariko Noguchi
    • 1
  • Yuki Hamamura
    • 3
  • Tetsuya Higashiyama
    • 4
    • 5
  1. 1.Cell and Genome Biology, Graduate School of Life and Environmental SciencesKyoto Prefectural UniversitySoraku-gunJapan
  2. 2.Biotechnology Research DepartmentKyoto Prefectural Agriculture Forestry and Fisheries Technology CenterSoraku-gunJapan
  3. 3.Division of Biological Science, Graduate School of ScienceNagoya UniversityNagoyaJapan
  4. 4.Institute of Transformative Bio-Molecules (WPI-ITbM)Nagoya UniversityNagoyaJapan
  5. 5.JST, ERATO, Higashiyama Live-Holonics ProjectNagoya UniversityNagoyaJapan

Personalised recommendations